Intelligent Design

Proving our point: News from Brazil

Spread the love

Brazilian Intelligent Design Society President emeritus Enézio E. De Almeida Filho informs us that rabid ID-critics in his country are accusing Intelligent Design advocate Dr. William Dembski of fabricating the following quotes from Schopenhauer and J. B. S. Haldane in his book, The Design Revolution: Answering the Toughest Questions About Intelligent Design (Intervarsity Press: Downers Grove IL, 2004, p.20), because he failed to document their sources. These critics, who I’m told are mainly atheists and agnostics, are claiming that the two quotes below are not genuine:

“The acceptance of radical ideas that challenge the status quo (and Darwinism is as status quo as it gets) typically runs through several stages. According to Arthur Schopenhauer, ‘All truth passes through three stages. First, it is ridiculed. Second, it is violently opposed. Third, it is accepted as being self-evident.’ Similarly, evolutionist J. B. S. Haldane remarked, ‘Theories pass through four stages of acceptance: (i) this is worthless nonsense; (ii) this is an interesting, but perverse, point of view; (iii) this is true, but quite unimportant; (iv) I always said so.’” (2004, p. 20)

(NOTE: A lengthier quotation of the above passage can be found in an online article by high school science teacher Stephen E. Jones, titled, “Intelligent Design and the new McCarthyism” (November 25, 2005). See also here for a PDF copy of the Preface of Dembski’s book, The Design Revolution. The quotes from Arthur Schopenhauer and J. B. S. Haldane appear on page 7.)

Commenting on the quotes, Dr. Dembski adds:

“I like to flesh out Haldane’s four stages as follows. First, the idea is regarded as preposterous: the ruling elite feel little threat and, as much as possible, ignore the challenge, but when pressed they confidently assert that the idea is so absurd as not to merit consideration. Second, it is regarded as pernicious: the ruling elite can no longer ignore the challenge and must take active measures to suppress it, now loudly proclaiming that the idea is confused, irrational, reprehensible and even dangerous (thus adding a moral dimension to the debate). Third, it is regarded as possible: the ruling elite reluctantly admits that the idea is not entirely absurd but claims that at best it is of marginal interest; meanwhile, the mainstream realizes that the idea has far-reaching consequences and is far more important than previously recognized. And fourth, it is regarded as plausible: a new status quo has emerged, with the ruling elite taking credit for the idea and the mainstream unable to imagine how people in times past could have thought otherwise. With intelligent design, we are now at the transition from stage two to stage three – from pernicious to possible. This is the hardest transition.” (2004, p. 20)

Did Dembski make the quotes up?

So, did Dr. Dembski fabricate the quotes? The truth is much less dramatic. The substance of the quotes is accurate, but the wording is slightly inaccurate, if we consult the original sources.

What did J. B. S. Haldane say?

Let’s look at Haldane first. The original reference for the quote is listed as follows in Wikipedia article on J. B. S. Haldane:

Haldane, J.B.S. (1963). [Book review] “The Truth About Death: The Chester Beatty Research Institute Serially Abridged Life Tables, England and Wales, 1841-1960” (PDF).Journal of Genetics 58 (3): 464. doi:10.1007/bf02986312. The quote and the review from which it is taken can be viewed online here. Referring to the then-novel idea that actuaries should make use of “cohort” life tables showing the survival and mortality at different ages of men and women born in a given year, Haldane writes:

I suppose the process of acceptance will pass through the usual four stages:

1. This is worthless nonsense,
2. This is an interesting, but perverse, point of view,
3. This is true, but quite unimportant,
4. I always said so.”

Dembski’s quote in The Design Revolution is slightly different:

Theories pass through four stages of acceptance:

(i) this is worthless nonsense;
(ii) this is an interesting, but perverse, point of view;
(iii) this is true, but quite unimportant;
(iv) I always said so.”

I respectfully submit that the minor differences in wording do not affect the meaning of the passage.

What about Schopenhauer?

The quote from Arthur Schopenhauer (1788-1860) has a far more interesting history. As quoted by Dr. Dembski, it reads: “All truth passes through three stages. First, it is ridiculed. Second, it is violently opposed. Third, it is accepted as being self-evident.” As it turns out, Schopenhauer never said that, although he did say something similar. However, it seems that the quote has taken on a life of its own: when I enclosed it in quotes and typed it in Google, I got 126,000 hits, including Brainyquote, Life hack Quotes, Reddit and an article in the Huffington Post. So if Dembski erred, he has lots of company.

A highly informative 2005 article by computer scientist (and ID critic) Dr. Jeffrey Shallit, titled, Science, Pseudoscience, and The Three Stages of Truth catalogs the many and varied political and cultural agendas which this quote (which is widely attributed to Schopenhauer) has been cited in support of:

This dubious Schopenhauer citation has been used to support non-mainstream or controversial views on such diverse topics as the feelings of fish [3], megadose vitamin C therapy [32], drug legalization [25], network marketing [12], acupuncture [33], supranational government [24], repressed memory [28], libertarianism [35], anti-vaccination [9], and human cloning [23]. It has even been cited in a court case in Florida [18]. A common feature of all these citations is the lack of any reference to where in Schopenhauer’s work the quotation can be found.

So, what did Schopenhauer actually say? According to Shallit’s article, what Schopenhauer originally wrote in 1818 was:

Der Wahrheit ist allerzeit nur ein kurzes Siegesfest beschieden, zwischen den beiden langen ZeitrÄaumen, wo sie als Paradox verdammt und als Trivial gering geschÄatzt wird.

Arthur Schopenhauer. Die Welt als Wille und Vorstellung. 1818.

This is commonly translated in English as follows:

To truth only a brief celebration of victory is allowed between the two long periods during which it is condemned as paradoxical, or disparaged as trivial.

English translation by E. F. J. Payne in The World as Will and Representation, Volume I, Falcon’s Wing Press, Indian Hills, Colorado, 1958. Preface to the First Edition, p. xxv.

However, on a discussion thread over at Metabunk.org, one commenter named Herman Aven pointed out that the above translation “leaves a lot to be desired,” and that it a better translation which “keeps logic, flow and meaning intact” would be as follows:

The truth is always destined to have only one brief victory parade between two long time spans in which it’s first being condemned as paradoxical and then belittled as trivial.​

So according to Schopenhauer, there are indeed three stages: a long period when a truth is “condemned as paradoxical,” a short, violent phase during which it triumphs over error and enjoys “only one brief victory parade,” and a long final stage in which the now-universally accepted truth is “belittled as trivial.”

Now compare that with the wording in Dembski’s quote: “First, it is ridiculed. Second, it is violently opposed. Third, it is accepted as being self-evident.”

Not such a big difference, is there? Metabunk commenter Herman Aven appears to agree, for he remarks that the popular misquote paraphrases the meaning of what Schopenhauer said (emphasis mine):

The attribution therefore is not literal but paraphrastic. While it’s not clear why that has happened, the basic meaning has been left intact while the interesting emphasis of the shortness of the middle stage disappeared. So it would be indeed good to reintroduce the original text again.

ID critic Michael Shermer at one time accepted the popular attribution, as well

In his 1997 best-seller, Why People Believe Weird Things: Pseudoscience, Superstition, and Other Confusions of Our Time (W. H. Freeman & Co; paperback version by Henry Holt and Company; Foreword by Stephen Jay Gould), Intelligent Design critic Michael Shermer apparently accepted at face value the authenticity of the quote that Dembski subsequently attributed to Schopenhauer in The Design Revolution (2004). On page 50 of his book, Shermer attacks the stupidity of people who justify their denial of the Holocaust by citing this saying of Schopenhauer’s (emphases mine – VJT):

Reprinted in the January/February 1996 issue of the “Journal of Historical Review”, the organ of Holocaust denial, is a famous quote from the nineteenth-century German philosopher Arthur Schopenhauer, which is quoted often by those on the margins: “All truth passes through three stages. First, it is ridiculed. Second, it is violently opposed. Third, it is accepted as self-evident.” But “all truth” does not pass through these stages. Lots of true ideas are accepted without ridicule or opposition, violent or otherwise. Einstein’s theory of relativity was largely ignored until 1919, when experimental evidence proved him right. He was not ridiculed, and no-one violently opposed his ideas. The Schopenhauer quote is just a rationalization, a fancy way for those who are ridiculed or violently opposed to say, “See, I must be right.” Not so.

The reader will notice that even as he describes the Schopenhauer quote as a “rationalization,” Shermer does not contest its authenticity.

I might also add that Dr. Dembski, in attributing the saying to Schopenhauer, nowhere attempts to argue that because Intelligent Design is vehemently opposed by its critics, therefore it must be true. Rather, what he says is: “The acceptance of radical ideas that challenge the status quo (and Darwinism is as status quo as it gets) typically runs through several stages.” He then proceeds to list the stages described by Schopenhauer and by J. B. S. Haldane, before going on to suggest that the public’s view of Intelligent Design is currently going through a critical stage, where popular opinion of it changes “from pernicious to possible.” In other words, Dr. Dembski is invoking the stages described by Schopenhauer and by J. B. S. Haldane, purely in order to make a sociological observation. And that’s all.

How did the popular version of the saying attributed to Schopenhauer arise?

For those readers who are interested, the Wikiquote article on Arthur Schopenhauer contains a detailed discussion of where the popular version of the saying attributed to Schopenhauer may have come from. Apparently, similar versions can be found in 19th century medical journals, but with no reference to Schopenhauer. Here’s one:

“For it is ever so with any great truth. It must first be opposed, then ridiculed, after a while accepted, and then comes the time to prove that it was not new, and that the credit of it belongs to some one else.”
(Dr. J. Marion Sims, 1868, Richmond & Louisville Medical Journal, Vol. 7, p. 290)

Summary

I conclude that Dembski’s quote from J. B. S. Haldane in The Design Revolution does not materially differ from the original, while the alleged quote from Arthur Schopenhauer is a paraphrase of something which he actually said, in 1818. In the original version, there are also three stages that each new truth has to pass through, before it is universally accepted.

The accusation, made by certain (unnamed) ID critics in Brazil, that Intelligent Design author Dr. William Dembski has made up two quotes from Schopenhauer and J. B. S. Haldane, I find altogether baseless.

Dr. Shallit’s beef with Dr. Dembski

Dr. Shallit, however, appears to think otherwise. In a comment on a thread over at Panda’s Thumb titled, Dembski’s Curious Incompetence With Quotations, he argues that Dr. Dembski, who has “two master’s degrees and two Ph. D.’s,” exhibits “a certain contempt for accuracy incompatible with being a scholar — no matter how many degrees he has.” (I note for the record that Dr. Shallit has one Ph.D. from the University of California, Berkeley, which he obtained in June 1983. To give credit where credit is due, I should also mention that he collaborated on a paper with the late mathematician Paul Erdős in 1991.) What seems to have irked Shallit was that the Schopenhauer quote, which was used in a preliminary version of Dembski’s book, The Design Revolution, in May 2002, re-appeared in April 2004, when the book was published by Intervarsity Press, despite the fact that Shallit had repeatedly warned Dembski that the Schopenhauer quote was “very probably specious” and “in all likelihood fabricated.” Dembski’s response, according to Shallit, was: “Prove me wrong.”

But as we’ve seen, the alleged quote from Schopenhauer wasn’t fabricated; nor was it specious. It was simply a paraphrase.

The story doesn’t end there, however. On April 14, 2014, Dembski authored an article titled, Dealing with the Backlash Against Intelligent Design, in which he expressed himself much more cautiously (emphasis mine):

Increasingly, design theorists and their program are regarded not merely as misguided and pseudoscientific but also as perverse and evil. In a quote widely attributed to Arthur Schopenhauer, “All truth passes through three stages: First it is ridiculed. Second, it is violently opposed. Third, it is accepted as being self-evident.” There’s no question that we’ve now entered Schopenhauer’s second stage.

Contrary to Dr. Shallit’s claim that Dembski made no attempt to correct his errors, here we see him publicly acknowledging that the quote from Schopenhauer is a popular attribution – which means that its accuracy cannot be guaranteed.

Not the words, but the substance: A passage from Charles Dickens

Reading through these exchanges, I was suddently reminded of a passage from Charles Dickens’ novel, Great Expectations, which I had not read since 1977 (the year I graduated from high school). I hope my readers won’t mind if I reproduce a brief excerpt from Chapter 18 of the book (emphases are mine – VJT), in which the narrator tells the story of how, under the sway of one man’s biased portrayal of the trial, he and a group of his friends came to believe that a man accused of murder in the newpapers was guilty, before a verdict had even been pronounced, when a stranger (who turned out to be a lawyer named Mr. Jaggers) suddenly intervened:

It was in the fourth year of my apprenticeship to Joe, and it was a Saturday night. There was a group assembled round the fire at the Three Jolly Bargemen, attentive to Mr. Wopsle as he read the newspaper aloud. Of that group I was one.

A highly popular murder had been committed, and Mr. Wopsle was imbrued in blood to the eyebrows. He gloated over every abhorrent adjective in the description, and identified himself with every witness at the Inquest. He faintly moaned, “I am done for,” as the victim, and he barbarously bellowed, “I’ll serve you out,” as the murderer. He gave the medical testimony, in pointed imitation of our local practitioner; and he piped and shook, as the aged turnpike-keeper who had heard blows, to an extent so very paralytic as to suggest a doubt regarding the mental competency of that witness. The coroner, in Mr. Wopsle’s hands, became Timon of Athens; the beadle, Coriolanus. He enjoyed himself thoroughly, and we all enjoyed ourselves, and were delightfully comfortable. In this cozy state of mind we came to the verdict Wilful Murder.

Then, and not sooner, I became aware of a strange gentleman leaning over the back of the settle opposite me, looking on. There was an expression of contempt on his face, and he bit the side of a great forefinger as he watched the group of faces.

“Well!” said the stranger to Mr. Wopsle, when the reading was done, “you have settled it all to your own satisfaction, I have no doubt?”

Everybody started and looked up, as if it were the murderer. He looked at everybody coldly and sarcastically.

“Guilty, of course?” said he. “Out with it. Come!”

“Sir,” returned Mr. Wopsle, “without having the honour of your acquaintance, I do say Guilty.” Upon this, we all took courage to unite in a confirmatory murmur.

………

“Come!” said the stranger, “I’ll help you. You don’t deserve help, but I’ll help you. Look at that paper you hold in your hand. What is it?”

“What is it?” repeated Mr. Wopsle, eyeing it, much at a loss.

“Is it,” pursued the stranger in his most sarcastic and suspicious manner, “the printed paper you have just been reading from?”

“Undoubtedly.”

“Undoubtedly. Now, turn to that paper, and tell me whether it distinctly states that the prisoner expressly said that his legal advisers instructed him altogether to reserve his defence?

“I read that just now,” Mr. Wopsle pleaded.

“Never mind what you read just now, sir; I don’t ask you what you read just now. You may read the Lord’s Prayer backwards, if you like – and, perhaps, have done it before to-day. Turn to the paper. No, no, no my friend; not to the top of the column; you know better than that; to the bottom, to the bottom.” (We all began to think Mr. Wopsle full of subterfuge.) “Well? Have you found it?”

“Here it is,” said Mr. Wopsle.

“Now, follow that passage with your eye, and tell me whether it distinctly states that the prisoner expressly said that he was instructed by his legal advisers wholly to reserve his defence? Come! Do you make that of it?”

Mr. Wopsle answered, “Those are not the exact words.”

“Not the exact words!” repeated the gentleman, bitterly. “Is that the exact substance?”

“Yes,” said Mr. Wopsle.

“Yes,” repeated the stranger, looking round at the rest of the company with his right hand extended towards the witness, Wopsle. “And now I ask you what you say to the conscience of that man who, with that passage before his eyes, can lay his head upon his pillow after having pronounced a fellow-creature guilty, unheard?”

We all began to suspect that Mr. Wopsle was not the man we had thought him, and that he was beginning to be found out.

I’d like to return to Mr. Jaggers’ remark:

“Not the exact words!” repeated the gentleman, bitterly. “Is that the exact substance?”

I have to say that I find it amazing that there exist people in Brazil, some 7,000 kilometers from the United States, who apparently have nothing better to do with their time than rake over old coals and resurrect accusations that were made a decade ago.

I also find it amazing that these nit-picking individuals fail to see the wood for the trees. What I have attempted to show in this post is that while the two quotes by Dembski are not correct word for word, they are certainly accurate as to their substance. Schopenhauer did speak of truths as going through three stages in the process of winning universal acceptance, and the four stages listed by J. B. S. Haldane were spot-on, in Dembski’s quote.

Finally, I submit that the carping nature of the criticisms made by these individuals only serves to prove our point that criticisms of Intelligent Design have no solid scientific basis. If there were one, we would be hearing about it. Instead, we find that the inability of our critics to account for the origin of new classes of proteins, the origin of the genome and the origin of life itself, to say nothing of the origin of major animal groups, remains as glaring as it was ten years ago. Descending into historical nit-picking does their cause no service.

Wise words from William Dembski

I’d like to conclude with a final quotation from Dr. William Dembski’s article, Dealing with the Backlash Against Intelligent Design, in which he warns ID advocates against getting mad at the critics of Intelligent Design:

The hardcore critics with whom I regularly deal are intellectual bullies, and they don’t deserve to be placated. What’s more, they are not very frightening, especially when you get past their initial defenses, so there’s no reason to flee.

Fighting, however, is not advised either. The problem with fighting is that it consumes valuable energies and is motivated by anger, which always distorts mental clarity and distracts from the real issues. As John Cassian noted over 1,500 years ago,

No matter what provokes it, anger blinds the soul’s eyes, preventing it from seeing the Sun of righteousness. Leaves, whether of gold or lead, placed over the eyes, obstruct the sight equally, for the value of the gold does not affect the blindness it produces. Similarly, anger, whether reasonable or unreasonable, obstructs our spiritual vision. Our incensive power can be used in a way that is according to nature only when turned against our own impassioned or self-indulgent thoughts.

So, let’s put anger aside. Let the other side fume with indignation. Indeed, many of them have turned indignation into a full-time occupation.

Wise words indeed. As I have spent quite enough time writing this post, I shall put down my pen (so to speak), and throw the discussion open to readers. What do you think?

37 Replies to “Proving our point: News from Brazil

  1. 1
    Andre says:

    Dr Torley

    On this very blog we saw the same tactic used by our opponents we say something or quote something and we are accused of a very different charge or intention.

    Prof Moran has made it clear that we are all anti-evolution when in fact we are only opposing and questioning the idea that unguided evolution is capable of explaining the complexity we see.

    This tactic is nothing new to any of us.

  2. 2
    mk says:

    hi uncommondescent. there is a new paper by dr tomkins that disprove the claim of biologos about the vitelogenin pseudo gene:

    https://answersingenesis.org/genetics/dna-similarities/challenging-biologos-claim-vitellogenin-pseudogene-exists-in-human-genome/

    very interesting paper that i think worth a discussion.

  3. 3
    News says:

    Another great piece by Vince Torley. From a news perspective, the main thing to see here is the extent to which this is the level at which these people feel they can still argue, in defense of a purely Darwinian understanding of evolution.

    It is worth keeping in mind however, that a great many people will find this level sufficient to their need for information.

  4. 4
    Seversky says:

    It all seems like much ado about nothing. It’s just another version of the “They all laughed at Columbus” trope to which Carl Sagan gave the perfect answer:

    But the fact that some geniuses were laughed at does not imply that all who are laughed at are geniuses. They laughed at Columbus, they laughed at Fulton, they laughed at the Wright Brothers. But they also laughed at Bozo the Clown.

    The important takeaway from this is how does “truth” triumph and just what exactly is truth. Is it, as another trope has it, that the new “truth” becomes established only when enough supporters of the old die off? That doesn’t seem to say much about the new “truth”, does it? Just that its supporters will, at some point, outnumber its opponents, not that it’s been established as true by any method of investigation.

  5. 5
    EugeneS says:

    “It all seems like much ado about nothing.”

    Who could have thought otherwise?! Of course, it is unimportant…

    There is no way to establish what is true in science except by borrowing from outside of science. Science cannot deal with it. It cannot prove or disprove e.g. solipsism. It genuinely rests upon belief as a principle.

  6. 6
    bornagain says:

    Thanks mk @ 2, interesting paper.

    Challenging the BioLogos Claim that a Vitellogenin (Egg-Laying) Pseudogene Exists in the Human Genome
    by Jeffrey P. Tomkins on October 21, 2015
    Excerpt: The BioLogos organization promotes hypothetical broad-scale vertebrate macroevolution as real science (Luskin 2014). One of the chief arguments they put forth as evolutionary proof is the idea that the human genome contains the 150 base remnant of an eggyolk related vitellogenin (vtg) gene acquired through descent from a common ancestor shared with chicken. However, research described in this report shows that the alleged vtg fragment in human is only 62% identical to its alignable counterpart in the chicken vtg1 gene (exon 3). Moreover, the actual chicken vtg1 gene is 42,637 bases long (not including promoter sequence) so the alleged vtg fragment in human actually represents less than 1% of the original ancestral gene. Even in an evolutionary sense, to say that a pseudogene can be identified by only 0.35% of the original sequence is quite a stretch of the Darwinian paradigm.

    However, the real story is that the alleged 150 base vtg sequence is not a pseudogene remnant at all, but a functional enhancer element in the fifth intron of a “genomic address messenger” (GAM) gene. This particular GAM gene produces long noncoding RNAs that have been experimentally shown to selectively inhibit the translation of known target genes, a majority of which have been implicated in a variety of human diseases. Messenger RNAs from this particular gene are also known to be expressed in a variety of human brain tissues in both fetal and mature subjects in three separate studies.

    All of the combinatorial data presented in this report clearly show that the alleged vtg pseudogene fragment is a functional enhancer element in a GAM gene expressed in the human brain—overturning the idea that this sequence is an egg-laying pseudogene genomic fossil.
    https://answersingenesis.org/genetics/dna-similarities/challenging-biologos-claim-vitellogenin-pseudogene-exists-in-human-genome/

    Dr Torley, will you now retract the claim that you made yesterday for common descent, based on the egg laying gene, since the claim has now, apparently, laid a big goose egg in regards to being credible? 🙂

    “we find switched-off genes coding for the production of egg yolks in human DNA. Only the hypothesis that humans are descended from an eggg-laying ancestor can explain that.”
    http://www.uncommondescent.com.....ent-584669

    Moreover, seeing just how far out of wack the claimed genetic evidence for common descent actually was from reality, if I were you, I would seriously consider rigorously questioning just how reliable any of the other supposed genetic evidences are that Darwinists and/or theistic evolutionists have tried to feed you.

  7. 7
    Barry Arrington says:

    The most widely quoted Chesterton line of all time: “When a man stops believing in God he doesn’t then believe in nothing, he believes anything.”

    Umberto Eco said he wrote an entire novel, Foucault’s Pendulum, based on it.

    The problem is that while Chesterton wrote plenty of which this would be be a plausible paraphrase, he apparently never wrote exactly that. But it does quite accurately capture the gist of what he wrote. See here for a discussion.

    Seversky is surely correct in 4, “much ado about nothing.”

    It seems to me a sign of desperation when Dembski’s opponents are reduced to raising such trivialities.

  8. 8
    StephenB says:

    No matter what provokes it, anger blinds the soul’s eyes, preventing it from seeing the Sun of righteousness. Leaves, whether of gold or lead, placed over the eyes, obstruct the sight equally, for the value of the gold does not affect the blindness it produces. Similarly, anger, whether reasonable or unreasonable, obstructs our spiritual vision. Our incensive power can be used in a way that is according to nature only when turned against our own impassioned or self-indulgent thoughts.

    I disagree. Anger is the appropriate response to outrage. Without it, few will be motivated to right the wrongs of the world. The problem is not anger but rather what some people do with it. We are supposed to use anger and not be used by it. Losing control is the great sin. That is what impairs judgment.

    If you want to read real words of wisdom, try Aristotle: “Anybody can become angry – that is easy, but to be angry with the right person and to the right degree and at the right time and for the right purpose, and in the right way – that is not within everybody’s power and is not easy.”

  9. 9
    Orloog says:

    Sorry, I have to disagree: yes, he got the gist right, but the differences to the originals make it clear that Dr. Dembski didn’t bother to check the quotes, but relied on his memory or secondary sources only.

    And that’s how dubious quotes can creep in. See:

    https://www.youtube.com/watch?v=dx8siugG440

  10. 10
    StephenB says:

    Fighting, however, is not advised either. The problem with fighting is that it consumes valuable energies and is motivated by anger, which always distorts mental clarity and distracts from the real issues. As John Cassian noted over 1,500 years ago,

    This, too. is wrong. When you are in a culture war, you either win or you lose. If you don’t fight, you don’t win. The task is to fight and love at the same time. Most people who are good at loving are not good at fighting; most people who are good at fighting are not good at loving. Our task is to do both at the same time.

  11. 11
    Orloog says:

    What I have attempted to show in this post is that while the two quotes by Dembski are not correct word for word, they are certainly accurate as to their substance.

    Accuracy as to its substance is nice and dandy, but if you start to put something into quotation marks, the reader expects accuracy as to its words.

    Your defence of Dr. Dembski’s lack of accuracy boils down to fake, but accurate!

  12. 12
    Orloog says:

    Contrary to Dr. Shallit’s claim that Dembski made no attempt to correct his errors, here we see him publicly acknowledging that the quote from Schopenhauer is a popular attribution – which means that its accuracy cannot be guaranteed.

    W. Dembski didn’t correct his mistake, he just didn’t repeat it!

  13. 13
    Roy says:

    So Dembski misquoted Haldane and Schopenhauer, in ways that affect their meaning*, and because he didn’t reference any secondary source the responsibility is his and his alone. This isn’t unusual. Somewhere between 20% and 50% of quotes cited by creationists and IDers prove incorrect on inspection, mainly because of the cottage industry of quote-sharing. Nor is his attitude when queried atypical – I know from experience how little Creationists/IDers care about whether their ‘quotes’ are accurate, and the sources they actually use are unimpressive.**

    But all this is beside the point. Dembski is supposed to be one of the leading lighths of ID research. If he is this careless and unconcerned about the accuracy of the quotations he cites, there is no reason to believe he would be any more careful or conscientious about facts or data. His lack of attention to detail here and more especially his failure to correct reported issues cast doubt on everything else he writes.

    He has lost credibility.

    Roy

    *Haldane wasn’t referring to scientific theories; Schopenhauer’s brief central stage was of acceptance, not violent opposition.

    **cf Jorge, kairosfocus and others

  14. 14
    Mung says:

    Roy:

    I know from experience how little Creationists/IDers care about whether their ‘quotes’ are accurate…

    Of course you do Roy. I’ll just dispose of my library. Who needs to be able to verify sources anyways, when you can just make stuff up.

  15. 15
    NickMatzke_UD says:

    2
    mkOctober 26, 2015 at 5:03 am
    hi uncommondescent. there is a new paper by dr tomkins that disprove the claim of biologos about the vitelogenin pseudo gene:

    LINK

    very interesting paper that i think worth a discussion.

    Not really that interesting. As usual Tomkins arbitrarily narrows his focus and thus conducts his analyses in a dumb way.

    E.g.:

    1. The original paper looked at these genes/pseudogenes not just in chickens and humans, but also platypus, marsupials, etc. Sequence comparisons get better and more reliable with more organisms being aligned, but Tomkins just isolates the human/chicken comparison and a narrow region around the pseudogene. I searched the Tomkins paper on platypus, marsupial, etc. and found…bubkis.

    2. The synteny argument for homology is much more than just one gene (Tomkins’s claim), there are big chunks of synteny throughout chicken chromosome 8 vs. Human chromosome 1. I did a YASS alignment of the two, search ID is: Oct_26_2015_16_16_19_80947975

    Here’s a link to the dotplot:
    http://bioinfo.lifl.fr/cgi-bin.....9_80947975

    Zoom in on:
    Query (chicken):
    17000000
    18000000

    Target (human)
    75000000
    85000000

    3. BLAST, as part of the YASS dotplot search readily identifies the human/chicken homolog:

    *(17538291-17537642)(79254161-79254787) Ev: 1.10916e-76 s: 650/627 r
    * “8_dna_rm:chromosome_chromosome:Galgal4:8:1:28767244:1_REF” (28767244 bp) / “1_dna_rm:chromosome_chromosome:GRCh37:1:1:249250621:1_REF” (249250621 bp)
    * score = 930 : bitscore = 304.99
    * mutations per triplet 58, 59, 55 (4.44e-03) | ts : 88 tv : 84 | entropy : 5.36794

    |17538290 |17538280 |17538270 |17538260 |17538250 |17538240 |17538230
    AGCGTGCAATAAAAATATACAATTGAGGATGACAAAGGATGTCATCTGGGACCCTGCA–GAAAAAGAAGCCACCAGATT
    ||.:||||||||:|.|:||..|||…|.|||..|.:.|.||.:|.|:::.|||||.| |.|.||:|||. |:|:|
    AGAATGCAATAAGATTGTAATATTTTTGCTGAATATATAGGTAGTATAAATCCCTGAAATGCATAAAAAGA—-AAACT
    |79254170 |79254180 |79254190 |79254200 |79254210 |79254220 |79254230

    |17538210 |17538200 |17538190 |17538180 |17538170 |17538160 |17538150
    ACATTAATTATGCTAAATATTGAATCACATCCAGCTACTGTCGTATGTTTTATTGCCTTTCGTTTGCTGGCTACGAAATC
    ||||.|||:|||:|||||||::|:..|||::.|:||.:| ||:|| ||||.||| |||| |||.:||:|||||.
    ACATGAATCATGTTAAATATCAAGAAACACTGAACTCTT——TGCTT–TTGCATTT-GTTT-CTGCTTATGAAATA
    |79254240 |79254250 |79254260 |79254270 |79254280 |79254290

    |17538130 |17538120 |17538110 |17538100 |17538090 |17538080 |17538070
    AGTTGATTAAATAATCCTAGGTTGTACAG-TTTGGAACAATTGGATTGATCCAATAACAAATTACTGTGCATTTCAAATT
    ||||||||||||||||:.|:|||:||::| |||||.|||||||:|||||||:.:.||:|||:|:|||||||||:.|||||
    AGTTGATTAAATAATCTAAAGTTATATGGTTTTGGTACAATTGAATTGATCTTGGAATAAACTGCTGTGCATTCAAAATT
    |79254310 |79254320 |79254330 |79254340 |79254350 |79254360 |79254370

    |17538050 |17538040 |17538030 |17538020 |17538010 |17538000 |17537990
    ACATTCCATTGTCTCCCTGGCCACAAAGCAGAAGAAATCCTTCAAGCCCAAGGTTGGCTTGAGCTGAGAATTACCTGGC-
    |:::||:||||||||||||:.|||||||||||||||||||:||||||||||||||:||||||||||||||||::|||||
    ATGCTCTATTGTCTCCCTGAGCACAAAGCAGAAGAAATCCCTCAAGCCCAAGGTTAGCTTGAGCTGAGAATTGTCTGGCT
    |79254390 |79254400 |79254410 |79254420 |79254430 |79254440 |79254450

    |17537970 |17537960 |17537950 |17537940 |17537930 |17537920 |17537910
    AAAGTGC-AAATAGAATTTAGAGCACTGAA-TAAAAAAACAGTAGTGTTAGTTACATTCTGCCTGAGTAAGCACAACATA
    |.||||: ||||:||||||||:.:.|||.| |…………|..|||||||||||||||.||||||||||.||||||
    ACAGTGTGAAATGGAATTTAGGCTTCTGCATTNNNNNNNNNNNNGACTTAGTTACATTCTGCATGAGTAAGCAAAACATA
    |79254470 |79254480 |79254490 |79254500 |79254510 |79254520 |79254530

    |17537890 |17537880 |17537870 |17537860 |17537850 |17537840 |17537830
    TGATGAAACTTAATTACTTCCCAAAAGCTTNNNNNNNNNNNCCCAACAAACTGGTATC—-AAGAGAATTTTACCTTTC
    ||||||||||||||||:||.:|.||||||| .|||.:|.|||| |||:.||||::|.|||||
    TGATGAAACTTAATTATTTGTCCAAAGCTT—————-GAAAACGTTATCAAAGAAGGTAATTCCAGCTTTC
    |79254550 |79254560 |79254570 |79254580 |79254590 |79254600

    |17537820 |17537810 |17537800 |17537790 |17537780 |17537770 |17537760 |17537750
    AAATTGAATAAATTTTCTTACCCTAATAAGACAAAGTTTTGGTCCAATACCACTAATTTCCACTTCACTTCTTATCCTTA
    ||||||:|||.|||||||||||:||||||:||..:||||::|.:|.:|:|||.|:|:|||:||||:||||:||:|::.:|
    AAATTGGATATATTTTCTTACCTTAATAAAACTTGGTTTCAGATCTGTGCCAGTGACTTCTACTTTACTTTTTGTTTACA
    |79254620 |79254630 |79254640 |79254650 |79254660 |79254670 |79254680

    |17537740 |17537730 |17537720 |17537710 |17537700 |17537690 |17537680 |17537670
    TTCCAGTTCTTGCAAGTCCTTTCTCTGGAATACCACTGAAAAGTATGCTTTCATAATTGTATGTATAAACCTTATTTTCA
    |:||||.||||.:||||.||.| |.|||||…|||| |:||:|:|:||||||||.||:.|..:||||::|.:.:||||
    TCCCAGGTCTTCTAAGTACTGT-TGTGGAAATACACT-AGAAATGTACTTTCATATTTAGAATCATAAGTCACCCTTTC-
    |79254700 |79254710 |79254720 |79254730 |79254740 |79254750 |79254760

    |17537660 |17537650
    CCAAAATCAGGTTCTGCAAA
    :.:||:|:||||||||.|||
    TGGAAGTTAGGTTCTGAAAA
    |79254770

    4. All of this was fairly obvious from the original Brawand et al. 2008 PLoS Biology paper, “Loss of Egg Yolk Genes in Mammals and the Origin of Lactation and Placentation”, doi: 10.1371/journal.pbio.0060063 , especially the dot-plot in Figure 2 and the alignments in the Supplemental Material. This is the paper that BioLogos cites and which Tomkins criticizes.

    Human:
    AACCTAACTTCCA-GAAAGGGTGACTTATGATTCTAAATATGAAAGTACA-TTTCTAGTGTATTTCCACA-ACAGTACTTAGAAGACCTGGGATGTAAACAAAAAGTAAAGTAGAAGTCACTGGCACAGATCTGAAACCAAGTTTTATTAAG

    Chicken:
    AACCTGATTTTGGTGAAAATAAGGTTTATACATACAATTATGAAAGCATACTTTTCAGTGGTATTCCAGAGAAAGGACTTGCAAGAACTGGAATAAGGATAAGAAGTGAAGTGGAAATTAGTGGTATTGGACCAAAACTTTGTCTTATTAGG

  16. 16
    Mung says:

    I would buy a book on macro-evolution by Nick Matzke just so I could be sure I had my sources right, if one existed.

  17. 17
    Barry Arrington says:

    Another point that has not been raised but should be is this: The issue addressed in the quotations, while interesting, is a completely collateral matter. The progression from opposition to acceptance of truth claims is interesting. But that is not what Dembski’s book is about. There is no allegation, as far as I am aware, that Dembski misquoted any source with respect to evolution or ID.

    Up thread Roy is eager to say Dembski is discredited by this tempest in a teapot. That says more about Roy than it does about Dembski.

  18. 18
    Barry Arrington says:

    BTW, am I the only one who had to look twice at the picture of Haldane? At first glance it sure looked like he was making an obscene gesture toward the photographer. 🙂

  19. 19
    bornagain says:

    NickMatzke_UD, and since you have never honestly owned up to your literature bluff against Behe, and rightly apologized for being wrong and/or dishonest in your literature bluff, your credibility is suppose to be above zero how exactly?

    Calling Nick Matzke’s literature bluff on molecular machines – DonaldM UD blogger – April 2013
    Excerpt: So now, 10 years later in 2006 Matzke and Pallen come along with this review article. The interesting thing about this article is that, despite all the hand waving claims about all these dozens if not hundreds of peer reviewed research studies showing how evolution built a flagellum, Matzke and Pallen didn’t have a single such reference in their bibliography. Nor did they reference any such study in the article. Rather, the article went into great lengths to explain how a researcher might go about conducting a study to show how evolution could have produced the system. Well, if all those articles and studies were already there, why not just point them all out? In shorty, the entire article was a tacit admission that Behe had been right all along.
    Fast forward to now and Andre’s question directed to Matzke. We’re now some 17 years after Behe’s book came out where he made that famous claim. And, no surprise, there still is not a single peer reviewed research study that provides the Darwinian explanation for a bacterial flagellum (or any of the other irreducibly complex biological systems Behe mentioned in the book). We’re almost 7 years after the Matzke & Pallen article. So where are all these research studies? There’s been ample time for someone to do something in this regard.
    Matzke will not answer the question because there is no answer he can give…no peer reviewed research study he can reference, other than the usual literature bluffing he’s done in the past.
    http://www.uncommondescent.com.....ent-453291

    Matzke tried the same literature bluff technique when Meyer’s book Darwin’s Doubt came out:

    A Graduate Student (Nick Matzke) Writes – David Berlinski July 9, 2013
    http://www.evolutionnews.org/2.....74221.html

    A One-Man Clade – David Berlinski – July 18, 2013
    http://www.evolutionnews.org/2.....74601.html

    Hopeless Matzke -David Berlinski & Tyler Hampton August 18, 2013
    http://www.evolutionnews.org/2.....75631.html

    Nick Matzke also had a major part in the literature bluff stunt at the Dover trial:

    “A Masterful Feat of Courtroom Deception”: Immunologist Donald Ewert on Dover Trial – audio
    http://intelligentdesign.podom.....1_03-08_00

    If there were a criminal justice system in science for punishing those who willfully misrepresent evidence, Matzke would easily qualify for the harshest penalty allowable for repeatedly violating that most sacred of trusts within science, i.e. the ‘sacred trust’ of not misrepresenting the actual state of evidence to fellow scientists and citizens!

  20. 20
    Mung says:

    At least he didn’t misquote anyone!

  21. 21
    mk says:

    hi nick. we are talking about the vitellogenin and not other genes. so tomkins find that this “pseudogene” isnt pseudo at all but a part of a functional gene. so the claim about remains of egg yolk gene in human disproved. do you agree with this?

  22. 22
    kairosfocus says:

    Roy,

    it seems that your intransigence and naming me suggest that, au contraire, the cites that so obviously get your goat are cogent and substantial.

    Just for fun, here is Orgel, 1973 — and the book is next to me (Amazon, Abe Books etc are wonderful):

    . . . In brief, living organisms are distinguished by their specified complexity. Crystals are usually taken as the prototypes of simple well-specified structures, because they consist of a very large number of identical molecules packed together in a uniform way. Lumps of granite or random mixtures of polymers are examples of structures that are complex but not specified. The crystals fail to qualify as living because they lack complexity; the mixtures of polymers fail to qualify because they lack specificity . . . .

    [HT, Mung, fr. p. 190 & 196 . . . why we went out and sourced the physical book:] These vague idea can be made more precise by introducing the idea of information. Roughly speaking, the information content of a structure is the minimum number of instructions needed to specify the structure. [–> this is of course equivalent to the string of yes/no questions required to specify the relevant “wiring diagram” for the set of functional states, T, in the much larger space of possible clumped or scattered configurations, W, as Dembski would go on to define in NFL in 2002, also cf here, here and here (with here on self-moved agents as designing causes).] One can see intuitively that many instructions are needed to specify a complex structure. [–> so if the q’s to be answered are Y/N, the chain length is an information measure that indicates complexity in bits . . . ] On the other hand a simple repeating structure can be specified in rather few instructions. [–> do once and repeat over and over in a loop . . . ] Complex but random structures, by definition, need hardly be specified at all . . . . Paley was right to emphasize the need for special explanations of the existence of objects with high information content, for they cannot be formed in nonevolutionary, inorganic processes. [The Origins of Life (John Wiley, 1973), p. 189, p. 190, p. 196. Of course, that immediately highlights OOL, where the required self-replicating entity is part of what has to be explained (cf. Paley here), a notorious conundrum for advocates of evolutionary materialism; one, that has led to mutual ruin documented by Shapiro and Orgel between metabolism first and genes first schools of thought, cf here. Behe would go on to point out that irreducibly complex structures are not credibly formed by incremental evolutionary processes and Menuge et al would bring up serious issues for the suggested exaptation alternative, cf. his challenges C1 – 5 in the just linked. Finally, Dembski highlights that CSI comes in deeply isolated islands T in much larger configuration spaces W, for biological systems functional islands. That puts up serious questions for origin of dozens of body plans reasonably requiring some 10 – 100+ mn bases of fresh genetic information to account for cell types, tissues, organs and multiple coherently integrated systems. Wicken’s remarks a few years later as already were cited now take on fuller force in light of the further points from Orgel at pp. 190 and 196 . . . ]

    And BTW, Dembski has given substantially sound cites, though they are not verbatim; and in describing the progress of controversial ideas as a social-intellectual process, they are very much on the money. Acknowledging intellectual debt to the two apparent main roots is appropriate.

    All that is missing in terms of the dynamics is the one funeral at a time part. Planck, isn’t that?

    KF

  23. 23
    Orloog says:

    “And BTW, Dembski has given substantially sound cites, though they are not verbatim;”

    1) If they are not verbatim, they don’t belong into quotation marks.

    2) Schopenhauer’s quote isn’t “substantially sound”:

    “All truth passes through three stages. First, it is ridiculed. Second, it is violently opposed. Third, it is accepted as being self-evident.”

    a) ridicule
    b) violent opposition
    c) acceptance as self-evident

    “Der Wahrheit ist allerzeit nur ein kurzes Siegesfest beschieden, zwischen den beiden langen Zeiträumen, wo sie als Paradox verdammt und als Trivial gering geschätzt wird.”

    a) ridicule (“als Paradox vedammt”)
    b) general acceptance (“ein kurzes Siegesfest”)
    c) belittlement (“als Trivial gering geschätzt”)

  24. 24
    kairosfocus says:

    Orloog, still straining at gnats while swallowing camels? I suggest, give the man his B grade for not getting the cite letter perfect, and then build on the substantial point. The let’s find a flaw and throw out the baby with the bathwater approach is a grade D or E blunder as a certain Galilean peasant so aptly highlighted. Next problem. KF

  25. 25
    Vy says:

    I know from experience how little Creationists/IDers care about whether their ‘quotes’ are accurate, and the sources they actually use are unimpressive

    Yes, yes. I mean, all evolutionists are known for their always 100% fully sourced and accurate quotes.

    Oh wait . . . this evolutionist, doesn’t just misquote or paraphrase, he fabricates and he’s proud of it.

    Hmm, whudda thunk it?

  26. 26
    Roy says:

    it seems that your intransigence and naming me suggest that, au contraire, the cites that so obviously get your goat are cogent and substantial.

    I named you because I caught you copying a context-free misquote and distorting the author’s meaning by putting emphasis on a word that wasn’t in the original text – and, like Dembski, refusing to divulge your source or confirm its accuracy.

  27. 27
    NickMatzke_UD says:

    21
    mk

    October 26, 2015 at 2:57 pm

    hi nick. we are talking about the vitellogenin and not other genes. so tomkins find that this “pseudogene” isnt pseudo at all but a part of a functional gene. so the claim about remains of egg yolk gene in human disproved. do you agree with this?

    Nope. Rather than explain why, let’s have you investigate this like a scientist would.

    1. What kind of gene does Tomkins say this is?

    2. What is the function supposed to be? Does that sound like it’s nailed down, or vague and speculative?

    3. What’s his reference? Is it peer-reviewed literature?

    4. If you search the term “genomic address messenger” on Google Scholar, and turn off patents first, what do you get?

    5. Does it look like “genomic address messenger” genes are actually a thing in the scientific literature? Or is it just some guy who put out some speculative patents?

    6. Even if it were to be established as a real mRNA gene, does anything really prohibit alleged long functional mRNA thousands or tens of thousands of base pairs long from including 150 base pairs of pseudogene sequence?

  28. 28
    kairosfocus says:

    Roy, the games continue. The fundamental issue remains that you have no sound answer on the origin of functionally specific complex organisation and associated information, for OOL or of body plans up to our own. The record of the world of life clearly shows the islands of function in the fossils and the molecules, all duly full of FSCO/I. The further fact is that the only empirically observed and analytically plausible source of FSCO/I on trillions of cases including your own over the top posts is design. You are patently desperate to not go there with the merits and seem to imagine shoot at any real, imagined or projected imperfections in the messenger will somehow deflect the substantial point. To such, I simply say, I have not claimed to be perfect and have it on good authority that I know in part. Problem is, your tin-eared hostility has not heard the warning from Umpqua, where innocent blood cries up from the ground because madmen are now distilling shoot Christians on sight from the toxic atmosphere the sort of over-wrought hostility that your ilk has mightily striven to achieve. Duly noted. I suggest that you now take some time to actually put first things first. G’day. KF

  29. 29
    rhampton7 says:

    StephenB,

    What does the scientific theory of Intelligent Design have to do with the culture war? ID theory only posits that life on Earth shows evidence of design, hence designers. ID theory does not make any claim about the designers themselves.

  30. 30
    Aleta says:

    to Seversky at #4: from “Bob Dylan’s 115th Dream:

    Well, I rapped upon a house
    With the US flag upon display
    I said, “Could you help me out
    I got some friends down the way
    ” The man says, “Get out of here
    I’ll tear you limp from limb”
    I said, “You know they refused Jesus, too”
    He said, “You’re not Him

  31. 31
  32. 32
    mk says:

    hi nick. aldo my english isnt so well i will try to answer. first-the paper itself is a peer-review (even if its a creationist).

    i do find this gene here:

    http://www.uniprot.org/uniprot/P03702

    but lets say that its isnt a real gene.2 things that we do know: tomkins note that its not in the same place as the chicken vgt. and 2: its too short too recognize it as a real vgt.

    so its 2 important facts to look about.

  33. 33
    NickMatzke_UD says:

    32
    mkOctober 27, 2015 at 5:40 am
    hi nick. aldo my english isnt so well i will try to answer. first-the paper itself is a peer-review (even if its a creationist).

    i do find this gene here:

    http://www.uniprot.org/uniprot/P03702

    That’s a link to a protein in a viral phage, and the phage is a virus of Enterobacteria.

    but lets say that its isnt a real gene.2 things that we do know: tomkins note that its not in the same place as the chicken vgt. and 2: its too short too recognize it as a real vgt.

    so its 2 important facts to look about.

    I demonstrated that the synteny alignment is more extensive, I posted the YASS link above. Click through and look at the dot plots.

    150 base pairs is plenty long for any computer search to recognize similarity and distinguish it from chance similarity. And, there are some other regions of similarity in about the right place, as demonstrated in the original 2008 paper.

    Even Uncommon Descent has recognized Tomkins made huge errors in the paper claiming low sequence similarity between human and chimp, why should it be surprising here? Creationist peer-review? Wait, the other paper also had creationist peer-review. Maybe this tells us something about the quality of creationist peer-review…

  34. 34
    Virgil Cain says:

    What makes a chimp a chimp and a human a human, Nick? Please point us to the evolutionary peer-review that goes over that key aspect.

  35. 35
    bornagain says:

    Nick scorns any literature that goes against neo-Darwinism thusly

    “Maybe this tells us something about the quality of creationist peer-review…”

    Which is an interesting comment coming from the dishonest man who fragrantly literature bluffed, and obfuscated, on the immune system, bacterial flagellum, and the Cambrian Explosion, (to name just a few), and never, ever, owned up to to his dishonesty, even though he was caught red handed:

    http://www.uncommondescent.com.....ent-584809

    As to Matzke’s dishonest crusade against Michael Behe and the Bacterial Flagellum in particular

    Finally, a Detailed, Stepwise Proposal for a Major Evolutionary Change? – Michael Behe – March 10, 2015
    Excerpt: I would say its (Nick Matzke’s 2004 proposal for the evolution of the flagellum) chief problem is that it’s terminally fuzzy, bases most of its speculation on sequence comparisons, and glides over difficulties that would have to be dealt with in nature.,,, That’s one reason I wrote The Edge of Evolution — to say that we no longer have to rely on our imaginations, that we have good evidence to show what Darwinian processes are capable of doing. When we look to see what they do when we are watching, we never see the sorts of progressive building of coherent systems that Darwinists imagine. Rather, we see tinkering around the edges with preexisting systems or degradation of complex systems to gain short-term advantage.
    http://www.evolutionnews.org/2.....94271.html

    More Irreducible Complexity Is Found in Flagellar Assembly – September 24, 2013
    Concluding Statement: Eleven years is a lot of time to refute the claims about flagellar assembly made in Unlocking the Mystery of Life, if they were vulnerable to falsification. Instead, higher resolution studies confirm them. Not only that, research into the precision assembly of flagella is provoking more investigation of the assembly of other molecular machines. It’s a measure of the robustness of a scientific theory when increasing data strengthen its tenets over time and motivate further research. Irreducible complexity lives! –
    http://www.evolutionnews.org/2.....77051.html

    Behe’s work in the ‘Edge of Evolution” simply devastates neo-Darwinian arguments

    “The number I cite, one parasite in every 10^20 for de novo chloroquine resistance, is not a probability calculation. Rather, it is a statistic, a result, a data point. (Furthermore, it is not my number, but that of the eminent malariologist Nicholas White.) I do not assume that “adaptation cannot occur one mutation at a time”; I assume nothing at all. I am simply looking at the results. The malaria parasite was free to do whatever it could in nature; to evolve resistance, or outcompete its fellow parasites, by whatever evolutionary pathway was available in the wild. Neither I nor anyone else were manipulating the results. What we see when we look at chloroquine-resistant malaria is pristine data — it is the best that random mutation plus selection was able to accomplish in the wild in 10^20 tries.”
    Michael Behe

    Dr. Behe’s number for the “Edge of Evolution”, (1 in 10^20), has recently been confirmed in the lab:

    Michael Behe – Empirically Observed 1 in 10^20 Limit of Evolution – video – Lecture delivered in April 2015 at Colorado School of Mines
    https://www.youtube.com/watch?v=9svV8wNUqvA

    How Many Ways Are There to Win at Sandwalk? – Michael Behe – August 15, 2014
    Excerpt: ,, with chloroquine resistance in Plasmodium falciparum. The best current statistical estimate of the frequency of de novo resistance is Nicholas White’s value of 1 in 10^20 parasites. That number is now essentially fixed — no pathway to resistance will be found that is substantially more probable than that. Although with more data the value may be refined up or down by even as much as one or two orders of magnitude (to between 1 in 10^18-10^22), it’s not going very far on a log scale. Not nearly far enough to lift the shadow from Darwinism.
    What’s more, we can also conclude that the mutations that have already been found are the most effective available of any combination of mutations whose joint probability is greater than 1 in 10^20, since more effective alternatives would already have occurred and been selected if they were available.,,,
    The bottom line for all of them is that the acquisition of chloroquine resistance is an event of statistical probability 1 in 10^20.,,,
    http://www.evolutionnews.org/2.....88981.html

    Moreover, to add further insult to injury, as hard as it is was for unguided Darwinian processes to account for chloroquine resistance in the malaria parasite, it turns out that the adaptation came at a loss of fitness for the parasite, not a gain.

    Metabolic QTL Analysis Links Chloroquine Resistance in Plasmodium falciparum to Impaired Hemoglobin Catabolism – January, 2014
    Summary: Chloroquine was formerly a front line drug in the treatment of malaria. However, drug resistant strains of the malaria parasite have made this drug ineffective in many malaria endemic regions. Surprisingly, the discontinuation of chloroquine therapy has led to the reappearance of drug-sensitive parasites. In this study, we use metabolite quantitative trait locus analysis, parasite genetics, and peptidomics to demonstrate that chloroquine resistance is inherently linked to a defect in the parasite’s ability to digest hemoglobin, which is an essential metabolic activity for malaria parasites. This metabolic impairment makes it harder for the drug-resistant parasites to reproduce than genetically-equivalent drug-sensitive parasites, and thus favors selection for drug-sensitive lines when parasites are in direct competition. Given these results, we attribute the re-emergence of chloroquine sensitive parasites in the wild to more efficient hemoglobin digestion.
    http://www.plosgenetics.org/ar.....en.1004085

  36. 36
    mk says:

    hi nick. first: tomkins do gave sources from non creationist peer-review papers.

    now about the gene synteny – human also have homologous gene of the vit:

    http://www.ncbi.nlm.nih.gov/pubmed/3265622

    and this gene isnt even close to the pseudo- vit in the genome. so a similar sequence doesnt say a lot.

    of course that chicken and human share a lot of genes. but this is because a commondesign. like 2 cars share a lot of similarity.

  37. 37
    kairosfocus says:

    Note the snipe and scoot tactic, and the rhetorical irresponsibility revealed thereby.

Leave a Reply