Information created accidentally, without design

Notice how posters at UD, when at a loss, open a thread at TSZ? I've never understood why. There's no help over there. Mung

FYI, Alan Fox posted the translation system challenge here. (My main concern is about how often I will have the time to participate, as I was already time stretched. I will contribute as I can.) ericB

Score another for ID theory! Mung

LoL! Alan posted Eric's challenge over on TSZ and as predicted no one is up to the task. Joe

Well Alan it is a given that neither you nor any TSZ regular has a clue. The safe bet is not one of you can produce a testable hypothesis for unguided evolution producing a transcription and traslation process... Joe

Many are those who would not even make the attempt to think it through.

Many? That's a bit of a stretch, ericB! I doubt more than half a dozen people have read your 296. Anyway, I thought I'd go ahead and post your comment as an opening post at TSZ. If there's anything you'd like to correct, you can let me know here or at TSZ. Alan Fox

Alan Fox:

Evolution is a process of environmental design.

Unguided evolution cannot design anything. Alan is a confused liar. There still isn't any scientific theory of unguided evolution. And no one over on TSZ is up to any challenge... Joe

AVS:

“Plenty of evidence for a designer”? Ha, I lost it at that one.

Most likely you were born lost.... Joe

AVS, thanks for diving in! You have gone to the head of the line for being willing to take a stab at this question. When I ask about the origin of a translation system, I am asking about how it comes to be that we have in every living cell a decoding system, i.e. translation via some code. (That's, of course, the distinction of translation from a process such as transcription.) If you look at the description I've provided @296 of the generalized components of a translation system, you'll get a sense of what I'm talking about. They are generalized in the sense that I'm not assuming the original forms were the same as what we see today. The challenge is to see whether it is rational to expect unguided chemicals to make any such system that translates (i.e. decodes) according to a code. You can also get a sense of the nature of the problem from the questions that I ask @362. Please consider whether you think you have answers for those types of questions. Looking forward to hearing your additional thoughts. Thanks again for giving it a shot! Many are those who would not even make the attempt to think it through. ericB

Sorry, missed out the word 'scientific' Alan Fox

@ Biped Of course there is design in nature. Evolution is a process of environmental design. "Intelligent Design" is another matter. There is no theory of ID that I know of, as yet. Alan Fox

ericB @ 362 Your challenge is not going to get much attention on a deeply buried thread on a site with a mixed moderation history. You are welcome to tidy it up and I'll post it at TSZ. Or you can do it yourself, if you don't mind registering. Alan Fox

@ Biped Nobody is arguing for non-natural processes, except maybe ID-proponents. Alan Fox

The process of translation in biology has a physico-chemically arbitrary relationship between the arrangement of nucleotides and their effects because it has to. It's a physical necessity. You are welcome to whatever satisfaction you derive from envisioning a system without it. goodnight Upright BiPed

My system converts nucleic acid sequence into amino acid sequence. Thats translation enough for me, and apparently the rest of the scientific world because thats exactly what the process of translation is in biology. AVS

You don't have translation system until you have a physico-chemically arbitrary relationship instantiated in the system. Upright BiPed

Ah yes, sarcasm. Might I remind you though that the original task was to come up with "one or more coherent scenarios for the creation of a translation system by unguided chemicals." That is what I did. It was you that stormed in asking me to create a translational system that also uses a triplet codon and whatnot else. I answered your friends question, now you want me to do the near impossible and recreate the evolution of gene expression for you....well you can go fuck yourself. AVS

Allow me to be brief as well. Upright BiPed

Well to sum it all up quickly, your extra dimensions arise from small changes to the nucleic acid sequences and the proteins that interact with them. I proposed a mechanism that provides a simple coding system that can then be modified by unguided changes and become more and more complex, like what we see today. AVS

avs, At what point in your scenario is the dimensionality of the code established? In order to produce a functional effect, the current system is established at three nucleotides for each iterative action - plus a start and a stop. Also, you don’t seem to provide any mechanism beyond the determinant forces of inexorable law. You can’t derive - from inexorable law - the relationship that the arrangement of nucleotides has to the effect it produces. That’s not how the system operates. The relationship to the effect is established locally, not globally, and it’s established by a second arrangement of matter that preserves this arbitrary relationship. The relationship has to be there for the very reason that the arrangement of the medium has to produce the effect because inexorable law can’t. It doesn’t have that to give. Not only does it not have that to give, but we already know that the relationship is determined locally within the system. So the origin of system becomes the question, and that question can’t be answered by an appeal to inexorable law alone. So you’re going to need a mechanism to establish the three nucleotide dimension. And you’ll need one to establish the relationships between the differing arrangements and their effects. And you’ll need another to establish enough function within the effect, at least to the level that the system reproduces itself and passes on the relationships that produced it. This represents the rise of the genome, and its required prior to information-based organization. Upright BiPed

So I threw together some ideas about your question above, its very simple but I believe it meets all your requirements, feel free to point out the holes in it so I can explain. -Nucleotides -Nucleic acids -Nucleic acids with catalytic function -Simple protein catalytic activity with simple amino acids forming protein lattices -Single nucleotide pairs with a single amino acid through protein association -Nucleic acids bring amino acids together, forms peptide bonds and simple proteins This is the most basic form of the translational process as we know it today. With nucleic acids and simple proteins being formed and slowly changing structures, their functions can also change and become more complex. AVS

Dr Liddle entered into that conversation without the faintest clue that the existence of information had specific material requirements. She thought an arrangement of matter could result directly in an effect (medium-->effect) apparently with no need of translation. I remember trying to get her to understand there had to be "a break in the causal chain". To this day, I am not certain she even understands why it must exist. But to her credit, she at least attempted to engage the details (which is far more than someone like Alan Fox would allow himself). The only (really only) poor thing to ascribe to Dr Liddle is that when the material facts became clear to her, she didn't have the scientific integrity to accomodate those facts in her conclusions. Too bad. Upright BiPed

ericB:

Calling all evolutionists / materialists! Your help is needed! Alan Fox has not been able to answer a particular challenge, but perhaps you know an answer.

Elizabeth Liddle famously (or was it infamously) once asserted here at UD that she could do precisely this. It never happened. Right Upright BiPed? Mung

EL

It both causes and is caused by things. It contains information in the sense that its sequence, to requote Merriam Webster “produce[s] specific effects”. A stone can “cause” me to trip without being an “active agent”.

Unbelievable. She can trip over s rock and that qualifies as information according to Webster's because the stone has some:

attribute inherent in and communicated by one of two or more alternative sequences or arrangements of something (as nucleotides in DNA or binary digits in a computer program) that produce specific effects

Yup. It's true. You cannot reason with irrational people. Mung

EL @274:

The only thing I am disputing is that the system can be reasonably called “symbolic”.

You are, as is so typical of your approach to dealing with uncomfortable issues, contradicting yourself. Or are you recanting your former position on Shannon Information?

But it’s not something I’m going to go to the stake over.

For reasons apparently obvious to everyone but you. Christians, otoh, were crucified without apology for their belief. Mung

Calling all evolutionists / materialists! Your help is needed! Alan Fox has not been able to answer a particular challenge, but perhaps you know an answer. The issue is simple and the bar is purposely set low. The question is whether there exists one or more coherent scenarios for the creation of a translation system by unguided chemicals. As discussed @296, any such system requires multiple interdependent parts in order to function. The components on their own are typically useless for providing any benefit from their translation function. That presents an obvious difficulty for mindless, unguided chemicals that cannot pursue distant goals, have no intentions, and have no need for such a system since they already fulfill all the laws of chemistry and physics in lifeless arrangements without any such system. Notice that the challenge is not to prove that any such scenario is true, or even most likely. Furthermore, as clarified @302, for the sake of the question, feel free to assume the existence of any amount of DNA material or RNA material as a substance suitable to serve as an information medium. However, you cannot freely assume specific arrangements of nucleotides without justification. The nature of the challenge is to provide a coherent scenario that does not obvious conflict with the known behavior of chemicals operating according blindly to the laws of physics and chemistry. For example, assuming chemicals have an ability to build toward a future benefit in a goal directed manner would be an obvious violation. A reasonable scenario would address obvious issues of sequence. For example... Do you propose that a decoding mechanism developed prior to the existence of meaningful / functional encoded information? If so, how could that be? Do you propose that encoded information developed prior to a decoding mechanism that could decode it to its functional form? If so, how could that be? How is the store of encoded information to be originally populated? With the help of an encoding mechanism? If so, before or after the existence of a matching decoding mechanism? And how was consistency between encoded and decoding established? If the original encoded information did not come from an encoding mechanism, then how else? While it may be that Alan Fox and others are content to take a giant leap of blind faith and trust there are unknown, indescribable answers to all these apparent contradictions with reality and the actual behavior of chemicals, many of us are skeptical of such blind faith and find it beyond our ability to simply believe and take it on faith despite what is known. We prefer to look for answers that are at least compatible with reason and plain evidence -- answers that do not obviously conflict with the known behavior of chemicals, for instance. So if you can think of some solid answers, please share them! Of course, if no one can even think of any coherent unguided / undirected answers to this challenge that hold up under scrutiny, then one obvious possibility that must be considered is that there are no such scenarios. It may be that all translation systems, by their very nature, require the intentional design of intelligent agents that can build toward a goal and future functionality. ericB

The most important question unanswered being ” …in what possible sense is your “semiotic argument” an argument for Intelligent Design?”

Yes, having retracted her claim, the most important question is how a system of symbols could possibly support the proposition of design in nature. good grief Upright BiPed

I’m perfectly aware that semiotics is a field of study, William, which is why I said ‘“Semiotics” is a field of study.’ in comment #348.

The entry isn't about semiotics, Alan. It's about BIOsemiotics, which is a growing scientific field about that which you claim doesn't exist (semiotics in biology) and for which (you imply) there have been no published papers. William J Murray

Standard Alan Fox. The exchange with Dr Liddle ended in her retracting her claim. The exchange with Reciprocating Bill ended with his concession of his two main counter-arguments. I have the links to each of those concessions if you really must see them yet again. Will you be linking to your own rebutal at some point, or will you continue to push shadows in the ring? Upright BiPed

Oops posted #357 prematurely! Here it is in full.

As I’ve maintained… No Translation = Not Symbolic or No Encoding and No Decoding = Not Symbolic Sadly, I think these words may be invisible to Alan Fox.

@ ericB See the thread linked to in my previous comment. Upright Biped had sufficient self-confidence in his argument to mount a defence at TSZ. See here for instance. Also see onward links in that thread to other threads where Dr. Liddle tries hard to get Upright Biped to clarify his argument. The most important question unanswered being " ...in what possible sense is your “semiotic argument” an argument for Intelligent Design?" Link Alan Fox

@ ericB See the thread linked to in my previous comment. Upright Biped had sufficient self-confidence in his argument to mount a defence at TSZ. See here for instance. Alan Fox

I know from direct experience with you that these texts only provide you fodder to repeat your unsupported assertions over and over again – always without any detail to support those assertions. Frankly, that is your problem, not mine. I no longer have time for it.

As you didn't give a link, itook a stroll down memory lane and, though didn't find the exact text you reproduce above, I did come across an inordinate amount of repetitive discussion. The main repetitive element was the regularity with which your interlocutors were unimpressed with your argument. The Upright Biped thread at UD. Yes, it all seems to have been done to death! Alan Fox

Apparently, Alan, you are unaware that the semiotic translation system and what it implies are not the sole domain of ID supporters. It is already an expanding and contentious field in the scientific community.

I'm perfectly aware that semiotics is a field of study, William, which is why I said '“Semiotics” is a field of study.' in comment #348. Alan Fox

"Plenty of evidence for a designer"? Ha, I lost it at that one. I always know I can come here for a good laugh. AVS

kairosfocus, thanks for info @347. I wish Elizabeth B Liddle was still participating. @155 she asked:

… And which of the information-transfers involved is, in your view “symbolic”, and why?

Borrowing from your Daniel Chandler quotation:

Since the meaning of a sign depends on the code within which it is situated, codes provide a framework within which signs make sense. Indeed, we cannot grant something the status of a sign if it does not function within a code.

As I've maintained... No Translation = Not Symbolic or No Encoding and No Decoding = Not Symbolic Sadly, I think these words may be invisible to Alan Fox. fnord ericB

Alan Fox:

I, personally, find nothing is added if you bring in some celestial prime mover,...

Again Alan exposes his ignorance. saying something was designed is a game changer, Alan. Even Dawkins recognizes that simple fact. So what is your issue? It must be ignorance.

... because that is just additional speculation for which there is no evidence at all.

And more ignorance. There is plenty of evidence for a designer Alan. What YOU don't have is any positive evidence for YOUR position. And I see that upsets you so much that you are forced to lie and act like a little baby. Nice job. Alan Fox:

But supernatural explanations that people have made up for comfort and solace don’t work for me.

1- ID does NOT requyire the supernatural 2- Alan just makes up stories that offer comfort and solace to him Joe

Well, if you think so, William. I still wonder, if so much devastation could be inflicted on the evil twins of atheism, materialism (and the other twin, Darwinism) why this concept of semiotics hasn’t begun to get some traction with ID proponents. Why not a paper published, for instance?

From Wikipedia:

Biosemiotics (from the Greek bios meaning "life" and semeion meaning "sign") is a growing field of semiotics and biology that studies the production and interpretation of signs and codes[1] in the biological realm. Biosemiotics attempts to integrate the findings of biology and semiotics and proposes a paradigmatic shift in the scientific view of life, demonstrating that semiosis (sign process, including meaning and interpretation) is one of its immanent and intrinsic features. The term "biosemiotic" was first used by Friedrich S. Rothschild in 1962, but Thomas Sebeok and Thure von Uexküll have done much to popularize the term and field.[2] The field, which challenges normative views of biology, is generally divided between theoretical and applied biosemiotics.

Apparently, Alan, you are unaware that the semiotic translation system and what it implies are not the sole domain of ID supporters. It is already an expanding and contentious field in the scientific community. Your denials that it is proper to see this process as semiotic in nature is in contradiction to an entire field of scientific research. Darwinist idealogues like you are left scrambling trying to find some way of explaining away what is an obvious case of semiotics, for which there is no feasable Darwinistic explanation. Such irreducibly complex symbol (sign) and interpretation systems require intention and intelligence to set up and organize. William J Murray

UB to Alan Fox: (Nov2012)

“life and semiosis are coextensive” >>Professor Emeritus Thomas Sebeok, Indiana University ... “the basic unit of life is the sign, not the molecule” >> Professor Emeritus Jesper Hoffmeyer, Institute of Biology, University of Copenhagen ... “life is matter controlled by symbols” >> Professor Emeritus of Physics, Howard Pattee, New York State University ... “semiosis not only is a fact of life but is ‘the’ fact that allowed life to emerge from inanimate matter” >> Marcello Barbieri, Department of Morphology and Embryology, University of Ferrarra ... “I think the attempt to link semiosis to protein synthesis just fails utterly” >> Alan Fox

Upright BiPed

Alan, Given your responses, it is somewhat understandable why you have such a low opinion of philosophy in the face of empiricism. But you truly torture both. Perhaps a little more interest in physical details and rational thought would save you from the specter of arguing with certainty that a thing is not semiotic, while simultaneously asking what makes a thing semiotic. Or, saying out of one side of your mouth that the origin of life is too distant and mysterious for us to be certain of anything, while saying out of the other side of your mouth that it was certainty not the result of design. Or, professing a love of empirical detail, while simultaneously denying material facts.

Alan: ...there is no operational definition of Upright Biped’s “semiotic system”

Neither empiricism nor philosophy can help you if allow yourself to be patently dishonest. You knew this comment was untrue the very moment you typed it out. I have provided the details of a semiotic system at the material level. You have participated in those discussions. The material conditions required to confirm a semiotic system are:

a) an arrangement of matter to evoke an effect within a system, where the arrangement is physicochemically-arbitrary to the effect it evokes. b) an arrangement of matter to establish the otherwise non-existent relationship between the first arrangement and the effect it evokes. c) the preservation of the physicochemically-arbitrary relationship between the first arrangement and its effect d) the production of the unambiguous function that pervades the animate kingdom

I have also provided the argument in a single paragraph:

In a material universe, it is not possible to transfer any form of recorded information into a material effect without using an arrangement of matter (or energy) as an information-bearing medium. If that is true, then other material necessities must follow. Firstly, such a medium must evoke an effect within a system capable of producing that effect. Universal observation and logical necessity demonstrate this to be true. Secondly, if a medium contains information as a consequence of its arrangement, then that arrangement must be physically arbitrary to the effect it evokes. Again, universal observation and logical necessity demonstrate this to be true. And thirdly, if an arrangement of matter requires a system to produce an effect, and if that arrangement is arbitrary to the effect it evokes, then the system itself must contain a second arrangement of matter to establish the otherwise non-existent relationship between the arrangement of the medium and its effect. Once again, universal observation and logical necessity demonstrate this to be true. If each of these things are true, then in order to transfer and translate any form of recorded information, the process fundamentally requires two arrangements of matter operating as an irreducible core within the system. And because Darwinian evolution requires the transfer and translation of recorded information in order to exist itself, it cannot be the source of this system. Given these observations, a mechanism capable of establishing this semiotic state is necessary prior to the onset of Darwinian evolution and information-based organization.

I know from direct experience with you that these texts only provide you fodder to repeat your unsupported assertions over and over again - always without any detail to support those assertions. Frankly, that is your problem, not mine. I no longer have time for it. Upright BiPed

Thank you for your comment, KF. However, I think you are committing the fallacy of begging the question. "Semiotics" is a field of study. But UB is going further by claiming there is a set of things he is calling "semiotic" that includes language and protein synthesis. To further this claim, he needs to define "semiotic" in this context of deciding whether something is semiotic or not. If he has done so successfully, I'd be interested to see this operational definition. Alan Fox

F/N: The obfuscation continues apace. Backed up by obtuseness that will not accept that prong height can be and is used for coding, or that tapes are a handy technology for string based data structures used in machine code based numerical control of machines that physically implement algorithms. (One wonders how much machine code level experience with info processing systems the would-be objectors have, and how much willingness to listen to what those with such experience have to say.) Dictionary.com on semiotics:

se·mi·ot·ics [see-mee-ot-iks, sem-ee-, see-mahy-] Show IPA noun ( used with a singular verb ) 1. the study of signs and symbols as elements of communicative behavior; the analysis of systems of communication, as language, gestures, or clothing. 2.a general theory of signs and symbolism, usually divided into the branches of pragmatics, semantics, and syntactics.

Where also, Daniel Chandler informs us:

The concept of the 'code' is fundamental in semiotics. Whilst Saussure dealt only with the overall code of language, he did of course stress that signs are not meaningful in isolation, but only when they are interpreted in relation to each other. It was another linguistic structuralist, Roman Jakobson, who emphasized that the production and interpretation of texts depends upon the existence of codes or conventions for communication (Jakobson 1971). Since the meaning of a sign depends on the code within which it is situated, codes provide a framework within which signs make sense. Indeed, we cannot grant something the status of a sign if it does not function within a code. Furthermore, if the relationship between a signifier and its signified is relatively arbitrary, then it is clear that interpreting the conventional meaning of signs requires familiarity with appropriate sets of conventions. Reading a text involves relating it to relevant 'codes'. Even an indexical and iconic sign such as a photograph involves a translation from three dimensions into two, and anthropologists have often reported the initial difficulties experienced by people in primal tribes in making sense of photographs and films (Deregowski 1980), whilst historians note that even in recent times the first instant snapshots confounded Western viewers because they were not accustomed to arrested images of transient movements and needed to go through a process of cultural habituation or training (Gombrich 1982, 100, 273). As Elizabeth Chaplin puts it, 'photography introduced a new way of seeing which had to be learned before it was rendered invisible' (Chaplin 1994, 179). What human beings see does not resemble a sequence of rectangular frames, and camerawork and editing conventions are not direct replications of the way in which we see the everyday world.

In this light, we can find rich stimulation for reflecting on the discovered reality of codes used in cells to make proteins, the workhorse molecules of life. And, for now, I will simply highlight that the contrivances and conventions implied by the marvellous functionally specific organisation in the cell are telling us something. Something amplified by the additional factor of an organised von Neumann self replicating facility that puts us in a chicken-egg loop on steroids. KF kairosfocus

I’m asking if there is any coherent scenario that could be suggested even as a hypothesis in which it would make sense for a rational person to conclude that unguided chemicals, “being made of matter [and energy] following physical law”, would undertake to build a translation system. Keep in mind this limitation. “It is all a matter of physical and chemical interactions” so the explanation must be driven only by such interactions.

I am sure there is. Life did not exist on Earth before it was cool enough for liquid water to be present and now life exists on Earth in great profusion. Unfortunately, there is no full record of events over the billion or so year window from the cooling to the first direct evidence of living organisms. So we are free to speculate. I, personally, find nothing is added if you bring in some celestial prime mover, because that is just additional speculation for which there is no evidence at all. Of course, we may, to borrow an analogy to whom I am not sure it should be attributed, be like ants on the side-walk a yard from the Empire State Building and unaware of its existence. I was persuaded by the late Robert Shapiro that answers to life's origin may lie beyond Earth and I recommend his book "Planetary Dreams". And to repeat, I am sure there is an explanation for life on Earth. We just don't know what it is yet and maybe never will. Maybe, like ants on the sidewalk, we are not capable of seeing or understanding those explanations. But supernatural explanations that people have made up for comfort and solace don't work for me. Alan Fox

Ditto @ ericB. Let's have a clear definition of "semiotic" that does what is claimed! That is it can bracket protein synthesis with language and exclude everything else. Without a clear definition , I don't see where the argument progresses. Also remember, nonetheless, I will allow for the sake of argument that protein synthesis can be described as semiotic. So what? Alan Fox

Ah. I see the question I posed has forced you to use a parachute. So when you repeatedly deny that the genetic system is semiotic, you simply have no idea what you are talking about.

Not exactly. I pretty much have no idea what you are talking about, when apparently suggesting there are two sets of things, those that are semiotic and those that are not.

The bottom line here is that a system being made of matter following physical law has nothing whatsoever to do with it being semiotic. As far as the conditions required for semiosis, those conditions have been provided to you in material detail.

I don't recall suggesting that "semiotics" involved events that violated the properties of the known universe, mainly because there is no operational definition of Upright Biped's "semiotic system. Had such an operational definition been provided, I am sure it should be a simple matter to cut-&-paste or link to it. Alan Fox

Alan Fox @329 (but emphasis mine):

But I suspect you are asking about the origin of life rather than its subsequent evolvability. Can’t help you there. There are lots of ideas based on little evidence so I don’t currently have any idea how life got started on Earth.

It's OK if there is little evidence, since the bar on this exercise is set low. I'm not asking for proof. I'm asking if there is any coherent scenario that could be suggested even as a hypothesis in which it would make sense for a rational person to conclude that unguided chemicals, "being made of matter following physical law", would undertake to build a translation system. Keep in mind this limitation. "It is all a matter of physical and chemical interactions" so the explanation must be driven only by such interactions. SO, if there really are "lots of ideas", let's hear one or two or three. The goal is not proof. It is to see if anyone can even propose something that makes coherent sense, given what we already know about how unguided chemicals behave. Of course, if no one can even think of a coherent scenario that could be described clearly and yet hold water... The bar is set low. Please have a go at it. No proof required. Just a clear and coherent scenario. ericB

Re: Alan Fox, Upright BiPed nails the relevant point.

The bottom line here is that a system being made of matter following physical law has nothing whatsoever to do with it being semiotic.

Exactly, as would be necessary for any clear thinking materialist to acknowledge (or else concede that semiotics does not exist). Therefore... Alan Fox @163

DNA’s relationship to protein is so obviously physico-chemical, ...

Irrelevant.

... it is hard to comprehend the suggestion of symbolism.

Not to everyone else who talks about codes, codons, decoding, translation, etc. and understands the meaning of a code. Alan Fox @188

All processes, DNA replication, RNA transcription and protein synthesis are biochemical.

Irrelevant.

And you can call the Genetic code a code if you like but is does not involve symbols.

When stripped of irrelevancies, this becomes a repeated but empty assertion without a justification. Alan Fox @189

It [translation of mRNA to protein] is purely biochemical.

Irrelevant.

Except that tranlation of mRNA to protein does not involve symbolism.

When stripped of irrelevancies, this becomes a repeated but empty assertion without a justification. Alan Fox @301

It is all a matter of physical and chemical interactions.

Irrelevant.

Chemistry or semiotics?

False dilemma based on an irrelevant observation. Alan Fox @317

DNA, RNA, ribosomes, proteins are molecules. Computers are made of molecules. ...

Irrelevant.

... Molecules are not symbols.

When stripped of irrelevancies, this becomes yet another empty assertion without a justification. Alan Fox @322

But what is going on (in the cell, when DNA is being replicated, transcribed into mRNA, when proteins are being synthesized) is chemistry, ...

Irrelevant.

... not semiotics.

When stripped of irrelevancies, this becomes a repeated but empty assertion without a justification. ericB

What is the operational definition of “semiotic”?;

Ah. I see the question I posed has forced you to use a parachute. So when you repeatedly deny that the genetic system is semiotic, you simply have no idea what you are talking about. The bottom line here is that a system being made of matter following physical law has nothing whatsoever to do with it being semiotic. As far as the conditions required for semiosis, those conditions have been provided to you in material detail. Upright BiPed

Alan Fox:

On the other hand, I already asked, assuming I’m wrong, so what? Where does it get you?

It gets us to design. And that gets us to something beyond your BS "emergence". It gets us to intention and purpose. IOW Alan, it gets us to reality. And that is the only place science should be. Joe

Alan Fox:

All systems, in my view, that exist in this universe, emerge from the properties of particles and energy.

Unfortunately for Alan support for that won't be found in any peer-reviewed journal.

What is the operational definition of “semiotic”?

When all else fails act like a child. Nice job Alan. Joe

The arguments you (Pand UB before you) have made about the code and translation system are utterly devastating to Darwinism and extremely problematic for atheism/materialism.

Well, if you think so, William. I still wonder, if so much devastation could be inflicted on the evil twins of atheism, materialism (and the other twin, Darwinism) why this concept of semiotics hasn't begun to get some traction with ID proponents. Why not a paper published, for instance? Alan Fox

So even Alan Fox’s sources do not agree with Alan Fox’s denial of the reality of the cell’s translation process of decoding information via a genetic code.

ericB, I'm not denying any reality about the processes that occur in the cell. I suggest the conflation with semiotics is in error. On the other hand, I already asked, assuming I'm wrong, so what? Where does it get you? Alan Fox

Perhaps you can give us an example of a system you see as genuinely semiotic that doesn’t consist of molecules following physical law.

All systems, in my view, that exist in this universe, emerge from the properties of particles and energy. Whilst physical laws are descriptive and not proscriptive, exceptions have not yet been found. Assuming we have an operational definition of what properties are involved for a system to be "semiotic", then we could presumably examine any system to decide whether it was "semiotic" by our operational definition. So the burden is on those who claim to identify a set of semiotic systems or things to explain what those criteria are. What is the operational definition of "semiotic"? Alan Fox

ericB, The arguments you (Pand UB before you) have made about the code and translation system are utterly devastating to Darwinism and extremely problematic for atheism/materialism. Only those willfully in denial can cling to the bare possibility that somehow these chemicals just happened to produce such a fantastic encoding and translation system. It takes blind faith to believe in such a chance occurrence than it takes to believe that there is an intelligent designer behind it. William J Murray

Alan Fox (not Allen, my apologies) undermines his own position by pointing @329 to an article that repeatedly says exactly what he steadfastly denies and avoids saying.

Nirenberg and Matthaei’s classic experiment in 1961 led the way in elucidating the codon to residue correspondence in DNA.

"elucidating the codon to residue correspondence"? Alan, it seems that you cannot bring yourself even to clearly state that this was a key experiment in breaking the genetic code. This "elucidating" effort was necessary precisely because there is no inherent chemical obligation for any particular "codon to residue correspondence". In fact, some species use a different "codon to residue correspondence", i.e. a different genetic code. That is what makes it a code. The particular "codon to residue correspondence" is not inherent or required by chemical laws. It is established per species as a convention that must be elucidated to be known. Excerpts from the article Alan Fox pointed to (emphasis mine):

The Nirenberg and Matthaei experiment was a scientific experiment performed on May 15, 1961, by Marshall W. Nirenberg and his post doctoral fellow, Heinrich J. Matthaei. The experiment cracked the genetic code by using nucleic acid homopolymers to translate specific amino acids. ... This experiment cracked the first codon of the genetic code ... Background ... In the 1960s, one main DNA mystery scientists needed to figure out was in transcription how many bases would be in each code word, or codon. ... Thus, they concluded that the genetic code is a triplet code because it did not cause a frameshift in the reading frame. ... Marshall Nirenberg and Johann Matthaei both longed to understand how information gets transmitted from DNA to protein. At this time there was a race to crack the code of the DNA language. ... Experimental Work ... Therefore, polyU coded for polyphenylalanine, consistent with UUU coding for phenylalanine. ... Using the three-letter poly-U experiment as a model, the research team discovered that AAA (three adenosines) was the code word or "codon" for the amino acid lysine, and CCC (three cytosines) was the code word for proline. ... Reception and Legacy ... In 1961, when they announced their methods for decoding the relationship of mRNA to amino acids, there was still a lot of experimentation required before the entire code was deciphered. ... This development sped up the process of assigning code words to amino acids. By 1966, Nirenberg announced that he had deciphered the sixty-four RNA codons for all twenty amino acids. For his ground-breaking work on the genetic code, Nirenberg was awarded the 1968 Nobel Prize in Physiology or Medicine. ...

So even Alan Fox's sources do not agree with Alan Fox's denial of the reality of the cell's translation process of decoding information via a genetic code. ericB

DNA, RNA, ribosomes, proteins are molecules. Computers are made of molecules. Molecules are not symbols. ... It’s molecules we have here!

Alan, you seem to have landed on the fanciful objection that becuase the genetic translation system is made of molecules (i.e. matter) following physical law, it cannot possibly be semiotic. At the same time, you seem to also agree that there are systems that are genuinely semiotic. I am wondering how well you've thought this through. Perhaps you can give us an example of a system you see as genuinely semiotic that doesn't consist of molecules following physical law. If you are unable to do so, then your key objection throughout the entire thread turns out to be rather silly, doesn't it? Upright BiPed

Alan Fox:

Nobody is suggesting that DNA does not carry the bulk of information necessary for cells to grow and reproduce. Wanting to categorize it with semiotics and computers is an error.

What a jerk! No one WANTS to categorize it that way- it IS that way. Look Alan just because you cannot support your claims doesn't mean there is some sort of conspiracy going on. Joe

Alan:

Indeed, the interior of a cell is not by any stretch of the imagination like a molecule-sized factory floor.

Again the experts refute Alan.

Cellular activity involves molecules encountering each other in an aqueous medium.

To anyone who actually looks it involves more than that.

Protein synthesis can be carried out in vitro.

Not without us it can't. Joe

KF

1: Symbols, operations and instructions are often physically instantiated in information-processing systems, e.g. holes in punch card and tape systems used in NC machines, magnetic tape or disks, prong height of Yale type lock keys [physical instantiation of a password).

OK

2: The prong height system is amenable to polymer implementation, where the sequence of monomers from a set — here, A/G/C/T or U — will encode and store information in prong height.

Nope. The inherent tendency of nucleotides to associate in a double helix with the complementary bonding between purines and pyrimidines emerges purely chemically.

3: Specifically, with a four state per monomer position string system, a three base codon can exist in one of sixty-four states, such as AUG, CCA etc.

OK

4: Thus, we see the genetic code, where each codon in sequence instructs the Ribosome-tRNA system to start, extend and eventually terminate a protein string made of the 20 or so AA’s used in life.

OK except "instructs"? It's molecules we have here!

5: Where also, the AA carried by a given tRNA is NOT set by any mechanical necessity of the configuration of the anticodon that matches the prong pattern of a given codon.

OK. As Upright Biped has pointed out, the point at which the specificity of an amino acid for its codon emerges is in the charging of the appropriate tRNA by the class of enzymes referred to as aminoacyl tRNA synthetases.

6: Indeed, the AA is coupled to a universal joint, the CCA end. The tRNA is loaded by a special enzyme that senses its conformation.

Again the anthropomorphisms. There is no "sensing" going on.

7: As a result tRNAs can be and have been reprogrammed, especially the stop codons. (This has of course been repeatedly pointed out to AF and ilk, just repeatedly ignored. Clearly, this does not fit the agenda so it must be wished away.)

As a result of what?

8: In short, the link from DNA to mRNA to protein chain is algorithmic and informational, not mechanical necessity.

Nobody is suggesting that DNA does not carry the bulk of information necessary for cells to grow and reproduce. Wanting to categorize it with semiotics and computers is an error. Alan Fox

Hi ericB Allen is a mis-spelling of my name. I know even bright guys like Allen MacNeill get it wrong but still... You ask:

If it’s just unguided chemicals knocking about, then please tell us how unguided chemicals began to knock about in this way (which we don’t find anywhere else in the universe, other than in designed systems).

Indeed, the interior of a cell is not by any stretch of the imagination like a molecule-sized factory floor. Cellular activity involves molecules encountering each other in an aqueous medium. There is no real equivalent to the Ford production line. Protein synthesis can be carried out in vitro.Nirenberg and Matthaei's classic experiment in 1961 led the way in elucidating the codon to residue correspondence in DNA. But I suspect you are asking about the origin of life rather than its subsequent evolvability. Can't help you there. There are lots of ideas based on little evidence so I don't currently have any idea how life got started on Earth. Alan Fox

To Mark Frank, Allen Fox, any others? Suppose you choose to avoid the word "symbolic". Suppose you assume that the words "translation" and "code" are unfortunate confusions on the part of biologists everywhere. Nevertheless, what I notice most of all is that neither of you have made any serious attempt at all at providing a coherent scenario in which unguided chemicals could produce a working system of the kind we do see (whatever it is called). After all, supposedly...

...what is going on ... is chemistry, ...

So, if it is nothing more than chemistry, chemistry should be able to account for its origin, correct? If it's just unguided chemicals knocking about, then please tell us how unguided chemicals began to knock about in this way (which we don't find anywhere else in the universe, other than in designed systems). Notice I'm not asking you to prove your story. If you can give two or three or more coherent possible explanations that plausibly connect chemical processes to the creation of such a system, you need not show which is true, or that any of them is true. I am asking for plausible coherence with known chemistry, not proof. Show how chemistry could lead to what we see, whether or not that is the way it happened. So please take at least a try at presenting a coherent story that a rational person would find plausible as to why unguided chemicals would build such a system (cf. @296 and @302). Thanks in advance. ericB

Joe, their more serious problem is that even if the cell is chemical throughout (i.e. "...what is going on ... is chemistry, ..."), that doesn't save their position. They still cannot cope with or deal with or explain what is happening. Have you noticed that no one has yet even attempted to address the actual challenge I presented (@296 and @302)? Really, I thought someone would at least try. But no one has touched it. ericB

Alan Fox:

But what is going on (in the cell, when DNA is being replicated, transcribed into mRNA, when proteins are being synthesized) is chemistry, not semiotics.

Strange that only people who absolutely NEED it to be only chemistry say crap like that. Unfortunately for that very small minority they don't have any data that supports their tripe. OTOH the majority has it all and it is in peer-reviewed journals, textbooks, well just about any place one would care to look. Joe

Mark Frank @316:

It is a bit like using the fact he is unmarried as evidence for him being a bachelor.

As a quibble, if a man is unmarried, then that does imply that he is a bachelor. There is nothing wrong with drawing that conclusion.

The point is that the definition of symbolic includes an element of intention. You need to find the intention to call it symbolic.

You appear to be preferring a definition for "symbolic" that focuses on what intelligent agents involved were intending (since material processes don't have intentions). You are entitled to your preference as a personal matter, but that is not a necessary part of the definition of "symbolic" and it is unhelpful and inappropriate in this context because it is question begging. In order to consider whether the translation system in cells is or is not due to intelligent agency and design, one must not build into the discussion a question begging assumption one way or the other. As I've already indicated, when I am discussing symbolic information processing, it is focused on the fact of translation by a code, without assuming beforehand whether or not this translation system was designed by intelligent agents according to their intentions. As I've said, No Translation = Not Symbolic One could equivalently say, No Encoding or Decoding = Not Symbolic

So you can’t use the fact that is symbolic as evidence for their being intention.

If I had use the term "symbolic" as evidence that the translation system is a product of intention, you would be quite right that that would have been an illegitimate move. I've already acknowledged that to you and Elizabeth. Note, however, that that is not the nature of the argument I am making. The argument, which is still essentially untouched by any actual rebuttal, was summarized @313:

Every physically implemented translation system, including the one we find in the cell, depends upon many necessary components, each of which would be useless for its translation purpose without the other components. Such a system requires intention to be constructed. A blind chemical process that cares nothing about symbolic information would never build such a system. There is no coherent scenario in which we could reasonably imagine unguided chemicals undertaking to build such a system and bring it to functionality. Consequently, the presence of an implemented symbolic information processing system implies intention and intelligent design. For details, see my post @296 with a generous clarification @302.

The need for intention is inferred from what would be required to build such a system, not from the fact that the term "symbolic" was used. ericB

To Alan Fox (and Mark Frank), If you prefer to use "semiotics" in a sense that refers exclusively to cases that involve interpretation by sentient agents who conceptualize symbols in some conscious way, I would not mind since I don't need the word "semiotics". If we were to use a definition like that for "semiotics", we would simply conclude that when computers process symbolic information, they are unable to process the symbolic information as a semiotic sign system, since the computer is not sentient and also has no conscious intentions. On the other hand, if you want to try to revert back to constructing a false dilemma of "either chemistry OR symbolic information processing, but not both", that has already been shown to be absurd (cf. @304), and especially so for materialists, e.g. 310:

IF it is the case that ... true symbolic information processing is not possible for material systems that operate according to “physical and chemical interactions” (cf. @301, and earlier posts by others), AND IF it is the case that philosophical materialism is true, at least such that everything is material and operates according to “physical and chemical interactions”, THEN ... symbolic information processing is not possible.

@322 you wrote:

Sure you can find people talking about codes and translation. But what is going on (in the cell, when DNA is being replicated, transcribed into mRNA, when proteins are being synthesized) is chemistry, not semiotics. Blame the describers – not the process.

It is possible that a minority position may be true and the majority position is wrong. It might be that Alan Fox has it correct and that all the biologists and others in the world who use these terms are all sadly mistaken. But I think you can see that we cannot just take your own assertions on this point as a sufficient proof. If the minority position cannot make a clear and meaningful case why everyone else is wrong, the repeated assertions by themselves carry the impression of simple denial. This is doubly so when the only justifications provided (so far) are easily reduced to absurd conclusions when followed to their logical implications. You seem at times to recognize the absurdity (e.g. @312), but then at other times you appear to revert right back to the same false dilemma that produced the absurdity. ericB

F/N: Re AF, 317:

DNA, RNA, ribosomes, proteins are molecules. Computers are made of molecules. Molecules are not symbols.

1: Symbols, operations and instructions are often physically instantiated in information-processing systems, e.g. holes in punch card and tape systems used in NC machines, magnetic tape or disks, prong height of Yale type lock keys [physical instantiation of a password). 2: The prong height system is amenable to polymer implementation, where the sequence of monomers from a set -- here, A/G/C/T or U -- will encode and store information in prong height. 3: Specifically, with a four state per monomer position string system, a three base codon can exist in one of sixty-four states, such as AUG, CCA etc. 4: Thus, we see the genetic code, where each codon in sequence instructs the Ribosome-tRNA system to start, extend and eventually terminate a protein string made of the 20 or so AA's used in life. 5: Where also, the AA carried by a given tRNA is NOT set by any mechanical necessity of the configuration of the anticodon that matches the prong pattern of a given codon. 6: Indeed, the AA is coupled to a universal joint, the CCA end. The tRNA is loaded by a special enzyme that senses its conformation. 7: As a result tRNAs can be and have been reprogrammed, especially the stop codons. (This has of course been repeatedly pointed out to AF and ilk, just repeatedly ignored. Clearly, this does not fit the agenda so it must be wished away.) 8: In short, the link from DNA to mRNA to protein chain is algorithmic and informational, not mechanical necessity. __________ Let us see if AF continues to try to ignore and dismiss the information and information processing involved in protein synthesis. That will tell us volumes. KF kairosfocus

ericB:

It would never serve science to retreat into a vague, black box description that cannot address what is happening in detail. So, I would ask you again to consider why it is that those advancing the science of biology, who are trying to be clear and descriptive, find themselves needing to talk in terms of symbols, codes, and translation. It is because that is the true reality that needs to be understood clearly, if one is to have any hope of coming to an understanding of how it came to be so.

Well, yes, sort of. The trap you continually fall into is that language is a very imprecise way of describing reality. Analogy can be a very useful tool for understanding but often leads to error and misunderstanding when taken too literally. You can only communicate effectively using a commonly understood vocabulary. Sure you can find people talking about codes and translation. But what is going on (in the cell, when DNA is being replicated, transcribed into mRNA, when proteins are being synthesized) is chemistry, not semiotics. Blame the describers - not the process. BTW my last few comments may have seemed a bit terse but that is due to my fingers being too large for the tablet I sometimes use to comment. :) Alan Fox

Do the dots and dashes of the Morse code become the letters? No. Do the dots and dashes of the Morse code represent the letters? Yes and that means they are symbols. Joe

Do codons become the amino acids? No! Do codons represent amino acids? Yes! And that means they are a symbol. Joe

Alan Fox:

DNA, RNA, ribosomes, proteins are molecules. Computers are made of molecules.

Yes, they are.

Molecules are not symbols.

They can be and in the case of transcription and translation they are. Poor Alan Fox all bluster and still nothing to support his spewage. Joe

Mark Frank:

The point is that the definition of symbolic includes an element of intention.

So does design.

You need to find the intention to call it symbolic.

Cuz Mark sez so.

So you can’t use the fact that is symbolic as evidence for their being intention.

Sure we can.

It is a bit like using the fact he is unmarried as evidence for him being a bachelor.

Umm that actually works: How do you know that he is a bachelor?-> He is unmarried. How do you know that transcription and translation are intentional?-> They are symbolic Joe

ericB, DNA, RNA, ribosomes, proteins are molecules. Computers are made of molecules. Molecules are not symbols. Alan Fox

ericB The point is that the definition of symbolic includes an element of intention. You need to find the intention to call it symbolic. So you can't use the fact that is symbolic as evidence for their being intention. It is a bit like using the fact he is unmarried as evidence for him being a bachelor. Mark Frank

Mark Frank:

What is needed for semiotic systems is intention.

Then all you need to do is demonstrate that the current transcription and translation system arose without intention, ie via blind and undirected chemical processes. Yet you have FAILED to do so. So here we have the evos continuing to "argue" in the absence of supporting evidence for their claims. And we have Alan Fox making up stories about transcription and translation being a purely physio-chemical thing despite the evidence. Joe

Alan Fox:

Agreeing with Mark that your premises are inappropriate, the simple fact is that protein synthesis is not in any way analoous to language.

So two morons agree- so what? The experts say that it is analogous to language. Who should we accept? Joe

To Mark Frank and Alan Fox, please correct me if I misunderstand or assume too much, but to summarize where it stands, it seems we are agreed that there is nothing about a physical system that excludes it from processing symbolic information. Such a system can perform translation and decode symbolic information into meaningful/functional actions according to a code. A computer is one example of such a system. I have maintained that the cell is another. The fact that it operates by physical and chemical processes is truly irrelevant. Alan Fox asks, "For the sake of argument, let’s say I’m wrong. Where does it get you?" Every physically implemented translation system, including the one we find in the cell, depends upon many necessary components, each of which would be useless for its translation purpose without the other components. Such a system requires intention to be constructed. A blind chemical process that cares nothing about symbolic information would never build such a system. There is no coherent scenario in which we could reasonably imagine unguided chemicals undertaking to build such a system and bring it to functionality. Consequently, the presence of an implemented symbolic information processing system implies intention and intelligent design. For details, see my post @296 with a generous clarification @302. p.s. Re: "the simple fact is that protein synthesis is not in any way analoous to language", the plain facts are otherwise, cf. quotations at 172 and 261. ericB

@ ericB Agreeing with Mark that your premises are inappropriate, the simple fact is that protein synthesis is not in any way analoous to language. Semiotics it isn't! For the sake of argument, let's say I'm wrong. Where does it get you? Alan Fox

#310 ericB The first premise is false. What is needed for semiotic systems is intention. Intention can be accounted for by physical and chemical interactions but it requires the kind of (physical/chemical) things that can have intentions to be involved e.g. people. Mark Frank

To all materialists (and to Alan Fox, Mark Frank, Elizabeth B Liddle, et al), what do you make of this argument? IF it is the case that semiotics and true symbolic information processing is not possible for material systems that operate according to "physical and chemical interactions" (cf. @301, and earlier posts by others), AND IF it is the case that philosophical materialism is true, at least such that everything is material and operates according to "physical and chemical interactions", THEN semiotics and symbolic information processing is not possible. If you don't like that conclusion and consider it absurd, which of the premises (either or both) would you consider false? ericB

Thanks, Mark Frank, I hope to exchange thoughts with you again whenever you feel so inclined. (You haven't yet said anything about 296, 302.) As food for thought to chew on over time, please allow yourself to consider ... What if biologists actually have a good reason for using the terminology they use about codes, translation and decoding? I realize that may require some changes in your accustomed mental categories, which is rarely welcome or easy. Nevertheless, instead of just writing all biologists off as talking about codes "because it sounds more exciting and has associations with unlocking a secret" (based on your own gut hunch without any real evidence), please seriously consider the possibility that what they are saying describes something real and worth talking about -- even if you don't yet know what to make of it. As I've said, it really is an amazing fact that we find this reality nowhere else in the universe other than in biological translation and in the activities of intelligent agents. From any perspective, that is a significant fact that is worth attempting to understand, both regarding its nature and regarding its origin. Best regards to you! ericB

ericB We really have done this all before - at least once. I am going to have to stop before I go crazy. I do sincerely appreciate your genuine and polite debating style. Mark Mark Frank

Mark Frank @306, no the functional result, of itself, does not define translation. There is no circularity, but the concepts are related (e.g. as sides of the same coin). I would suggest (as before) that the key idea is mapping, i.e. the application of a code. You cannot see translation by exclusively looking at what you had before (e.g. the binary code, the English symbols, the DNA or the RNA), because any symbolic meaning is extrinsically assigned/associated. It cannot be found by studying the symbol itself. You cannot see translation by exclusively looking at the functional result of translation. To see translation, one must look at the coding convention whereby the symbol sequence is mapped to the result. That coding convention is applied consistently and with regularity, but it is not obligatory in the sense of coming from any inherent physical or chemical requirement in the symbols. The code is neither obligated by law, nor a random association. If you like, you can think of it as an invented law or an imposed rule. Those are just suggestive ways of describing the idea. ericB

ericB You defined translation as

The use of a code (cf. above) that maps between symbols and what they represent (e.g. from an encoded algorithm to the sequence of actions it represents according to the code), thereby producing a functional result.

The trouble is that when asked what defines a symbol you seemed to come up with is "translated" as opposed "transcribed". So it all gets rather circular. The one phrase that is new in this definition is functional result. So is that what defines translation? Mark Frank

Alan Fox:

The DNA sequences do not represent anything.

Yes they do. DNA codons represent amino acids.

It is all a matter of physical and chemical interactions.

Only in Alan Fox's little world. Joe

Alan Fox @301 wrote:

There is no convention. The DNA sequences do not represent anything. They are the template. If you like, they are the code.

I do believe the understanding of what constitutes a genetic code (and there are multiple such codes) is well established. The information in protein coding DNA (notice the accepted term and distinction) is transcribed to the mRNA and does need to be decoded (cf. my post @303). On this point you seem to be arguing against what is commonly recognized in biology.

It is all a matter of physical and chemical interactions. If you want to focus on the one area where you might be able to argue for a semantic element, have a look at how amino acids get loaded onto their appropriate tRNA. Look at aminoacyl tRNA synthetase and it role in this process. One can speculate that these synthetases are the translators. What do you think? Chemistry or semiotics?

You are clearly falling into the error of creating a false dilemma. Of course, everything happening in the cell happens according to cause and effect in a manner that follows the laws of chemistry and physics. Of course, everything happening in a computer happens according to cause and effect in a manner that follows the laws of chemistry and physics. If it were legitimate to infer that "physical and chemical interactions" exclude processing symbolic information, then that would imply that there could be no such thing as a device for processing symbolic information. This is obviously false. ericB

Mark Frank @299,300 asks again about the difference between transcription and translation. Mark, I'd like to be able to help clarify what doesn't yet click for you, but you will have to help me understand where your difficulty is. I did respond to this question at the end of 298. Yet you didn't seem to take notice, so I don't have a clear indication of what you didn't understand about my answer. If you don't like or trust my explanation of the difference, you could also consult any biological textbook or source that explains translation according to a genetic code. For example, an excerpt from wikipedia's Translation (biology), but with my own emphasis added.

In molecular biology and genetics, translation is the process in which cellular ribosomes create proteins. It is part of the process of gene expression. In translation, messenger RNA (mRNA) produced by transcription is decoded by the ribosome to produce a specific amino acid chain, or polypeptide, that will later fold into an active protein. ... The ribosome facilitates decoding by inducing the binding of tRNAs with complementary anticodon sequences to that of the mRNA.

p.s. I meant to say earlier that I don't object to your comparing an input device such as a paper tape reader to being more like the transcription part of the process. When I brought up my list of examples of input devices, the point I was making is that every input device imposes its own restrictions and limitations on the medium and the conventions used for input. Therefore, it would not be legitimate to argue that information cannot be symbolic simply because a device for reading and processing it imposes restrictions. I don't recall you ever making that argument, and that original point wasn't motivated by any of your posts. ericB

I claim @296 that intelligent design is indicated by the cell's translation system for converting via a code from encoded recipes to amino acid sequences for functional proteins. However, I will make one correction. I indicated that none of the components of the system can fulfill their purpose for the sake of a translation system without having the other components as well. That presents a barrier for a blind chemical process, especially since chemicals have no concern, plan, intention or desire to create translation systems, nor any need whatsoever to do so. However, that doesn't strictly mean that a blind chemical process could not at least make a medium that could potentially be used to hold a symbolic information sequence. Just as a blind chemical process could make something like chalk and slate, or something like ink and a compatible writing surface, for the purposes of my claim, I would grant for the sake of discussion that a blind chemical process might* produce the chemical structures of DNA and RNA. This is offered freely as assumed for the sake of discussion. *In reality, there may be unsurmountable obstacles to this process when it is considered realistically and without the helpful but unrealistic interventions of scientists, as Robert Shapiro has pointed out at length. Nevertheless, for the sake of this discussion, all such possible difficulties are willingly waved away and not considered, since that would be an unrelated distraction. ericB

ericB

The codons are not themselves inherently anything, but by a convention they represent a meaningful action sequence to build a function amino acid sequence.

This is the crux of your misunderstanding. There is no convention. The DNA sequences do not represent anything. They are the template. If you like, they are the code. Nobody reads or writes anything. It is all a matter of physical and chemical interactions. If you want to focus on the one area where you might be able to argue for a semantic element, have a look at how amino acids get loaded onto their appropriate tRNA. Look at aminoacyl tRNA synthetase and it role in this process. One can speculate that these synthetases are the translators. What do you think? Chemistry or semiotics? Alan Fox

Sorry badly phrased .... try again I think you are blurring the distinction between the binary code and code as in the code of a computer program. The binary code is a term for the symbols 0 and 1 as use to depict (among other things) what is going in inside a computer (equivalent to the latter A,C,G and T). I do not deny that the latters A,C, G and T are symbols. Code as in a computer programme is a term for the actual electronic/magnetic/holes. This use is slightly specialist. I don’t think a layman new to computers finds it natural to call it code. However, specialist term or not, programme code is intended by humans to achieve something so it is quite different from DNA. Notice that when referring to a lot of bits in a computer we differentiate between code, data and useless junk. How about explaining that key difference between translation and transcription? Mark Frank

ericB (I happened to be on-line). I think you are blurring the distinction between the binary code and code as in the code of a computer program. The binary code is a term for the symbols 0 and 1 as use to depict (among other things) what is going in inside a computer (equivalent to the latter A,C,G and T). I do not deny that the latters A,C, G and T are symbols. Code as in a computer programme is a term for the actual electronic/magnetic/holes. This use is slightly specialist. I don't think a layman new to computers finds it natural to call it code. However, they are intended by humans to achieve something so it is quite different from DNA. Notice that when referring to a lot of bits in a computer we differentiate between code, data and useless junk. How about explaining that key difference between translation and transcription? Mark Frank

Mark Frank @297, I am very glad to have your continued participation. About your hunch concerning why biologists talk about codes and translation, part of my question was whether you thought those in computing used those same terms for the same motives (i.e. because they are simply mysterious and exciting). I've invited you to consider why those in computing use the terms (where they are exactly as appropriate as they are for biologists). Of particular relevance, consider how binary code has no inherent meaning. The very same pattern of 1s and 0s in any byte might occur as part of a sequence of instruction codes, or as data for an image, or part of a document, or any number of other meaningful uses. The bits themselves have no inherent meaning. The meaning is always, entirely extrinsic to the bit sequence itself. That is why binary code that was encoded for one processor will be useless if a different kind of processor with a different translation from code to action were to try to execute it. Then consider carefully whether or not there is anything fundamentally different about the translation of the coded information stored in mRNA into the specific sequence of actions needed to construct the amino acid sequence of a functional protein. The sequence of nucleotides (= sequence of bits) has no inherent meaning. If it were processed according to the wrong genetic code convention (= the operational code conventions of a particular processor), it would not work. Yet, when it holds meaningful symbolic information that has been encoded according to the same code used by that ribosome (= that processor), the ribosome can decode the encoded message into the specific sequence of instructions needed to derive the functional result, i.e. constructing a protein. The codons are not themselves inherently anything, but by a convention they represent a meaningful action sequence to build a function amino acid sequence.

The question is what is different about the DNA to Protein process that merits the description of translation as opposed to transcription?

The use of a code (cf. above) that maps between symbols and what they represent (e.g. from an encoded algorithm to the sequence of actions it represents according to the code), thereby producing a functional result. p.s. After you have considered and reflected on the above, I think you will find my post at 296 worth consideration, at least since it brings up new considerations. ericB

ericB I will try to hang in here a bit longer but so much has been written I have rather lost the thread of the debate. I believe the last two comments directed to me were #288 and #289. With respect to #289 you ask why I believe the main reason for referring to DNA as a code is because it sounds more exciting and has associations with unlocking a secret.  The answer is – it is just a hunch – I have no insight into biologists motives. #288 you are concerned to differentiate between transcription – which is just copying – and translation which unfortunately you do not go on to define. You then assert that translation is the key thing that makes DNA symbolic. Now I am all for identifying precise differences between the meaning of words and recognise that they mean different thinngs. But I need to understand your specific meanings in this context. Several of your earlier examples of symbols such as reading a paper tape or a punched card are just copying processes. They copy a sequence of bits from one medium to another.I cannot see how they are different in principle from transcribing DNA into mRNA. Translation is normally used in the context of language – translating English into French – where both origin and result have meaning. But I don’t think you can mean that. The question is what is different about the DNA to Protein process that merits the description of translation as opposed to transcription? Mark Frank

The translation system in cells indicates intelligent design. I would submit that, regardless of how many billions of years one waited, it is not reasonable to expect that unguided chemicals would ever construct a system for translating symbolic information into functional proteins based on stored recipes and a coding convention. [I realize people have thoughts about what happened earlier (e.g. that might not need proteins, for example) and what happened later (e.g. when a functioning cell provides the full benefits of true Darwinian evolution). For the purposes here, attention is focused specifically on the transition from a universe without symbolic translation to construct proteins to the origin of such a system. Whatever happened earlier or later, sooner or later this bridge would have to be crossed on any path proposed to lead to the cells we see now.] One of the key considerations leading to this conclusion is that a translation system depends upon multiple components, all of which are needed in order to function. + Decoding At the end, one needs the machinery to implement and apply the code to decode encoded symbolic information into its functional form. (In the cell, this is now the ribosome and supporting machinery and processes, but the first instance need not be identical to the current version.) Without this component, there is no expression of the functional form of what the symbolic information represents. The system as a whole would be useless as a translation system without this. Natural selection could not select for the advantages of beneficial expressed proteins, if the system cannot yet produce any. A DVD without any player might make a spiffy shiny disk, but it would be useless as a carrier of information. + Translatable Information Bearing Medium There must be a medium that is both suitable for holding encoded information and that is compatible with the mechanism for decoding. Every decoding device imposes limitations and requirements. It would be useless to a DVD player if your video was on a USB thumb drive the DVD player could not accept instead of a suitable disk. In the cells we see, this is covered by DNA and ultimately mRNA. + Meaningful Information Encoded According to the Same Coding Convention One obviously needs to have encoded information to decode. Without that, a decoding mechanism is useless for its translation system purpose. If you had blank DVDs or DVDs with randomly encoded gibberish or even DVDs with great high definition movies in the wrong format, the DVD player would not be able to produce meaningful results, and so would have no evolutionary benefit tied to its hypothetical but non-functioning translation abilities. In the cell, this information holds the recipes for functional proteins following the same encoding convention implemented by the ribosome and associated machinery. + Encoding Mechanisms This is perhaps the least obvious component, since the cell does not contain any ability to create a new store of encoded protein recipes from scratch. Indeed, this absence is part of the motivating reasons for the central dogma of molecular biology. Nevertheless, even if this capability has disappeared from view, there would have to be an origin and a source for the meaningful information encoded according to the same coding convention as is used by the decoding component. (For the moment, I will just note in passing that the idea of starting out with random gibberish and running the system until meaningful recipes are stumbled upon by accident is not a viable proposal.) So there has to be some source capable of encoding, and this source must use the same coding convention as the decoding component. To have a working, beneficial DVD player, there must also be a way to make a usable DVD. + Meaningful Functional Source Material to Represent It would do absolutely no good to have the entire system in place, if there did not also exist in some form or other a beneficial "something" to represent with all this symbolic capability. If you want to see a movie as output, there needs to be a movie that can be encoded as input. If you want functional proteins as output, there needs to be access to information about proper amino acid sequences for functional proteins that can serve as input. Otherwise, GIGO. Garbage In, Garbage Out. If there is no knowledge of what constitutes a sequence for a functional protein, then the result produced at the end of the line would not be a functional protein. + Some Other Way To Make What You Want The System To Produce If we supposed that the first movie to be encoded onto a DVD came from being played on a DVD player, we would clearly be lost in circular thinking, which does not work as an explanation for origins. Likewise, if the only way to produce functional proteins is to get them by translating encoded protein recipes, that reveals an obvious problem for explaining the origin of that encoded information about functional proteins. How can blind Nature make a system for producing proteins, if there has never yet been any functional proteins in the universe? On the other hand, how does blind Nature discover and use functional proteins without having such a system to make them? The core problem is that no single part of this system is useful as a translation system component if you don't have the other parts of the system. There is nowhere for a blind process to start by accident that would be selectable toward building a translation system. The final killer blow is that chemicals don't care about this "problem" at all. Chemicals can fully fulfill all the laws of chemistry and physics using lifeless arrangements of matter and energy. Chemicals are not dissatisfied and have no unmet goals. A rock is "content" to be a rock. Likewise for lifeless tars. The biology of cells needs chemistry, encoded information, and translation, but chemicals do not need encoded information or biology. They aren't trying to become alive and literally could not care less about building an encoded information translation system. ericB

Upright BiPed, thanks for contributing the extra details @294 regarding translation! ericB

Hello ericB, I don't have the spare time to participate in this thread, but I have been occasionally skimming it and have enjoyed reading your comments. There is one thing I noticed that really needs to be clarified. The clarification physically demonstrates the argument you've been making. You say:

DNA holds encoded information, but DNA is not the code. The code is implemented by RNA (i.e. the tRNA) in the ribosome

Just to be clear, the code in genetic translation is not established by an RNA. It is established in complete temporal and spatial isolation from the remaining transcription and translation process by the protein aaRS. In other words, it is not the physical structure of tRNA that establishes the code (the tRNA is merely a passive carrier of the code) it is instead the physical structure of the compliment of aaRS. The aaRS charge the tRNA with their correct amino acid prior to the tRNA ever entering the ribosome. They accomplish this by being able to do a unique double-independent recognition (Barbieri) of the tRNA and AAs. This isolation from the translation process instantiates the necessary physicochemical arbitrtariness which is fundamentally required for the system to function. The system would not be able to translates recorded information into a physical effect without it. cheers... Upright BiPed

Mark Frank:

(Presumably I don’t have to explain that Joe’s “answer” is not an explanation: Because it is a code and that means it is the proper description. )

Presumably Mark can't support anything he sez. Joe

Short reply to Mark Frank (as I'm past out of time), Personally I would rather that you stay engaged. For example, I am interested in your thoughts about how science can deal with and understand translation systems, if we do not talk in terms of translation and only think about cause and effect. See also my post just made to Elizabeth. I feel that there are some real opportunities of improved communication. Again, I prefer to have you in the conversation. Thank you for your posts. ericB

Elizabeth B Liddle, I see real progress in communication in your comments @275. Thanks for constructively engaging with these topics. I also see opportunities for correcting what may be misunderstandings.

I don’t think the “sender” is the “programming” in any very sensible sense. ... ... my point is that once you get down to detail, it is extremely difficult to impose a a human-to-human communication system analogy on what goes on in the cell. ... But what is actually going on at organismic and cellular level is way more complicated than that and far too full of feedback loops to be pinned down by a simple Sender – Sign – Receiver model. As I think you agree. ... I am just extremely wary of trying to impose human-to-human communication analogies on a very different information processing system, ...

I'm surprised at this series of comments, since it was only because of your repeated request that I accommodated to fitting what happens in the cell into the simple Sender - Receiver model of human to human communication. If you don't think that fits the situation, why would you want to push the discussion in that direction? If I try to read between the lines, I get the impression that you just might think I am or someone else is actually proposing something like what you are describing and then rejecting, but if so that would be incorrect and a straw man. I hope you are not under that misunderstanding. I am using translation in a sense that applies just as well to the cell as it does to what happens inside computers (e.g. binary code to actions) where there are no human to human conversations taking place. There is no assumption of active/current sentient involvement in recognizing that the cell or the computer has symbolic information that requires translation by a convention.

[ericB:] Where translation by conventions is present, symbolic information is being processed, whether by sentient agents or by unthinking systems such as computers or cells. No translation = not symbolic.

OK, but that just moves the definitional burden to “translation”. I’m not nit-picking here – I am perfectly in agreement with you that information-processing takes place – if anything, I am making a more thoroughgoing analysis of the information transfer that takes place in living systems than you are – not restricting it to the DNA-RNA-protein system.

I think there is a misunderstanding here. I did not say that "information transfer" was restricted "to the DNA-RNA-protein system". I was answering the question you asked, which was stated as follows.

And which of the information-transfers involved is, in your view “symbolic”, and why?

Only "the DNA-RNA-protein system" is symbolic because only it requires translation. Both your question and my answer allow that there can be many other "information-transfers" that are not symbolic.

[ericB:] As I’ve consistently maintained, the hallmark for recognizing the presence of symbolic information is the need for translation by a coding convention.

Well, I’ll accept your use of the word. We just have to be careful not to import the baggage that may come with it. But to me “convention” means “agreed by a community of users”. I don’t think anything was “agreed” among cells to “use” a certain set of “symbols”, nor that there must have been a single designer who arbitrarily decided on a sest to use. That is would be assuming one’s conclusion. ...

That is one sense of "convention" -- a sense that focuses on the process by which a convention may have come into existence. But it is not the only sense for "convention". The more relevant meaning here is to focus on the nature of a convention itself (regardless of how it came to be). It is not inherently required (i.e. not a law in the natural sense). Yet it is regular and consistent, not capricious or random or haphazard (i.e. not a variable association determined by chance of the moment). If you like a different word that captures these ideas as well or better, alternatives could be considered. Regarding the concern about connotations and the illegitimacy of begging the question, if you check out my response to Mark Frank @251, you will see that I've already expressed the same thoughts. We don't want to mix in inappropriate connotations and then base conclusions directly upon those implicit assumptions in a question begging fashion.

I am just extremely wary of trying to impose human-to-human communication analogies on a very different information processing system, and then drawing conclusions about where an intelligent agent might feature in the system. I do not think that there are intelligent agents in the cell sending signals to each other, and I don’t think IDers do either, on the whole.

;-) I'm glad you concede that IDers "on the whole" don't propose that there are tiny "intelligent agents in the cell sending signals to each other". That's a relief ;) Again, about the concern of unwarranted conclusions depending only on connotations about words, I would invite you to please call me out whenever you sense that I might be making such a unwarranted, question begging inference. I welcome your correction. (out of time for now) ericB

ericB I don't know about you but having enjoyed our debate and learned from it, I am now finding it a bit repetitive and barren. I don't want to be accused of opting out but would you be put out if I dropped it? Mark Mark Frank

Mark Frank, I have a more fundamental question for you, regarding your answer @265 to my earlier question.

[ericB:] I would ask you again to consider why it is that those advancing the science of biology, who are trying to be clear and descriptive, find themselves needing to talk in terms of symbols, codes, and translation.

To support this you quote from the rather controversial Hubert Yockey but clearly it is very common to refer to DNA as a code. I believe the main reason for this is because it sounds more exciting and has associations with unlocking a secret.

[In passing a correction: DNA holds encoded information, but DNA is not the code. The code is implemented by RNA (i.e. the tRNA) in the ribosome.] Why do you hold onto this belief that "the main reason for this is because it sounds more exciting and has associations with unlocking a secret"? A. Is it because you actually have any evidence supporting this fact, such as drawing upon material written by biologists that introduced this terminology? If so, please share this evidence. or B. Do you hold onto this belief without any direct evidence of that kind? If B, is it because you really don't want it to be true that biologists use the word "code" in a meaningful and warranted way because there is an actual code and actual translation happening in the ribosome? For comparison and contrast, consider that programmers use the word "code" regarding the binary code in a computer (note I am being specific in stating binary code). Would you likewise hold onto the belief (despite having no evidence to support it) that "the main reason for this is because it sounds more exciting and has associations with unlocking a secret."? Computers work by cause and effect. Binary code is involved in cause and effect. Its effects are connected to a specific context. Is binary code translated into operations? Is it truly a code? Or are these only euphemisms that programmers adopt because they like the excitement of the inappropriate connotations? ericB

Mark Frank @270 wrote (my emphasis added):

But you would understand in great detail how those reactions happened. I admit you would not know to what end and that is precisely the point – we have no reason to suspect there is an end for the DNA/Protein transcription. If the chemistry underdetermines DNA/Protein transcription then let us know what it is that is not determined.

I suspect that it may have just been a careless error on your part, not a real failure of understanding, to use the word "transcription". Nevertheless, in answer to some of the questions you have asked me in other posts, it is instructive to reflect on the following fact. There is no such thing as "DNA/Protein transcription". You absolutely cannot create proteins merely by any process of transcribing DNA. Transcription -- across writing -- only describes a copying process, such as in the case of making mRNA from DNA, which does allow moving the sequence into a different medium. By itself, transcription does not involve any translation, which as I've pointed out is the crucial distinction with regard to symbolic information. No Translation = Not Symbolic Notice that even though the genome is widely transcribed into RNA (it is functional, not merely junk), nevertheless only a small part of it is encoded with protein coding information that is later translated. There are ways that we can consider the rest of the genome in terms of information, and it does indeed have functional value. However, without translation, that is not "symbolic information". You have asked @265:

The question I have is what does it add to describe that process as the translation of symbols which represent the proteins using a code over and above just describing the process (in detail)? ... I am reversing the question and asking you what you think the value is of describing the process in terms of symbols, codes and translation as opposed to just describing the process in detail in terms of chemistry? Compare it to another complicated causal chain such as the position of the moon in its orbit and the resulting effect on when and where on the earth’s surface tidal creatures will be active. I don’t think you would describe the position of the moon as being a symbol of the creature’s activity or the process as being one of translating the position of the moon into creature’s activity. What is the relevant difference to the DNA to protein process?

The difference is translation. Consider that we have before us this incredibly amazing fact. In all the universe, we never see translation taking place except 1. in the ribosomes of cells as an essential part of their operation, and 2. in the artifacts and activities of intelligent agents. Now surely, on any view of reality, this is an amazing fact that cries out for explanation. If science is going to address it at all, it must be able to at least talk about it. Now consider how your own statements are answering your own question. So long as you continue to talk and think in terms of complex cause and effect chains, you have been unable to see any significant difference of kind. That is why you ask questions about what is the difference, and what is the value of adding this terminology. The inability to see any difference comes directly from relying on terms and thinking that do not identify anything that is different between the cases at hand. As long as you only talk and think about what they have in common, of course you will not be able to see and meaningfully consider how they are profoundly different. Systems that include translation follow cause and effect. Systems that do not include translation follow cause and effect. Talking and thinking only about cause and effect makes one blind to the difference between these profoundly different categories. ericB

Re: DNA in computing. Last night, when I opened my recently received copy of the monthly journal of the ACM (Association for Computing Machinery), it happened that the first page I opened to contained this very timely news article. A New Approach to Information Storage By Samuel Greengard Communications of the ACM, Vol. 56 No. 8, Pages 13-15 Excerpts:

When George Church, a geneticist at Harvard Medical School, decided to produce 70 billion copies of his book, Regenesis: How Synthetic Biology Will Reinvent Nature and Ourselves, he skipped printing presses, Kindles, and hard drives. The professor of genetics instead turned to a most unlikely medium: DNA, the same long molecule that serves as the building block for life on Earth. "It has worked remarkably well as a storage medium for 3.5 billion years," he says. ... Welcome to the emerging world of data storage. While hard drive and solid-state drive manufacturers are attempting to increase storage densities and push the limits on speed and performance, a handful of researchers around the world are hard at work on the next generation of systems and devices that would crash standard thinking about storage. Some, like Church and the European Bioinformatics Institute (EBI), are focusing on DNA. ... For perspective, all the data humans produce in a year could fit into about four grams of DNA. "There is an opportunity to create storage systems that are a million to a billion times more compact than existing technology and provide a level of longevity that is unheard of today," Church points out. The DNA of Storage The need for more efficient data storage methods is rooted in today's radically changing world. According to IBM, humans collectively produce about 2.5 exabytes of data each day; market research firm IDC says roughly three zettabytes of data exist in the digital world. Remarkably, 90% of the data in the world has been created over the last two years alone, say researchers at IBM. ... Storage: The Next Generation In the end, it is not so much a question of if next-generation storage technologies will go mainstream, but when.

The full article is here. ericB

Mark Au contraire I think the macaques make a good point, because in their case using the language of meaning (and even of codes, to a limited extent) explains purposeful behaviour that is not dictated by human intentions. In that physiological, ie physical, processes underlie animal behaviour then trivially one can explain it chemically, whilst explaining nothing useful at the higher level. The language of function, even of purpose, is necessary to explain what behaviour facial expressions call out (using Margaret Mead's term)in monkeys. Is the same true in genetics? Given that the strong appearance of design is admitted by everyone from Dawkins up, "we have no reason to suspect there is an end..." is simply untrue. We have plenty of reason from the highly organised outcomes. The question is only whether we might have reason to suspect our impression to be wrong. But as the cases of macaques and computers show, finding there is a complete chain of physical cause and effect is insufficient support for that suspicion. Jon Garvey

Jon #273 I think you are rather confusing things by introducing the macaques. If I could demonstrate that the behaviour of macaques had the same relationship to their internal chemistry as the execution of a computer program has to the electronic states changes in a computer then I think most people would say I had demonstrated reductionism of behaviour to chemistry. Indeed a computer programme is often the metaphor opponents use to characterise reductionism: "you are just reducing mental events to a computer programme". The fact is that the behaviour of a programme running on a computer is completely determined by the electronic events happening inside it. The work of animal behaviourists with macaques is not fluff, whether you can reduce their behaviour to chemistry or not, because even if you knew the chemistry it would be hopelessly hard work to try explain it all in those terms. Similarly using the language of codes and representation is helpful for extracting key characteristics of that electronic behaviour so you need to be concerned about details of the hardware. But that language, while extremely useful, is losing detail not adding it. You only get to add something if you start to consider what the bits mean and that requires knowledge of human intentions. Mark Frank

Of related note: Anthropic Principle - God Created The Universe - Michael Strauss PhD. - video http://www.metacafe.com/watch/4323661 This preceding video, at the 6:49 mark, has a very interesting quote: "So what are the theological implications of all this? Well Barrow and Tipler wrote this book, The Anthropic Cosmological Principle, and they saw the design of the universe. But they're atheists basically, there's no God. And they go through some long arguments to describe why humans are the only intelligent life in the universe. That's what they believe. So they got a problem. If the universe is clearly the product of design, but humans are the only intelligent life in the universe, who creates the universe? So you know what Barrow and Tipler's solution is? It makes perfect sense. Humans evolve to a point some day where they reach back in time and create the universe for themselves. (Audience laughs) Hey these guys are respected scientists. So what brings them to that conclusion? It is because the evidence for design is so overwhelming that if you don't have God you have humans creating the universe back in time for themselves." - Michael Strauss PhD. - Particle Physics bornagain77

Elizabeth B Liddle """Which isn’t even non-Christian. John tells us that Jesus quoted the psalmist who said “ye are Gods”, with approval."""

The term "God" is used frequently in the Bible. I believe there is however good reason to recognize distinction in this regard. Take the difference between God and gods; and the god of this World; compared to the actual true creator God of Abraham. In the setting of this topic the overall narrative of the Bible seems unambiguous in its affirmation of a one and true creator God. DinoV

Liz: Elohim is translated "angels" elsewhere and has multiple meanings. In the context of Psalm 82, it is clearly speaking about magistrates and rulers with authority who "will die like mere mortals," and "fall like every other ruler." Jesus' point was to show his accusers' hypocrisy in their charge of blasphemy, not to approve the notion that we are all gods. Phinehas

I realise you have other things on your mind right now, KF, and I do hope all is going well. When you have time and mind to spare, perhaps you could say more clearly what you think it is I trying to "avoid acknowledging". Because my guess is that I'm probably not! But for now you have nothing but my very best wishes. Lizzie Elizabeth B Liddle

EL: There is a two-year track record. KF kairosfocus

No, that's OK, "atheist" is probably the simplest description. But yes, I do think that "nature takes on the creative qualities of a metaphysical “god” in an impersonal sort of manner" - and indeed, in a personal manner in the form of people :) Which isn't even non-Christian. John tells us that Jesus quoted the psalmist who said "ye are Gods", with approval. Cheers Lizzie Elizabeth B Liddle

Ok Liz, I was just curious about your thoughts on consciousness and now I understand you would hold to non-reductive physicalism, generally speaking. I was under the impression that you were an atheist, I apologize If I misrepresented you. If you believe that nature takes on the creative qualities of a metaphysical "god" in an impersonal sort of manner, you wouldn't be the first person on earth to have held to this view of reality. Thanks for the clarification. DinoV

I guess my view is nearest to that of Douglas Hofstadter. I think mind emerges from matter, rather than being separate from it. I think that "conscious" makes more sense as a verb (being conscious of something) than as a noun "consciousness", and I think it consciousness falls on a continuum from not being conscious of very much (a moth; an early embryo) to being conscious of a great deal (a human child or adult). I don't think consciousness can be "reduced" to matter - I think it is the property of a system, not shared by its constituent parts. I also think that consciousness of one's own consciousness - specifically of one's own existence as a conscious volitional agent is an intrinsically reflexive phenomenon arising from the reentrant loops that are part of our brain-body architecture. That's as succinct as I can make it in the context of an internet post :) But when you describe me as having an "atheistic worldview" - I'm not sure what you imply by that. I was a theist for most of my life. I still have a basically theistic "worldview". I just don't think that mind is separable from matter, so I don't believe in a creator mind that gave rise to matter. If that makes me an atheist, I'm an atheist. I think "pantheist" is probably a better term. I still have a referent for the signifier "God", and just as I still have a referent for the signifier "morally responsible person". Elizabeth B Liddle

Liz - a bit off topic and it is not my intention to shift it, but I was curious; In the context of your experience and atheistic worldview, what philosophy of mind paradigm do you believe best explains consciousness? DinoV

Eric:

I would first qualify that what we see happening in the cell is more like a programmed information processing system than just sending a letter, so “sender” “receiver” does not quite capture the situation. But, we can work with that for the moment.

Yes, I agree, but like you I am happy to work with it.

In passing, in a meta sense, one could consider the “sender” to be the who or what that programmed the system. The protein coding information had to come from somewhere and the cell itself does not have the ability to create and populate its own protein coding information store from scratch (cf. the central dogma of molecular biology).

Well, all dogmas are likely to be false, but I agree that the general direction of information flow is from DNA to RNA to protein. That may not always have been the case, however, and it is a very small part of the cascade, particularly in multicellular organisms. And we also have to consider the information transfer that takes place during cell division(when information from the parent cell is duplicated), and the information transfer that takes place when a cell in a multicellular organisms does its job in the organism (for example when genes are expressed in neurons during thought, for instance), and during development (determining what genes will be expressed in the daughter cells).

Leaving that to the side, within the cell the “sender” would refer to the control programming (including epigenetic factors) that determines what genes will be expressed and (in eukaryotes) which alternative splicing of that gene will be used to construct the mRNA. It would also include the mechanisms for transporting the mRNA to a ribosome — the literal act of sending.

This seems a rather crude way of looking at it. I don't think the "sender" is the "programming" in any very sensible sense. It seems to me better to think in terms of signal cascades, which are two-way (in fact multi-way - full of feedback loops). In a multicellular organisms when for example the organism gets a "message" from the environment - radiant heat, for example, or sound, or pressure, or smell, or light - genes are expressed and cells send signals to other cells, which return more information. In other words, signals are bouncing around inside and between the organism and the environment in multicellular organisms all the time, from conception to death. What the "programming" does is to allow this signalling to take place.

The message is carried by the messenger RNA, hence its name.

Sure. But DNA is also carries information from cell to cell. And that information includes its the epigenetic settings.

The recipient is the ribosome that receives the mRNA.

Well, sure, but it in turn becomes a sender. It is also itself a "message" sent from the DNA sequence that codes for it.

Notice that the DNA is not “causing” anything to happen. It is not the active agent.

It both causes and is caused by things. It contains information in the sense that its sequence, to requote Merriam Webster "produce[s] specific effects". A stone can "cause" me to trip without being an "active agent". Not only that, but your post can cause me to respond to you, even though it is not an "active agent".

It is an information store and is passive in this whole affair.

Depends what you mean by "passive". But I agree that for some meanings of "passive" it's "passive". I don't think it's a particularly important point. It's still causal in the sense that if it was otherwise, other results would be produced.

The agent that does “its work” to make proteins is the ribosome, which uses the information encoded into the mRNA as data, specifically as a recipe that it can translate into an amino acid sequence.

Why not the mRNA, or the tRNA, or the RNA polymerase? They all play roles in the information processing, and they all contain information, according to that Merriam-Webster definition. And the DNA contains the sequence that gives rise to all these RNA molecules. Without the DNA there would be no ribosome.

This is why it is improper to attribute the processing input requirements and limitations of the ribosome translation unit as though these were properties of the information in DNA, or to infer any conclusion about the nature of information. All devices that do work, including ribosomes, impose requirements on their inputs. That doesn’t define the nature of symbolic information.

Not sure what you mean, but my point is that once you get down to detail, it is extremely difficult to impose a a human-to-human communication system analogy on what goes on in the cell. There is plenty of information processing going on, but to try to express it in Saussurian terms seems to me doomed to failure - and to be misleading. The only half-way decent version of the analogy that I can see is that information from the environment is transferred to the gene pool of a population as a record of what sequences result in most effective replication in that environment. But what is actually going on at organismic and cellular level is way more complicated than that and far too full of feedback loops to be pinned down by a simple Sender - Sign - Receiver model. As I think you agree.

As I’ve consistently maintained, the hallmark for recognizing the presence of symbolic information is the need for translation by a coding convention.

Well, I'll accept your use of the word. We just have to be careful not to import the baggage that may come with it. But to me "convention" means "agreed by a community of users". I don't think anything was "agreed" among cells to "use" a certain set of "symbols", nor that there must have been a single designer who arbitrarily decided on a sest to use. That is would be assuming one's conclusion. tRNA is coded by DNA, and organisms with DNA that happened to code for a set of tRNA molecules that gave reasonably faithful results would tend to reproduce more reliably, so we need not necessarily invoke "convention" to account for an arbitrary set of "symbols".

Both symbolic information processing operations and operations that do not involve any symbolic information operate by cause and effect. The concept of cause and effect provides no discrimination whatsoever between these distinct categories.

I don't understand this, and this may because of the "baggage" I refer to. Or it may be because I am not on board with your idea that DNA is not "causal". I think that is an unduly restrictive view of "cause". DNA stores information (we agree) as defined as a pattern that produces specific effects. In that sense it is causal.

Where translation by conventions is present, symbolic information is being processed, whether by sentient agents or by unthinking systems such as computers or cells. No translation = not symbolic.

OK, but that just moves the definitional burden to "translation". I'm not nit-picking here - I am perfectly in agreement with you that information-processing takes place - if anything, I am making a more thoroughgoing analysis of the information transfer that takes place in living systems than you are - not restricting it to the DNA-RNA-protein system. I am just extremely wary of trying to impose human-to-human communication analogies on a very different information processing system, and then drawing conclusions about where an intelligent agent might feature in the system. I do not think that there are intelligent agents in the cell sending signals to each other, and I don't think IDers do either, on the whole. So it's important, I think, not to jump to the conclusion that because information transfer occurs in living systems, that therefore an intelligent agent must be sending the information. The information is not being sent by intelligent agents; it may, nonetheless, be true (although I don't think the inference is warranted) that an intelligent agent designed the system. A robot is an information processing system, designed by people. But that robot is not processing information sent to it by its designers, necessarily. The two levels of analysis are very different. Elizabeth B Liddle

We need to ask ourselves what is so telling about the obvious info processing system in the cell that builds proteins (and similar systems) that makes the likes of MF and EL so desperate to avoid acknowledging the obvious. And if that is what hey are reduced to doing, that is telling indeed.

What is it that you think I am trying to "avoid acknowledging", Kairosfocus? The only thing I am disputing is that the system can be reasonably called "symbolic". But it's not something I'm going to go to the stake over. It is what it is. What you call it is essentially up to you. Elizabeth B Liddle

...we have no reason to suspect there is an end for the DNA/Protein transcription.

Yes we do, but it is possible to deny it even in the case of the computer software - if, for example you're an eliminative materialist. "Chemistry->genetics->mind->computer software (->blog posts about it, come to that)". Sticking to undoubtedly natural systems, though, we have no reason to limit genetic activity to the chemical realm any more or any less than we do to limit the behavioural characteristics of macaque monkeys to chemistry - they are after all the end result of those genetic changes. But in the case of monkey social and physical activity too if you studied the chemistry "...you would understand in great detail how those reactions happened" so the monkeys would have been fully explained, but only to an reductionist who considered all that zoologists and animal behaviourists find useful to be fluff. I'm actually quite saddened to see that there are still people who embody the old nineteenth century hyper-reductionist stereotype, "There, it's nothing but a bag of chemicals reacting." If it were, it would interest only chemists. But it interests information scientists like Hubert Yockey too - whose contribution to the understanding of DNA goes back to the dawn of its discovery, but whose insights, though they were clear to Watson and Crick, seem to have gone over some people's heads even 60 years later. Jon Garvey

PS: We need to ask ourselves what is so telling about the obvious info processing system in the cell that builds proteins (and similar systems) that makes the likes of MF and EL so desperate to avoid acknowledging the obvious. And if that is what hey are reduced to doing, that is telling indeed. (And I have again outlined what we are dealing with above, cf also here -- especially note the video.) kairosfocus

Folks, See what I mean about needing familiarity with machine level processing in info systems? Device physics (or chemistry) is an enabling phenomenon. Structures apply that phenomenon to signal processing. Systems then use the structures based on the underlying processes to achieve information level results. MF is doing the equivalent of suggesting that once we understand in some way semiconductor physics and the phenomena of junctions and such like, we can then describe what is going on in a CPU and do so without residue. That is why one studies devices (and underlying phenomena), signals, structures and systems without making the blunder of imagining that more information functional levels are not adding tot he understanding. FYI, MF, Electronics is not simply Quantum physics. Devices, circuits and networks are not systems, and hardware is not software. On the soft side, machine, assembly and higher level code are not equivalent either. We all should know and readily recognise this. We should know that when we see object code working at machine level and executing algorithms [step by step, goal directed finite sequences of steps], that is what we are seeing. That is why when I see the sort of line of objections that is cropping up yet again in this thread, all it tells me is that we are seeing little more than refusal to recognise the compellingly obvious. Sad, but on track record, not unexpected. And utterly telling. KF kairosfocus

#269 Jon

One could describe the running of a computer program in terms of physics, and extremely tedious it would be, ending up by telling you that this electronic change happened in slightly different ways a few billion times, and here’s a printout of the pattern (which reproduces what you can read in the program only at much greater length). And you’re no closer understanding how, or to what end, those reactions happened.

But you would understand in great detail how those reactions happened. I admit you would not know to what end and that is precisely the point - we have no reason to suspect there is an end for the DNA/Protein transcription. If the chemistry underdetermines DNA/Protein transcription then let us know what it is that is not determined. (Presumably I don't have to explain that Joe's "answer" is not an explanation:

Because it is a code and that means it is the proper description.

) Mark Frank

It cannot be described in terms of chemistry.

Or to be more precise, it is completely underdetermined by chemistry, which is evident to anybody not being willfully obtuse. One could describe the running of a computer program in terms of physics, and extremely tedious it would be, ending up by telling you that this electronic change happened in slightly different ways a few billion times, and here's a printout of the pattern (which reproduces what you can read in the program only at much greater length). And you're no closer understanding how, or to what end, those reactions happened. Describing genetic events chemically will leave you with no idea that there are, and must be, error correction mechanisms, that there are levels of organisation of information processing (because there can't be if there's no information involved), opr, of course, that there is any actual organisation involved, chemistry not being a subject involving organisms. Jon Garvey

Mark:

The question I have is what does it add to describe that process as the translation of symbols which represent the proteins using a code over and above just describing the process (in detail)?

Because it is a code and that means it is the proper description.

To support this you quote from the rather controversial Hubert Yockey but clearly it is very common to refer to DNA as a code.

In what way is Yockery controversial? Is it because he contradicts what you are saying? LoL!

I am reversing the question and asking you what you think the value is of describing the process in terms of symbols, codes and translation as opposed to just describing the process in detail in terms of chemistry?

It cannot be described in terms of chemistry. If it could be then scientists would. IOW Mark appears to be totally clueless wrt transcription and translation. Joe

Elizabeth:

What I do not agree with is that such a system cannot arise from a simpler information processing system as a consequence of Darwinian evolution, nor that the the simplest possible Darwinian-capable information processing system is too complex to have occurred as a result of physical and chemical reactions, which also involve information (patterns of things that cause specific effects).

Whetever Lizzie. What you do NOT have is any evidence to support that scenario. Science works via positive evidence and your scenario doesn't have any. That means it isn't science. Nice job. Joe

EL "What I do not agree with is that such a system cannot arise from a simpler information processing system as a consequence of Darwinian evolution, nor that the the simplest possible Darwinian-capable information processing system is too complex to have occurred as a result of physical and chemical reactions, which also involve information (patterns of things that cause specific effects)." Like disprove the existence of God it is impossible to disprove that that happened. Could you demostrate that a code can appeare by darwinian evolution? Chesterton

ericB I think the same comment applies your responses to Lizzie and myself. I am all for detail and not being vague. I think we all quite understand at a similar level of detail how DNA/RNA is transcribed into proteins. The question I have is what does it add to describe that process as the translation of symbols which represent the proteins using a code over and above just describing the process (in detail)? You write:

I would ask you again to consider why it is that those advancing the science of biology, who are trying to be clear and descriptive, find themselves needing to talk in terms of symbols, codes, and translation.

To support this you quote from the rather controversial Hubert Yockey but clearly it is very common to refer to DNA as a code. I believe the main reason for this is because it sounds more exciting and has associations with unlocking a secret. I think it is less common to call the bases symbols and when it happens I would say it is poor choice  – possibly arising from a muddle with the letters G, C A, and T which are symbols. I am reversing the question and asking you what you think the value is of describing the process in terms of symbols, codes and translation as opposed to just describing the process in detail in terms of chemistry? Compare it to another complicated causal chain such as the position of the moon in its orbit and the resulting effect on when and where on the earth’s surface tidal creatures will be active.  I don’t think you would describe the position of the moon as being a symbol of the creature’s activity or the process as being one of translating the position of the moon into creature’s activity. What is the relevant difference to  the DNA to protein process? You have offered a couple of items as reasons for talking of symbols but they appear to apply equally to the moon/tidal creatures example.

There is no chemical necessity to those associations, and in fact we know different associations are used by some organisms.

There is every necessity if you place the DNA in a specific environment. In the same sense there is no physical or chemical necessity to the association between the Moon’s orbit and tidal creatures. You cannot tell simply by inspecting the moon and its orbit where and when on earth the creatures will be active. You need to consider the moon in a specific environment i.e. the earth and the details of its surface. If it were orbiting another planet it would have a quite different effect.

The codons represent amino acids, even though they are not amino acids and have no inherent or intrinsic relationship to any amino acid.

The orbit of the moon is not the activity of the creatures and has no inherent or intrinsic relationship to any activity of the creatures. Mark Frank

Elizabeth is right, of course, to say that Shannon information is an inadequate model to account for the DNA code having specific effects. On the other hand, it is a useful handle for deciding in what sense DNA is information at all. As Yockey says, DNA ticks all the boxes for an arbitrary semantic code, if an optimised one, (as do the others codes in life). But semantic codes also all conform to the constraints of Shannon information, such as entropy, channel width and so on, whereas purely chemical reactions do not - so those who say that "smoke" is information about there being a fire are using information in a non-Shannon, non-semantic way. DNA conforms to Shannon information in every respect, which is why Yockey has every right to say it is, at least, Shannon information. Then again, semantic information conforms to Kolmogorov complexity, whereas most natural self-organising structures like crystals do not. It has proven hard to get a handle on the concept of the "functional meaning" for semantic information in human communication as well as in DNA - but however much one disputes Dembski or Abel or Durston, the fact remains that the degree of theoretical intractability remains exactly the same for Shakespeare as for the genome: it has not proved possible to describe DNA's "function" any more easily in maths than it has to differentiate a useful computer program from a poor one. Which is suggestive of their being the same category of information. So DNA "quacks" like a semantic code, obeys Shannon's law, has Kolmorgorov complexity, and resembles the "mreaningfulness" of human semantic information. The only point at which "analogy" can legitimately be introduced in in the causation. Human information is produced deliberately, and has not proved possible to assemble by random variation and environmental selection, whereas DNA ('tis said) assembles by random variation and natural selection, and cannot have been assembled by mind. (Computer sims of life, of course, are useless in establishing that analogy in causing DNA only to appear to be "information", because they rely on representing life by semantic information in the computer program.) So what we observe, in effect, is conceptually-identical systems produced from completely different causal categories. Which is, I think, unusual in nature. Jon Garvey

Elizabeth B Liddle @240:

Now, would someone like to take a look at the information transfer cascade in my DAT example?

and @155:

In a cell, what is happening? Who is the sender? What is the message? Who is receiving it? I completely agree that information is being transferred, but I think it is salutary to analyse the transmission pathway. Take a protein like like the dopamine transporter, DAT. What is sending what information to what when DAT is expressed? ...

I would first qualify that what we see happening in the cell is more like a programmed information processing system than just sending a letter, so "sender" "receiver" does not quite capture the situation. But, we can work with that for the moment. In passing, in a meta sense, one could consider the "sender" to be the who or what that programmed the system. The protein coding information had to come from somewhere and the cell itself does not have the ability to create and populate its own protein coding information store from scratch (cf. the central dogma of molecular biology). Leaving that to the side, within the cell the "sender" would refer to the control programming (including epigenetic factors) that determines what genes will be expressed and (in eukaryotes) which alternative splicing of that gene will be used to construct the mRNA. It would also include the mechanisms for transporting the mRNA to a ribosome -- the literal act of sending. The message is carried by the messenger RNA, hence its name. The recipient is the ribosome that receives the mRNA. Notice that the DNA is not "causing" anything to happen. It is not the active agent. It is an information store and is passive in this whole affair. The agent that does "its work" to make proteins is the ribosome, which uses the information encoded into the mRNA as data, specifically as a recipe that it can translate into an amino acid sequence. This is why it is improper to attribute the processing input requirements and limitations of the ribosome translation unit as though these were properties of the information in DNA, or to infer any conclusion about the nature of information. All devices that do work, including ribosomes, impose requirements on their inputs. That doesn't define the nature of symbolic information.

... And which of the information-transfers involved is, in your view “symbolic”, and why?

As I've consistently maintained, the hallmark for recognizing the presence of symbolic information is the need for translation by a coding convention. Both symbolic information processing operations and operations that do not involve any symbolic information operate by cause and effect. The concept of cause and effect provides no discrimination whatsoever between these distinct categories. Where translation by conventions is present, symbolic information is being processed, whether by sentient agents or by unthinking systems such as computers or cells. No translation = not symbolic. ericB

Re: Elizabeth B Liddle @258, the significant problem with defining the protein coding information as

a pattern in which the arrangement causes specific effects.

or

patterns of things that cause specific effects

is that it is a retreat into vagueness -- a vagueness that is so broadly inclusive that it includes much that is irrelevant. All matter has arrangements that cause specific effects. Talking merely in terms of cause and effect is unhelpfully vague, as it avoids addressing the reality. What is fundamental and essential to biology -- and distinct from anything else we find anywhere in nature in the entire universe (excluding designed artifacts) -- is that biology depends upon the use of codes and translation. We know of no other instance of undirected nature that has this property. If we cannot talk clearly about what is unique and essential to biology, how could we begin to truly understand it? Whether we say "symbol" or not, there is indisputably and observably a translation to an amino acid sequence from a sequence that is not an amino acid sequence. There is no chemical necessity to those associations, and in fact we know different associations are used by some organisms. It is an association by a coding convention. The codons represent amino acids, even though they are not amino acids and have no inherent or intrinsic relationship to any amino acid. If we could not talk clearly about codes and translation from information to the associated meaning it represents, we would be unable to meaningfully deal with the reality. How could we begin to explain something, if we fail to even describe it accurately? ericB

Re: Mark Frank @257, I use those terms because they do indeed describe the details of what happens -- a translation from nucleotides functioning as a symbol sequence to the associated meaningful amino acid sequence via the particular conventions of an implemented code. This recognition of translation via a simple but real code is foundational biology, going back to the sequence hypothesis correctly posed by Francis Crick. Consider the consequences if biology had stopped at the vague statement, "All that we know for certain is that the same DNA string can result is different proteins depending on the context." In order for biology to advance, it has been necessary for biologists to be able to describe in meaningful and clear terms exactly what is happening inside the cell, without apology and without averting the eyes. Consider Hubert P. Yockey (my emphasis added):

It is important to understand that we are not reasoning by analogy. The sequence hypothesis applies directly to the protein and the genetic text as well as to written language and therefore the treatment is mathematically identical. - Hubert P. Yockey, “Self Organization, Origin-of-life Scenarios and Information Theory,” Journal of Theoretical Biology, Vol. 91 (1981):16

and

5. The ‘‘order’’ and ‘‘complexity’’ of DNA and protein sequences The question of whether ‘‘complexity’’ increases along a phylogenetic chain can be addressed only when the well-established de?nition and quantitative measure of ‘‘complexity’’ such as that given by Chaitin and Kolmogorov [14,16,17] is adopted in molecular biology. ... A sequence of symbols is highly ‘‘complex’’ when it has little or no redundance or ‘‘order’’ and cannot be calculated by an algorithm of finite length. ... 6. Conclusion The segregated, linear and digital character of the genome has allowed us to apply information theory and other mathematical theorems about sequences or strings of symbols to make a quantitative rather than an anecdotal and ad hoc discussion of significant problems in molecular biology. This procedure has led us to avoid a number of illusions common in the literature. The application of these mathematical procedures will play a role in molecular biology analogous to that of thermodynamics in chemistry. Information theory, evolution and the origin of life, Hubert P. Yockey, Information Sciences 141 (2002) 219–225

It would never serve science to retreat into a vague, black box description that cannot address what is happening in detail. So, I would ask you again to consider why it is that those advancing the science of biology, who are trying to be clear and descriptive, find themselves needing to talk in terms of symbols, codes, and translation. It is because that is the true reality that needs to be understood clearly, if one is to have any hope of coming to an understanding of how it came to be so. ericB

MF: You are manifesting exactly what EB is warning against. DNA is a passive info storage entity in the process, a memory bank. It is unzipped, transcribed, edited. I leave off maintenance. mRNA, already in a different code due to U not T, is transferred to ribosome, and threaded. It is a control tape for an NC machine (and that is not mere analogy, cf images and vid here noting the way paper tape readers worked), using prong height patterns to convey info. tRNAs serve as AA taxicabs and position-arm devices with universal CCA coupler tool tips. That means there is no deterministic setting of a given AA to a given codon-anticodon pair. Loading enzymes match config of tRNA and load per a code. That is an implicit dictionary. And of course there are natural and now artificial variants. The many to one variable pattern from codon triplet to AA added to protein string also bespeaks the same. I think you need to think again. KF PS: to get that link, I copied that for a comment then edited out: "#comment-467195" to get desired function. I trust that helps yo0u see the significance of editing. kairosfocus

F/N: I think I can safely say scoliosis (rapid onset) and surgery. Thots and prayers appreciated. KF kairosfocus

I am talking about information defined according to Merriam Webster' 2b definition:

the attribute inherent in and communicated by one of two or more alternative sequences or arrangements of something (as nucleotides in DNA or binary digits in a computer program) that produce specific effects

which is also a definition that Upright Biped has used. To be even more succinct: a pattern in which the arrangement causes specific effects. This is not the same as "Shannon information" because to quantify Shannon entropy you do not specify the arrangement - it merely gives you an estimate of the information-carrying capacity of the channel. The vast majority of possible arrangements in a wide-capacity capacity channel will not cause "specific effects". Clearly, the arrangement of nucleotides in DNA or RNA, or indeed the arrangments of amino acids in a peptide or protein, cause "specific effects" in a cell. What effects they cause is also a function of patterns of input of smaller molecules and ions. In other words, in living things, including multicellular organisms, what happens ("specific effects") is a result of a complex cascade of information - patterns of events. They are therefore complex information processing systems. If that is what Upright Biped is saying, I agree with him. What I do not agree with is that such a system cannot arise from a simpler information processing system as a consequence of Darwinian evolution, nor that the the simplest possible Darwinian-capable information processing system is too complex to have occurred as a result of physical and chemical reactions, which also involve information (patterns of things that cause specific effects). Elizabeth B Liddle

ericB #251 I think there is a danger of repeating the debate on symbolic with terms like "real code" and "represents". To try to avoid that can you explain what is going on besides DNA creating proteins in specific environments with slightly different proteins in different environments? Mark Frank

Elizabeth Liddle:

Clearly Mark and I are using different definitions of “symbol” from the rest of UDers.

Over at Elizabeth's blog, Neil Rickert posts:

I take the “information” of “information processing” to be Shannon information. I take Shannon information to be a sequence of symbols (such as bits). Categorization is how we get symbols in the first place. So categorization is prior to information processing.

Anyone familiar with Elizabeth's history here at UD will recall her reliance on "Shannon Information." So under what definition of "symbol" is Shannon Information not "symbolic"? Does Elizabeth even have a coherent position capable of explication? Mung

ericB:

We can say more than that. We can legitimately say that the genetic code is a real code

Absolutely. This has been demonstrated here at UD in the past. The objectors prefer to ignore THE FACTS and insist that all we have here is an analogy. Unacceptable. Mung

Elizabeth Liddle:

Nobody is disputing that DNA is part of an information storage-and transfer system, nor that it is part of a complex information processing system.

And the components of an information processing system are? If you cannot say, then you cannot know. So, for the record, you now agree with Upright BiPed? Mung

Elizabeth Liddle:

Clearly Mark and I are using different definitions of “symbol” from the rest of UDers. I suggest we move on.

I suggest that you learn to communicate clearly and effectively and without equivocation. The effort can do wonders for addle-headedness. How do you propose to even begin to defend the thesis that a codon is not symbolic? Are you going to claim that codons are meaningless information? Mung

Alan Fox:

Firstly, you don’t have a method of calculating CSI. You don’t have an agreed concept of CSI and its variants.

But Elizabeth Liddle did? Or was her entire exercise a fraud? Creating CSI with NS Yes, folks, EL claimed to generate CSI and also claimed to be able to calculate it. Where was AF in that thread? Didn't he tell her she was on a fool's errand? Mung

Regarding anthropomorphism, Mark Frank @239 wrote:

However, I do disagree with this statement which has more implications:

That meaning is assigned according to the convention of a particular code

“Assigned” gives the impression that someone thought up a convention and then decided to use different variants in different situations. As I have stressed “convention” implies one or more parties agreeing on something. ... It is interesting but we should be wary of anthropomorphising it in an attempt to explain it or make it more dramatic.

I agree that it is good to be careful about connotations and inadvertently adding unwarranted assumptions. In all my references to "conventions", "codes", "symbols", "symbolic", etc., I am always using these in a denotative sense that describes their function in a "complex information processing system", as Elizabeth said @240. I don't intend by any of these terms to merely and directly assume that the convention was made by sentient agents, and so on. Without begging the question, one of the possibilities to be considered is whether it makes more sense to attribute such a "complex information processing system" to an origin from undirected chemical processes or to an origin from intelligent agency. I do, of course, think all considerations point soundly and conclusively to the latter conclusion. I would maintain that it is not possible for chemical processes to develop this type of complex system for manipulating symbolic information that is stored and translated according to an extrinsic code. This would not happen regardless of the time allowed. However, I do not merely suppose that by assuming an anthropomorphic connotation to these terms, and I would not consider that a legitimate way to draw conclusions. At the same time, I would say there is an equivalent danger on the flip side. It would be easy for those who do not welcome an intelligent source for life to choose to avoid acknowledging the appropriateness of terms that correctly imply a real difficulty for their position. Word connotations can be used to tilt perspective in an unwarranted manner in either direction. For example, I would disagree with this characterization.

All that we know for certain is that the same DNA string can result is different proteins depending on the context.

We can say more than that. We can legitimately say that the genetic code is a real code (which is what makes it possible for your observation to be true), even without supposing it was made by intelligent agents. Even if chemicals made it, it is still a real code -- not an analogy to a code, but a genuine code. We can also say that each codon "... represents, [or] stands for ... an ... action, or material entity" [such as STOP making the protein, or add the associated amino acid (a material entity) to the growing polypeptide chain]. This, of course, is wording adjusted and borrowed from the definition of symbol, as provided by kairosfocus @249. This is similar to "Something that represents something else by association ... or convention, ..." provided by CentralScrutinizer @186. Even if you preferred to avoid the term "symbol", what matters is that you do not deny the reality described by these definitions. So long as we agree to affirm the reality, that particular term is not strictly necessary. The meaning of the term is an essential part of the reality of the situation to be studied and explained. Therefore, its reality must not be denied. ericB

kairosfocus @231, I don't know the particulars about the situation. Nevertheless, I join with what others have expressed. May it go well with you and with your son! ericB

F/N: On "symbol," wiki: >> A symbol is an object that represents, stands for, or suggests an idea, belief, action, or material entity. Symbols take the form of words, sounds, gestures, or visual images and are used to convey ideas and beliefs. For example, a red octagon may be a symbol for "STOP". On a map, a picture of a tent might represent a campsite. Numerals are symbols for numbers. Personal names are symbols representing individuals. A red rose symbolizes love and compassion. >> In this generally accepted sense, AUG is a symbol for start and load Methionine in an AA string. Since the tRNA -- cf the video in the post I made -- is coupled to the AA with a CCA universal coupler end, the specific AA for each tRNA is programmed. And obviously, with the anticodon at the other end of the folded tRNA, there is no necessary connexion between a given anticodon and a given AA. Indeed in several cases in the code(s) there are different anticodons that target the same AA. There are also three stops, and advantage has been taken to reprogram so that different AA's are loaded. None of this should have to be belaboured, but this is all to revealingly familiar. KF kairosfocus

AF: It's a little late to try a take-back, given your tactics that are even manifested in the catchphrase you propose relative to quite evident facts on the table. We will take due note, and respond accordingly to the tactics we are so plainly seeing. KF kairosfocus

MRI scan kairosfocus

Ribosomes are ubitiquitous and vary across archaea, bacteria and eukaryotes. Shades of evolution there too. Alan Fox

BTW Alan, ribosomes are not generic- there are differences. Joe

Elizabeth:

Clearly Mark and I are using different definitions of “symbol” from the rest of UDers.

What definition of symbol are you using? Joe

I had no idea there were so many variants on the standard genetic code. So I was wrong in thinking there was only one known “machine” for transcribing DNA into proteins.

The "machine" that translates mRNA into proteins is the ribosome and all living cells have them. The variations in the genetic code are small but highly significant. Most variations occur in prokaryotes and mitochondrial DNA that hints at an evolutionary element to the genetic code. Alan Fox

To clarify my remark Karthago (sic) delenda est, I was suggesting I should end all my comments with "and has anybody got a hypothesis of "Intelligent Design" yet?" after the habit of Cato appending Karthago delenda est to all his Senate speeches. BTW it translates as "Carthage must be destroyed" and is often a text book example of the use of the gerundive. I was not intending to imply any parallel between the fate of Carthage and that of ID. Alan Fox

I could go on and on, but I have much more important, closer to home medical issues today, a big day for my son.

I echo Lizzie's sentiment. Best wishes for the best possible outcome, G. Alan Fox

Clearly Mark and I are using different definitions of "symbol" from the rest of UDers. I suggest we move on. Nobody is disputing that DNA is part of an information storage-and transfer system, nor that it is part of a complex information processing system. Now, would someone like to take a look at the information transfer cascade in my DAT example? Elizabeth B Liddle

ericB I have moment to look at this again. First - thank you for your comment #238. I had no idea there were so many variants on the standard genetic code. So I was wrong in thinking there was only one known "machine" for transcribing DNA into proteins. As I have stressed many times above, it seems not to be very interesting to debate the correct meaning of "symbolic". However, I do disagree with this statement which has more implications:

That meaning is assigned according to the convention of a particular code

"Assigned" gives the impression that someone thought up a convention and then decided to use different variants in different situations. As I have stressed "convention" implies one or more parties agreeing on something. All that we know for certain is that the same DNA string can result is different proteins depending on the context. It is interesting but we should be wary of anthropomorphising it in an attempt to explain it or make it more dramatic. Mark Frank

Mung's STOP example @219 is instructive and revealing.

T – is a symbol that we happen to use, by convention, for thymidine. A – is a symbol that we happen to use, by convention, for adenosine. G – is a symbol that we happen to use, by convention, for guanosine. Put them together and what do they spell? TAG! or STOP!

Even among the nuclear genetic codes, TAG does not always represent a STOP code. In the Ciliate, Dasycladacean and Hexamita Nuclear Code and in the Blepharisma Nuclear Code TAG is used to represent an amino acid (specifically (Gln/Q) Glutamine), not a STOP code. While the standard code also uses TAA and TGA as STOP codes... the Euplotid Nuclear Code uses TGA for an amino acid (specifically (Cys/C) Cysteine), and the Ciliate, Dasycladacean and Hexamita Nuclear Code uses TAA for an amino acid (specifically (Gln/Q) Glutamine). So we see, even from Mung's example of STOP codes, that different genetic codes follow different coding conventions for STOP. In short, there is no inherent meaning of STOP for a sequence of nucleotides. It cannot be deduced from the properties of nucleotides. That meaning is assigned according to the convention of a particular code. It is extrinsic, not intrinsic. In other words, these codons are functioning as symbols that represent certain assigned meanings according to a convention. That is exactly what it means for a sequence to be functioning as a carrier of symbolic information. ericB

GAACUUUAAAUUUCUUAAUGGAGAAAUGGUUAA Chesterton

KF

I have much more important, closer to home medical issues today, a big day for my son.

My thoughts are with you today, KF. I have been wondering how things are going. Elizabeth B Liddle

Alan Fox:

Firstly, you don’t have a method of calculating CSI.

Yes, we do. YOU are just too ignorant to understand it. OTOH your position has absolutely nothing- which is exemplified by your avoidance of supporting it. Joe

Lizzie:

I simply do not think it is a SYMBOLIC system.

The EVIDENCE says that it is symbolic. So no one cares what YOU think. Joe

Alan Fox:

Except that tranlation of mRNA to protein does not involve symbolism.

Yes, it does- that is according to the experts it does.

It is purely biochemical.

What is the evidence that supports your tripe, Alan? And why don't biologists agree with you? Joe

Alan Fox:

Secondly, evolution involves the non-random process of natural selection (or as I like to refer to it, environmental design) so the whole argument about “blind chance” is moot.

In what way is natural selection non-random? Please show your work, or stop lying. Joe

F/N: I have put up a headline, here. 1 --> I take the correction, which I spotted after I posted. Cato. 2 --> I see more strawman distortion and red herring tangent tactics. Doubtless, the strawmen are to be soaked in ad hominems and set alight to cloud, poison and polarise the atmosphere. As usual. 3 --> I suggest, on defining ID, the UD reference on that is helpful:

The theory of intelligent design (ID) holds that certain features of the universe and of living things are best explained by an intelligent cause rather than an undirected process such as natural selection. ID is thus a scientific disagreement with the core claim of evolutionary theory that the apparent design of living systems is an illusion. In a broader sense, Intelligent Design is simply the science of design detection — how to recognize patterns arranged by an intelligent cause for a purpose. Design detection is used in a number of scientific fields, including anthropology, forensic sciences that seek to explain the cause of events such as a death or fire, cryptanalysis and the search for extraterrestrial intelligence (SETI). An inference that certain biological information may be the product of an intelligent cause can be tested or evaluated in the same manner as scientists daily test for design in other sciences.

4 --> The Darwinist proposed body plan macro evo mechanism IS chance based, despite attempts to pretend otherwise. Chance variation [CV] + differential reproductive success in situations [DRS] --> incremental descent with unlimited variations [IDWUM]. The CV is chance, the DRS is largely chance and is in any case a subtraction of info from the pop by extinction of the less lucky, less "favoured" (Darwin's word) or less fit, and the IDWUM is an assumption that -- contrary to what we observe for FSCO/I that well matched multiple parts must be put together the right way to work -- there is a vast, incrementally accessible continent of life functions. For which there is no credible observational evidence. As the tree of life misleading icon reveals on closer inspection of those overwhelmingly absent missing links. 5 --> The bald assertion that there is no way to calculate CSI is a bald faced lie [and yes, your deliberate continuation of a misreresdenation of truth one should know and should acknowledge is a lie, AF . . . ], one that has been repeatedly shown false but is insisted on anyway. Cf here on (esp here), and also cf the work of Durston et al at more sophisticated level. Stating:

Chi_500 = I*S - 500, functionally specific bits beyond the solar system threshold.

6 --> Onlookers, every time you look at a file capacity beyond 500 - 1,000 bits you are looking at CSI. That is a good part of why we know there are billions of test cases that show that FSCO/I is an excellent and reliable indicator of design. And AF knows or should know that. This brazen dismissive statement on his part is deceitful and tells us much about his Carthage must fall attitude. ******** I could go on and on, but I have much more important, closer to home medical issues today, a big day for my son. Good day. KF kairosfocus

No that wasn't a Freudian slip. Intelligent and Imaginary are synonymous in the context of ID! Alan Fox

Your link supports my point hat ID only has default arguments.

The theory of intelligent design holds that certain features of the universe and living things are best explained by an intelligent cause, and are not the result of an undirected, chance-based process such as Darwinian evolution.

Notice that "chance-based process such as Darwinian evolution"!

We can examine biological structures to test if high CSI exists.

Then why has nobody ever done it? And counting numbers of nucleotides or residues is trivial. It tells us nothing that we didn't already know. Logarithmic transforms only manipulta the data. Nothing extra is added.

Language and machines are good examples of things with much CSI. From our understanding of the world, high levels of CSI are always the product of intelligent design.

Humans communicate using language and can build machines. Yet life existed on Earth for possibly 3 billion years before people! What a daft analogy!

Because they exhibit high levels of CSI, a quality known to be produced only by intelligent design, and because there is no other known mechanism to explain the origin of these "irreducibly complex" biological structures, we conclude that they were intelligently designed.

Notice that "known"? There's the key to the default argument! We don't know what we don't know. Defaulting to "Imaginary Design" because we don't yet have an evidence-based explanation is not science. Alan Fox

Now, back to the challenge of actually — per observation — generating FSCO/I beyond 500 – 1,000 bits [oops above] by blind chance or mechanical necessity.

Several issues here! A couple to start with. Firstly, you don't have a method of calculating CSI. You don't have an agreed concept of CSI and its variants. CSI{Dembski}=/=FSC{Durston}=/=FSCO/I{GEM} and all is merely a default argument assuming (following the argument that "chance alone" cannot generate complexity "Intelligent Design" must occur. As to how, when, how often, by whom... we are left to speculate on the supernatural and how imaginary forces could impinge on reality and how this might be measured. Secondly, evolution involves the non-random process of natural selection (or as I like to refer to it, environmental design) so the whole argument about "blind chance" is moot. Alan Fox

Cato the Elder, not Cicero, KF! Alan Fox

PS: IDEA's summary of the scientific framework of ID in a nutshell. Now, back to the challenge of actually -- per observation -- generating FSCO/I beyond 500 - 1,000 bits [oops above] by blind chance or mechanical necessity. kairosfocus

Onlookers: AF has been at UD from the beginning. Eight years. He therefore full well knows -- it having been stated in his presence umpteen times -- that, for instance, a clear case of observation where genuinely blind chance and mechanical necessity are observed to generate an increment of 500 - 1,0000 bits or more of FSCO/I (equivalent, roughly to a protein code of 250 - 500 AA's/codons) would be decisive against ID. (Cf. here and here on. Likewise, Durston's one-pager here and here at ENV are helpful. Meyer's essay on methodological equivalence of design and descent approaches here will also be useful.) In short, it is a longstanding test-point of ID that beyond a relevant bound set by solar system or observed cosmos scale atomic resources, FSCO/I (or any similar form) will not credibly be accessible by blind chance and mechanical necessity. Of course, there have been many attempts over the years. Every one of them, from canals perceived on Mars by astronomers 100+ years ago, to the infamously misleading Weasel and genetic algorithms, to a YouTube video of clocks allegedly evolving blindly, have been shown to depend crucially on subtle or blatant injection of active information that narrows the target zone. Similarly, he full well knows that it is now ten full months since a direct challenge to address warrant for the evolutionary materialist picture of origins for the world of life through a ~ 6,000 word essay [maximum reasonable length for a blog post] with onward links to more and obvious provision for images and videos [as this would be a hosted original post] was put on the table by the undersigned, to address OOL and body plan macro-evolution, including the resolution of the pivotal tree of life icon. This has been a free shot at goal offer, and it is utterly telling that after ten months, there have been no serious takers. It is clear then that we are not dealing with reasonable discussion but implacable enmity, which is exactly what Cicero's Carthage must fall [by implication in light of the history of the Punic wars, by any means deemed effective . . . ] catchphrase represented. So, AF is here repeating a talking point he full well knows is false and misleading, the better to enmesh the naive or unwary. That is sad, but we need to face the reality of the sort of implacable, ruthless ideological enmity we are dealing with. KF kairosfocus

And in the spirit of Carthago delenda est if anyone has a testable hypothesis of "Intelligent Design", that would be good, too! Alan Fox

No alternative representation can be substituted.

This is just so blazingly wrong.

Lizzie is referring to the biochemical properties of DNA, RNA, protein and the biochemical processes of replication, transcription and translation. Mung asserts that Lizzie is wrong to suggest that no alternative "symbols" or "representations" will do the job. Mung can, perhaps support this assertion with an example. Or can he? Let's see! Mung and anyone else is welcome to supply examples of alternative "symbols" to molecules involved in protein synthesis and gene replication. Alan Fox

That’s right Alan, and we’ll just bury our heads in the sand any time we hear “RNA Word.”

Well, you are welcome to do so. I have been sceptical about RNA world as a possible route from Ool to self-sustaining self-replicators as I was influenced by Robert Shapiro's views. (Professor Shapiro strongly advocated looking for extra-terrestrial life in order to progress theories of Ool). Allan Miller at TSZ has been a persuasive advocate of RNA world and, looking at the quantity of recently published papers in the field, it seems currently a fruitful area of research.

Well just forget about those RGB cables we used to connect to our monitors and the digital cables we now use to the same effect. (HT: Elizabeth for that analogy.)

Analogies (like cables) work less and less well the further you stretch them. And for yourself, the analogy often seems the explanation, rather than an attempt to model reality.

You people really are amazing. just amazing. And I don’t mean that in a good way.

I have no doubt you have a very low opinion of people that don't share your views (whatever your views might actually be). Should anyone care? Alan Fox

Mung @219 Can you please stop being rational, its 2013 and in the eye of the naturalist a can be A and not A! It's just a matter of opinion! What's true for you may or may not be true for them it's all relative you see, just as long as it does not point to the truth of an Intelligent Designer everything is just fine and dandy! What red ball? Andre

There are too many comments here to read them all – much less respond. I apologise to anyone who has written something that deserves a response. Mark Frank

ericB:

Does anyone (Elizabeth B Liddle, Mark Frank, et al?) think this is a reasonable argument? 1. Even though information X could be converted into many different representations and mediums, receiver R requires that information X is provided in medium M using the encoding convention C, or else R cannot “do its job” with X. 2. Symbolic information would not have this limitation. 3. Therefore, information X must not be symbolic information.

I do! The problem here is your reliance on "symbolic" information. T - is a symbol that we happen to use, by convention, for thymidine. A - is a symbol that we happen to use, by convention, for adenosine. G - is a symbol that we happen to use, by convention, for guanosine. Put them together and what do they spell? TAG! or STOP! Therefore, the only "symbolic information" present is the symbols we ascribe to what they represent. QED Mung

Mark Frank:

In the case of DNA the code (and I think the word “code” here is used by analogy with human codes) is implemented in the cell machinery and that is the only place it existed for billions of years (of course we have copied in recent decades).

So Mark, how can we determine whether the use of the word "code" is merely by analogy? Ideas? Is there some clear definition of what constitutes "a code" that we can go to as an impartial guide? This subject has been addressed before here at UD and the objection refuted. Some people just refuse to face FACTS. Time for an addition to the weak argument corrective pages. Mung

ericB:

Consider the convention of Morse code, which involves sequences of short signals (or dots) and long signals (or dashes).

Want to bet there's an underlying design? That what the dots and dashes represent wasn't just "selected" at random? One guess as to which letter in the English alphabet is represented by a single dot. Mung

kf:

What is going on here is refusal to see a machine level molecular nanotech info system for what it is, a sure sign that the evidence is strongly against the deniers.

Willful blindness. That's what happens when you get your head too close to a high voltage circuit board. =P Mung

Alan Fox:

DNA’s relationship to protein is so obviously physico-chemical, it is hard to comprehend the suggestion of symbolism.

That's right Alan, and we'll just bury our heads in the sand any time we hear "RNA Word." Well just forget about those RGB cables we used to connect to our monitors and the digital cables we now use to the same effect. (HT: Elizabeth for that analogy.) You people really are amazing. just amazing. And I don't mean that in a good way. Mung

Elizabeth Liddle:

A DNA sequence does not “represent” a protein. It is, rather, a segment of a polymeric molecule which, in an environment that contains certain other polymeric molecules, results in a specific protein. It is, in other words, a physical object that is a necessary, but not sufficient, for that protein to be formed. No alternative representation can be substituted.

This is just so blazingly wrong. These are the kind of people we are dealing with. They do not understand information or information theory, and they do not understand biochemistry. Or they are just "addle-headed." DNA is transcribed into RNA. The RNA stands in quite nicely, thank you very much. Many people, Elizabeth probably among them, believe RNA preceded DNA. Mung

Mark Frank:

As far as I know, biologists and information scientists do not say that nucleotide strings hold symbolic information.

In the midst of moving. Books in storage. Gah! reminder to follow-up Mung

Mark Frank:

I was pointing out that there are lots of instances where “A causes B and A is not symbolic information about B.”

Well DUH! Why would you even think you needed to point that out?

Actually, as I pointed in #133 a paper tape, magnetic tape, punched card need not contain any information at all. The holes/magnetic marks may be totally meaningless.

So you don't fall into the "meaningless information" camp of Elizabeth Liddle and Allen McNeill? Mung

UBP:

Attempts to characterize the system in language that doesn’t reference how the system actually functions is like trying to characterize thermodynamics without reference to heat or energy.

Mung:

Is still cold air more or less “ordered” than still hot air?

That one is still awaiting a response from EL. Mung

Dr Liddle, your comments are duly noted. Where they are not incoherent, they are trivial.

She does stand out in a crowd, doesn't she. Meaningless information is as meaningful as useless information. UPB, I am happy to do the slogging through nonsense that you have long ago given up doing :)

A meaningless signal can be transmitted noisily or losslessly.

A meaningless signal. What would that consist of? Wikipedia:

A signal as referred to in communication systems, signal processing, and electrical engineering "is a function that conveys information about the behavior or attributes of some phenomenon".

Oh, and back to info 101. It's aboutness.

Both meaningful and meaningless signals can be transferred directly and physically into some other physical form

How? How does one translate a "meaningless signal"? According to what code?

“I’M RATHER ADDLE-HEADED RIGHT NOW ” – Elizabeth Liddle

More honesty and less obfuscation can do wonders for addle-headedness. Mung

Does anyone (Elizabeth B Liddle, Mark Frank, et al?) think this is a reasonable argument? 1. Even though information X could be converted into many different representations and mediums, receiver R requires that information X is provided in medium M using the encoding convention C, or else R cannot "do its job" with X. 2. Symbolic information would not have this limitation. 3. Therefore, information X must not be symbolic information. Is it not obvious that the constraints here are properties and limitations of the receiver R that works with X, and not a valid critique on the nature of X? Elizabeth, if I am mistaken, please correct me. It seems that you, at least, think there is something to this argument so long as... X=the information in protein coding DNA R=a ribosome M=mRNA, and C=the genetic code used by that ribosome. But would anyone still think this argument makes sense when, for example, X=food recipes, R=a blind person, M=printed using raised dots on paper (not ink on paper), and C specifies the braille convention known to that blind person. OR X=food recipes, R=a sighted person who reads only English, M=a printed (ink on paper) cookbook (not raised dots), and C specifies that the recipes are in English. "That representation does not work for me" therefore "it must not be symbolic information"? Can we really legitimately infer "not symbolic" from "this reader has these requirements for medium and coding convention"? Those are the limitations of the receiver/processor, not a definition of the concept of symbolic information itself. Since every symbolic information processing system imposes limiting requirements, how does it make sense to deny the nature of symbolic information (i.e. translation by a convention) based on the processing limitations of some processors of that symbolic information? ericB

Mark Frank @178 wrote:

In principle this is no different from dropping stones into a complex river pattern and noting the resulting changes in water flow downstream. It is just a very complicated river pattern and reliable river pattern.

Every physical system involves cause and effect. As long as you only think about cause and effect, you won't be able to distinguish symbolic information processing systems from systems that do not involve symbolic information. They both involve cause and effect. It is an irrelevant consideration for the topic, since it does not provide any distinction. When you say, "In principle this is no different ...", the mistake you are making is failing to consider the pivotal distinction, which is translation. The rock examples do not involve any translation. Genetic codes and Morse codes do involve translation. Translation is the hallmark of symbolic information. If you need to translate according to a code, you have symbolic information. If you can trace cause and effect without any translation according to any coding convention, then you don't have symbolic information. @180 you wrote:

Well there is one obvious difference. In the case of a human code the code is defined first and then possibly a machine is built to implement it (or possibly not). In the case of DNA the cell machinery existed first and we worked out the code to describe the relationship between DNA and protein. i.e the first case is prescriptive the second case descriptive.

The order in which we learned about something does not determine its nature. When you say, "we worked out the code to describe the relationship..." it almost seems to be the case that you believe the genetic code is something we just made up after the fact. Yet, whether we knew about it or not, it has been real for the entire history of cells that make proteins. Cells require translation to make proteins. You asked, Where is the dictionary? and I showed you the cell's dictionary for its coding convention, i.e. the set of transfer RNA molecules it uses to map from codon to amino acid. How might we use any mapping dictionary for symbolic equivalence? We look up a word or term and find its associated entry. How does the cell go from codon to amino acid? It finds the matching entry from its set of associations and applies the associated amino acid entry. If you are reluctant to acknowledge this is a true and genuine coding convention, what is the principled reason for not accepting this as a fact? Forewarning: Answers such as, "codes are made by humans", would not be legitimate distinctions. In terms of the work of translation, how is the cell not using a true code to map from codons to amino acids? ericB

EL: Pardon, I am tempted to say, SHOW it. I won't; instead, I will again note that -- as my context indicated or at least implied -- I am speaking of machine language info processing down at the level where physical quantities and states are used in material objects to carry out operations step by step. Everything above that level is abstract or virtual. The level that is relevant to the molecular nanotech of life. So, let us know, have you been doing machine code level info processing at the level where hard and software meet, using physical arrangements, forces and processes, to effect algorithms? Can you not at least see why molecular nanotech can be doing much the same? Let me give a simple (mechanical) example that as it turns out is close to one facet of what happens in ribosomes. The common Yale lock, where info is coded in a pattern of prong heights (and shapes of slots etc, but let us keep it simple). When the right pattern is passed, the lock will turn and open, but not otherwise, based on spring-loaded pins. Physically, nothing is happening apart from basic physics. And yet, stepping back, we see a physical manifestation of a password. And of course, the tRNAs use exactly the same prong height system to pass in sequence the right AA's to an emerging protein. Where, recall, the tRNA's are coupled to the AA's using a standard CCA coupler. (I specifically spoke about reprogrammed tRNA's loaded with non biological AAs to make new artificial proteins.) Now, at this stage, frankly, I do not expect you to be willing to acknowledge that anything I say has merit. After all your site is hosting slander against me that you tried to deny existed then to defend on excuse of free speech, neatly side stepping the difference between liberty and licence. Similarly, I and others have had to deal with your responses to the world partition imposed by a bright red ball on a table, and even to how it is impossible for a rock to be deluded that it is aware, and equally impossible for us to be mistaken that we are aware -- never mind if we make errors as to what we are aware of. But, I do think I should at least speak for record, so that unreasonableness does not swarm down the state of the case on the actual merits. And, somewhere, for no reason I can objectively justify (given a two-year or so track record), I find a glimmer of hope that good sense will prevail. Good night. KF kairosfocus

EL: "thinking that that means it will work just as well if it is transcribed into another medium. It won’t." In #169 I give some examples how it works in other mediums. Chesterton

It's only about what the information processing translates into at that instance in time that makes it a symbolic system. Just because you can't identify or deduce a receiver, doesn't make it non-symbolic. And it doesn't matter if you can't convey that same information through a different medium, that seems like a ridiculous argument. If DNA translates into a higher order physical structure (such as a protein), then it used a symbolic system to do so. The receiver in this case is the protein itself. That is why DNA is an advanced code where a direct functional relationship between the code and the physical system is established. The closest thing we have to that is assembly lines (ie: electro-mechanical automation) and even that analogy doesn't do justice. computerist

Elizabeth B Liddle @201:

Its not a symbol system by the perfectly clear criteria I have given: it doesn’t do the job if transferred to any other medium, whereas symbols do.

You are implying that true symbols don't have the limitation you mention with regard to medium, but that is clearly false. You appear to be confusing two different considerations. A. Is X symbolic information? B. Is symbolic information X usable by reader R? Adding the requirement "symbolic information usable by reader R" obviously adds considerations beyond whether X is symbolic information or not. This can be seen from your own examples. To be usable to reader R... 1. Usable symbolic information must be in a medium that R can read. Suppose we transfer a food recipe expressed as symbolic information into any digital medium, whether it be an old floppy disk or a new thumb drive. You as a human reader could not read it directly. It would not "do its job" for you. Does that mean it is reasonable to conclude that it is not symbolic information? If the symbolic information were printed on paper, nevertheless a blind person could not read it. Does that mean it is not symbolic information? Any information that you could put on paper could also be put onto a CD. Can we reasonably conclude that CDs never contain symbolic information, since only a CD drive can read from that medium? 2. Usable symbolic information must be expressed with an encoding convention that the reader R is able to decode. If the symbolic information were expressed in a language you did not know, you would not be able to read it. It would not "do its job" for you. Does that make it is no longer symbolic information? Implications... You seem to think you have made a clear distinction that allows you to say that protein coding DNA and mRNA do not hold symbolic information. Yet, I have not seen any distinction from you that could be reasonably applied consistently in the context of known examples -- including yours -- of symbolic information. Each one can easily be seen to become absurd when applied. In particular, it is a clear non sequitur to jump from observations about whether a particular representation of symbolic information can "do its job" to the conclusion it is not symbolic. Can you provide any example of symbolic information that does not break down upon inspection and a consistent application of your distinction? ericB

That is rather the point.

My point is it's a worthless point.

Did I ever tell you that I think you treated John Davison quite shabbily?

Umm..how is that Alan Fox? A while back I setup a blog for him and gave him some advice on how to run it himself (without the assistance of Alan Fox). Last I remember John was quite happy to become an independent blogger. computerist

EL, You're quoting Computerist, not me. At any rate, Alan Fox and Elizabeth B Liddle, I stand by what I said, and it's so patently obvious that there's nothing else that I can say. Readers can make up their own mind. CentralScrutinizer

Central Scrutinizer

That’s only true from the point of view that humans didn’t “invent” it. It’s a very restrictive view which basically denies from the onset the possibility it may be the result of ID.

No, it is not "only true from the point of view that humans didn't invent it". It would be perfectly possibly to figure out that a symbol system invented by someone other than a human was a symbol system. Its not a symbol system by the perfectly clear criteria I have given: it doesn't do the job if transferred to any other medium, whereas symbols do. It, is, however, an information storage system, and forms part of an information transmission system. So no, it doesn't deny from the outside that it may be the result of ID. In fact it would be strange if an ID invented a symbol system to accomplish what a cell does. We don't. We use symbols to communicate with each other, but when it comes to actually moving stuff around, we use physical information storage systems and transfer systems that require a specific medium. Which is why you can't play a cassette tape on a CD player. Elizabeth B Liddle

KF

EL: It is obvious you have not had to work closely with information processing, or refuse to make connexions that are patent. That is exactly the sort of thing that Euler warned against 250 years ago. But then, your ilk struggles with things like what a red ball on a table points to. KF

Kairosfocus, please desist from accusing me of saying things I am not saying. It's getting very tedious. And, as it happens, information processing is one of the things I do for a living. I have just spent the last five days and nights processing information, running montecarlo bootstraps on signal processing data, in fact, and measuring its information entropy among other things. That doesn't give me the right to tell you what information processing is or isn't, but it might just give you pause to consider that perhaps I am not quite as green as I'm cabbage-looking. And I don't have an ilk. Elizabeth B Liddle

'I AGREE that DNA stores information. I AGREE that this information is is transferred into it and out of it. I AGREE that it therefore is part of an INFORMATION PROCESSING SYSTEM. I simply do not think it is a SYMBOLIC system.' Don't shout, Elizabeth. Axel

Computerist:

That’s only true from the point of view that humans didn't “invent” it.

That is rather the point. PS Did I ever tell you that I think you treated John Davison quite shabbily? Alan Fox

I simply do not think it is a SYMBOLIC system.

That's only true from the point of view that humans didn't "invent" it. It's a very restrictive view which basically denies from the onset the possibility it may be the result of ID. computerist

And I could have said:

Depending upon the energy source and other circumstances, these indescribably complex entities can reproduce themselves with great reliability at times as short as 10-20 minutes. Each reproductive cell cycle involves literally hundreds of millions of biochemical and biomechanical events. We must recognize that cells possess a cybernetic capacity beyond our ability to imitate. Therefore, it should not surprise us when we discover extremely dense and interconnected control architectures at all levels. Simplifying assumptions about cell informatics can be more misleading than helpful in understanding the basic principles of biological function.*

* My emphasis Alan Fox

Or I could have said:

Two dangerous oversimplifications have been (i) to consider the genome as a mere physical carrier of hypothetical units called “genes” that determine particular cell or organismal traits, and (ii) to think of the genome as a digitally encoded Read-Only Turing tape that feeds instructions to the rest of the cell about individual characters.

Read it here. Alan Fox

@ CentralScrutinizer You're confusing reality with perception. The basic biochemistry practically common to all living things has been around for three billion years or so without needing you to verbalise it. Alan Fox

It is purely biochemical.

That's like saying, "except that translation of computer source code to object code does not involve symbolism. It is purely electronic." As if your statement somehow erases that fact that it's a systematic process of the translation of symbols.

Unless you want to tell me where the symbolism is!

Look at a codon table (aka genetic code) you'll see the symbols, they map from codon to amino acid. The protein machinery that KF described does this translation based on a deterministic, systematic mapping. That is, it reacts in a deterministic, systematic way to achieve a translation of the mapped representation, i.e, the symbol. Something requiring a translation is, by definition, a symbol because it is merely an "informer" to the process that produces an end result from it. I.e, a translation. That it's a biochemical process in no way undercuts the fact that it's a systematic translation of symbol to effect. (In this case, a functional effect. Quite brilliant.) So, yes, a codon is very much a symbol of an amino acid. And a gene is very much a symbol of a protein. As are punched holes in computer tape is very much a symbol of the the characters they represent, and groups of those holes symbols of words. Except with the DNA replicator, the effects are three dimensional functional objects. CentralScrutinizer

KF #191 After a lifetime in IT I am not even clear what the connexions are that you are talking about (I am not convinced you are clear either) Mark Frank

EL: It is obvious you have not had to work closely with information processing, or refuse to make connexions that are patent. That is exactly the sort of thing that Euler warned against 250 years ago. But then, your ilk struggles with things like what a red ball on a table points to. KF kairosfocus

AF: Your attitude is exactly the attitude rebuked by Euler, 250 years ago. Nothing new under the sun. And we all understand the "if you are not an evolutionary materialist, you are ignorant, stupid, insane or wicked" talking point. KF kairosfocus

...translation, is, by definition, symbolic.

If you say so. :) Except that tranlation of mRNA to protein does not involve symbolism. It is purely biochemical. Unless you want to tell me where the symbolism is! Alan Fox

And just like the Enigma codes and Purple were codes.

Ciphers generated by cipher machines would be more accurate. And you can call the Genetic code a code if you like but is does not involve symbols. All processes, DNA replication, RNA transcription and protein synthesis are biochemical. PS I for one don't bother to read your daft and pretentious "comments-closed" homilies. Alan Fox

... Put more succinctly, any thing that requires a translation, is, by definition, symbolic. CentralScrutinizer

Dictionary dot com's first definition of a symbol:

1. Something that represents something else by association, resemblance, or convention, especially a material object used to represent something invisible. Synonym: sign.

Codons on a DNA strand are not the amino acid they "represent." The process described by KF #184 "translates" this "representation" into something else based on a "convention." I would argue that both sheet music noation and data on a music CD is symbolic by this definition. Sheet music is translated by a musician into soundwaves. CDs are translated by the CD reader into soundwaves. Music notation and CD data work at different levels. Music notation represents music at the note level, and CD data represents music at the waveform level. Both are symbolic, because both are merely representations of an end result after translation. CentralScrutinizer

Kairosfocus: I'm not sure how to say this any more clearly than I already have (several times), but let me try: I AGREE that DNA stores information. I AGREE that this information is is transferred into it and out of it. I AGREE that it therefore is part of an INFORMATION PROCESSING SYSTEM. I simply do not think it is a SYMBOLIC system. It's a fairly trivial point, and so I'm not even going to press the point any more. If people want to call a codon a "symbol" for an amino, well, I think it's stretching the term to uselessness, but that's fine as long as we are not misled into thinking that that means it will work just as well if it is transcribed into another medium. It won't. I think you read to seriously read my posts! So, how about my questions in 182? Elizabeth B Liddle

EL: Please. You full well know or should, the DNA is first unzipped then transcribed, then the mRNA may be edited and is sent to the outer ell where it is threaded into a ribosome, then used as a control tape step by step to translate to form a given protein, where the trnas use universal couplers CCA - ends to tie the AAs and are loaded by specific load enzymes that pick the conformation to match the tRNA to the AA to be loaded. You know that researchers have manipulated loadings to make artificial proteins including AAs not in the usual list. That is more or less all now grade school level info. Yockey, long ago, laid out the way this expresses elements of an info processing system, but the matter is obvious. I think you need to seriously read here. KF kairosfocus

And just like the Enigma codes and Purple were codes. kairosfocus

Yes, of course DNA can be "translated" into a symbol system, including being stored on CD. But that doesn't mean it is a symbol system in the usual (I would argue) sense of the word. The pits on a CD aren't "symbolic" of the music - they simply cause it to be emitted when put in a CD player. However, musical notation is symbolic of the music - and it doesn't matter whether it's ink on vellum, photocopy, or pixels - the same music will emerge. The medium has nothing to do with the message. However, I think Mark is right - rather than continue to argue how best to define "symbol", it's probably far more interesting to track the process of data transfer. To quote myself at 155:

In a cell, what is happening? Who is the sender? What is the message? Who is receiving it? I completely agree that information is being transferred, but I think it is salutary to analyse the transmission pathway. Take a protein like like the dopamine transporter, DAT. What is sending what information to what when DAT is expressed?

Elizabeth B Liddle

No Mark, there isn't any difference and just because we worked it out- we did that for all enemy codes- doesn't mean anything. You are just grasping at straws. The genetic code is a code just as Morse code is a code. Joe

Joe #179 Well there is one obvious difference. In the case of a human code the code is defined first and then possibly a machine is built to implement it (or possibly not). In the case of DNA the cell machinery existed first and we worked out the code to describe the relationship between DNA and protein. i.e the first case is prescriptive the second case descriptive. Mark Frank

Except it is NOT an analogy, Mark. The genetic code is a code just like human codes. True, your position cannot handle codes so you HAVE to try to sweep it away. Too bad it ain't working... Joe

ericB I don't think the situation with Morse code is exactly the same as with DNA. Morse code is the result of a convention drawn up by people - Samuel Morse to be precise. In the case of DNA the code (and I think the word "code" here is used by analogy with human codes) is implemented in the cell machinery and that is the only place it existed for billions of years (of course we have copied in recent decades). The only way to find the DNA "code" was to either understand the machinery in detail or just observe what popped out at the end. In principle this is no different from dropping stones into a complex river pattern and noting the resulting changes in water flow downstream. It is just a very complicated river pattern and reliable river pattern. But our debate is getting repetitious so maybe it is time to stop. One way round this whole thing is to just drop the phrase "symbolic information" (who cares about definitions anyway?) and list the differences and similarities between DNA to protein translation and other kinds of translation. And I think we have done of that. Mark Frank

Elizabeth B Liddle @155 wrote:

DNA in any form but a molecule could not do the job. This is not true of, for example, language, which can be not only spoken, but written in countless different media and still convey the same information.

The problem is that your analogy is broken. You are comparing two different issues as if they were the same. As I pointed out earlier, it is true for any of our input devices for symbolic information processing systems that they impose requirements on the media that they will accept and are able to process. Exactly as a ribosome requires mRNA, so also CD drives require CDs, magnetic tape drives require magnetic tapes, paper tape readers require punched paper tape, and so on. This is regardless of the fact that the information contained on any of these mediums could in principle be converted into any other digital medium -- including storage in DNA. Thus, in terms of the requirements for a physically implemented device to "do its job" of translation, the ribosome and other symbolic information input devices are equivalent in this regard. What about the ability of symbolic information (not the device that reads it or the medium it is on, but the symbolic information) to be represented in different forms and carry the same information? Here again the symbolic information in DNA can be converted into many forms, such as into mRNA (a different form that uses uracil rather than thymine) or onto paper or in the form of computer memory and (as Craig Ventor et al demonstrated) back again into an artificially created yet functional DNA genome. Are you really going to deny that Craig Ventor and company did this, or that the symbolic information that they converted back and forth was not equivalent, even though it was held by multiple different mediums? The proof is in the pudding, and the end result was a functional living organism. In short, your analogy was broken only because you did not make an equivalent comparison. When equivalent comparisons are made, the symbolic information in DNA or mRNA fulfills all the requirements for symbolic information and is completely comparable to other examples of symbolic information. ericB

F/N: Euler's rebuke to the so called "freethinkers." KF kairosfocus

Mark Frank @156, wrote:

I am not sure what counts as “an assigned or associated meaning”. It is clear enough if there is a convention established either by common usage or by some kind of publication such as a dictionary. But the DNA/Protein link is neither of those. The only thing linking the DNA to the resulting protein is the observed fact that the DNA string causes the protein to appear in a very specific environment. There was no “convention” in any other sense that I am aware of.

I have the impression that you may be getting stuck by thinking in terms of the method by which humans may often establish conventions, rather than thinking about the nature of a coding convention itself. Consider the convention of Morse code, which involves sequences of short signals (or dots) and long signals (or dashes). Notice that these sequences do not carry any inherent meaning in themselves. You could not infer their meaning only by studying the physical and chemical properties of the sequence. Nevertheless, one can translate them (if they carry symbolic meaning) by applying the matching external coding convention. If one can do this and successfully translate the sequence, that shows both the meaning of the sequence and that the sequence was functioning to hold symbolic information. Three dashes do not necessarily represent the letter "S", but by the particular coding convention of the International Morse Code, they do. Likewise, there is no inherent or necessary association between three dots and the letter "O", but by the coding convention of the International Morse code, that association between symbol and meaning applies. Notice that other coding conventions could be used, and in fact the original Morse code (now also known as the American Morse code) was different from the International Morse code. Morse code at Wikipedia The situation in this regard is exactly the same with the coding conventions used for the genetic codes of biological organisms. The mRNA sequence (or the DNA) has no inherent meaning. The very same codon in one organism can mean something else in another organism. This is because some organisms use a different coding convention. There is no universal genetic code. So, in one organism, a certain codon (triplet of bases) might represent the translation instruction to add a particular amino acid. In another organism, that same codon might represent the instruction to add a different amino acid. OR, it might represent the signal to STOP, i.e. marking the end of the sequence for translating into a functional amino acid sequence for a protein. You wondered about "a dictionary" for the convention. In the cell, the coding convention's dictionary or translation look-up table is implemented chemically by the particular set of transfer RNA molecules that it uses to implement its genetic code. As I've mentioned before, there is no inherent or necessary chemical requirement that associates a particular codon/anticodon with a particular amino acid. The codon never even touches the amino acids. The flexibility of being able to have different sets of transfer RNA molecules is what allows there to be alternate genetic codes. You can see plainly that it doesn't have to be one way or the other way. There is no law of chemistry or physics or of cause and effect that requires a particular association between symbol and meaning. Yet at the same time, the associations must not be made randomly. They must be done with complete consistency within an organism, or else the ability to translate the meaning of the symbolic information would be destroyed. That is why it is proper and appropriate to acknowledge this is a coding convention. It is neither a necessary law of nature to make certain associations, nor are the associations formed by random chance. A consistent practice that is not obligatory is a convention. Now, if you like another word that means the same thing, that would make no difference. The reality is these are coding conventions that translate between symbolic information and the associated functional meaning. The severe problem this presents is that chemicals, when left to themselves, have no interest, need, or desire to construct coding conventions for storing and retrieving symbolic information (e.g. recipes to make proteins). You can never reach the construction of such a system through blind chemical processes, no matter how many billions of years you waited. ericB

There are none so blind as those who refuse to see Andre

Andre #165

Mark Frank you can register for free!

I didn't notice - thanks! I have done it now and the story substantiates what I said. It is the scatter plot that is symbolic not the DNA! Mark Frank

“Information, transcription, translation, code, redundancy, synonymous, messenger, editing, and proofreading are all appropriate terms in biology. They take their meaning from information theory (Shannon, 1948) and are not synonyms, metaphors, or analogies.” (Hubert P. Yockey, Information Theory, Evolution, and the Origin of Life, Cambridge University Press, 2005)

BTW codes use symbols... Joe

Mark: DNA/RNA sequences could be used to hold information. Joe: In living organisms they are.

That is exactly the issue we are debating.

Who doubts that? IOW why would anyone debate that other than ignorance or an agenda?

As far as I know, biologists and information scientists do not say that nucleotide strings hold symbolic information.

So you rely on ignorance then. The following site talks about the genetic code and symbols: the genetic code Joe

MF "This goes back to your example of someone deliberately using DNA to store a recipe for making a protein. It is the external fact of the intention to communicate that makes it symbolic information." What for the cell have the DNA if it is not to "comunicate" to the "doughter cells" how to build proteins? Chesterton

EL "What we are saying is that it is not symbolic Of course it is information." It is simbolic. You can use the same code to make a computer read the DNA, a machine sintetize proteins and we and you can use it to talk. Also you can use it to modify proteins using aminoacy tRNA modified in the lab. Chesterton

Lizzie:

What we are saying is that it is not symbolic.

It is wrt protein synthesis. And nothing you can say will ever change that fact. Joe

Alan Fox:

DNA’s relationship to protein is so obviously physico-chemical, it is hard to comprehend the suggestion of symbolism.

Unfortunately for Alan he cannot provide any evidence that supports his claim wrt the DNA to protein relationship. If Alan Lizzie or mark had any evidence to support their position they would present it. Yet they have either failed or flat out refused to do so. I am sure all of that is not lost on any onlookers. Joe

F/N: It should be noted that I have designed and built digital, info processing systems, and when we get down to hardware in action working on machine code, "all" that one sees is physico-electronic transitions, based on materials and structures and cause-effect bonds in accord with physical and chemical laws etc, but the arrangement of all of that is riddled with functionally specific complex info and related organisation that carries out algorithmic step by step goal-oriented processes. What is going on here is refusal to see a machine level molecular nanotech info system for what it is, a sure sign that the evidence is strongly against the deniers. Euler's rebuke to the free thinkers so called is looking ever more dead on target. But then, what do we expect from people who refuse to acknowledge the patent reality that error exists is undeniably true, or fought long and hard before grudgingly acknowledging that one cannot be mistaken that one is aware, and still fight tooth and nail to resist the implications of a red ball sitting on a table and the implications of being able to ask why there is that ball there. This is ever more plainly a priori -- and demonstrably self refuting and amoral -- materialist ideology speaking through dismissive and distractive talking points that we are dealing with, not reasonableness and docility before evident truth. KF kairosfocus

Mark Frank you can register for free! Andre

EL and MF: Please don't try the deny and evade game, just as was doe with slander against me at your blog EL. If you do not intend to communicate denial of info -- and functional, coded info is inextricably entangled with meaningfulness -- in DNA, functionally specific complex coded and control info, I think you need to revise your talking points drastically:

MF: I am not sure what counts as “an assigned or associated meaning”. It is clear enough if there is a convention established either by common usage or by some kind of publication such as a dictionary. But the DNA/Protein link is neither of those. The only thing linking the DNA to the resulting protein is the observed fact that the DNA string causes the protein to appear in a very specific environment. There was no “convention” in any other sense that I am aware of.

FYI, MF, there is a specific code, one identified and tabulated decades ago. That constitutes meaning. Next it is not just an environment that is at work, but an info processing system that uses molecular nanotech. There is transcription, editing, transmission, translation and expression as the end product of a highly complex process, leading to proteins that function on folding etc. MF, you used to work for IBM, so you must know better than you have spoken. EL, I am through with your evasion, denial and distortion games, given your track record as a harbourer and denier of vicious slander. Good day, KF kairosfocus

Its sadly telling that KF does not consider himself bound by the same standards he demands from his perceived opponents. DNA's relationship to protein is so obviously physico-chemical, it is hard to comprehend the suggestion of symbolism. Alan Fox

Andre #161 I cannot access even the abstract of the first paper but the title suggests it is about how a scatter plot can symbolise DNA patterns i.e. the symbols are the scatter plot not the DNA. The second paper is utterly bizarre but in any case is irrelevant as to whether DNA contains information about proteins. It is exploring the hypothesis that something used DNA to communicate that it was intelligent. I think it is absolutely nutty but even it is true it is independent of the ability of DNA to produce proteins. Mark Frank

Dr Liddle and Mark Frank

What we are saying is that it is not symbolic

Really? http://www.genomeweb.com/sequencing/symbolic-scatter-plot-helps-visualize-patterns-within-dna-sequence I wonder..... Does the one below not count because perhaps those kooks from Kazakhstan are religious fundamentalists? http://www.sciencedirect.com/science/article/pii/S0019103513000791 Andre

KF - I only echo both of Lizzie's comments. The Wikipedia article does not conflict with anything we have been trying to say and there is no gambit - it is genuine attempt to explain my/our point of view. It takes quite a lot of time and thought to express things as precisely and concisely as possible. I may well do it badly, but it is a bit galling to have it all dismissed as a gambit on the basis of a quote that is irrelevant. Mark Frank

Seriously, KF, if you would for one moment consider that perhaps we are not using a "gambit" at all - but trying to explain in all seriousness why we think the way we do, it would probably aid communication! Elizabeth B Liddle

KF: nobody is saying "DNA is not info". What we are saying is that it is not symbolic Of course it is information. Elizabeth B Liddle

F/N: I am not surprised to see the DNA is not info gambit at this stage, but MF, if he were willing to examine even Wikipedia, would find the following regarding the genetic code in the article of that name:

The genetic code is the set of rules by which information encoded within genetic material (DNA or mRNA sequences) is translated into proteins by living cells. Biological decoding is accomplished by the ribosome, which links amino acids in an order specified by mRNA, using transfer RNA (tRNA) molecules to carry amino acids and to read the mRNA three nucleotides at a time. The genetic code is highly similar among all organisms and can be expressed in a simple table with 64 entries. The code defines how sequences of these nucleotide triplets, called codons, specify which amino acid will be added next during protein synthesis. With some exceptions,[1] a three-nucleotide codon in a nucleic acid sequence specifies a single amino acid. Because the vast majority of genes are encoded with exactly the same code (see the RNA codon table), this particular code is often referred to as the canonical or standard genetic code, or simply the genetic code, though in fact some variant codes have evolved. For example, protein synthesis in human mitochondria relies on a genetic code that differs from the standard genetic code. Not all genetic information is stored using the genetic code. All DNA contains regulatory sequences, intergenic segments, chromosomal structural areas, and other non-coding DNA that can contribute greatly to phenotype. Those elements operate under sets of rules that are distinct from the codon-to-amino acid paradigm underlying the genetic code.

None so blind as those who, after repeated opportunities to get it right, still refuse to see. But, the very fierceness of the refusal to look at standard, well grounded facts of life, tells us volumes about the type of ideology we are dealing with and, inadvertently, about just how strong the inference is from code and code processing info systems to design. $0.02 KF kairosfocus

Eric You can of course define symbolic information any way you wish and DNA may well conform to one of those definitions. All I can do is point out a couple of problems in your definition. This paragraph seems to be the key one.

The core idea of a symbol is that, in addition to and distinct from its own inherent properties, it also has an assigned or associated meaning such that it represents something other than itself. That assigned or associated meaning is extrinsic to the thing itself. It is not inherent, since the association is by an external convention, not by its inherent properties.

I am not sure what counts as “an assigned or associated meaning”. It is clear enough if there is a convention established either by common usage or by some kind of publication such as a dictionary. But the DNA/Protein link is neither of those.  The only thing linking the DNA to the resulting protein is the observed fact that the DNA string causes the protein to appear in a very specific environment.  There was no “convention” in any other sense that I am aware of. (I can also think of an associated meaning without a convention arising from knowing human intentions – but that is an aside) The phrase “in addition to and distinct from its own inherent properties” also needs clarifying. Whenever there is a causal chain then the effect will be distinct from the cause. Suppose  a thunderstorm causes a flash of lightening which causes my internet connection to go down which causes this comment to be delayed. This delay is quite distinct from the properties of a thunderstorm. Is this all you mean? Mark Frank

Hi, Eric. What I meant by "the thing itself" is not the thing that the DNA specify, but is the physical means by which it does so. DNA in any form but a molecule could not do the job. This is not true of, for example, language, which can be not only spoken, but written in countless different media and still convey the same information. That is why I say there is a key difference between symbolic and non-symbolic information (I do not of course deny that DNA contains information). A DNA sequence does not "represent" a protein. It is, rather, a segment of a polymeric molecule which, in an environment that contains certain other polymeric molecules, results in a specific protein. It is, in other words, a physical object that is a necessary, but not sufficient, for that protein to be formed. No alternative representation can be substituted. On the other hand, you may be reading this post on a touch screen or a CRT, or listening to it with automated text-to-voice software - the medium makes no difference to your ability to receive the information. That is because I am using symbols, I am not making physical objects that will be inserted into your brain in order to reconfigure it in a manner that results in your understanding my post. This is why, if we are using data-transmission metaphors, that IMO it is important to keep track of who is the sender and who is the receiver and what is the message. In this post, it is perfectly clear that I am using the written English symbol system to send a message - this post - to you. In a cell, what is happening? Who is the sender? What is the message? Who is receiving it? I completely agree that information is being transferred, but I think it is salutary to analyse the transmission pathway. Take a protein like like the dopamine transporter, DAT. What is sending what information to what when DAT is expressed? And which of the information-transfers involved is, in your view "symbolic", and why? I suggest none are. Rather it is a highly complex cascade of physico-chemical interactions. Which doesn't make the system any less marvellous of course. Nor the resulting expression of our thoughts any less symbolic :) Elizabeth B Liddle

Re: the definition of symbolic information, Elizabeth B Liddle @116 showed an understanding of the relevant distinction in concepts, but there was a problem with the application.

[ericB:] Suppose we have begun to use DNA to hold information for our computational needs. Would you grant that in that case the DNA is a medium for holding symbolic information?

[EL:] Yes.

[ericB:] If yes, suppose that one of the pieces of information we store in that DNA is the recipe for a protein sequence. Would that still be symbolic information? Or would it cease to be so?

[EL:] Yes, unless of course you were using it in situ in the cell. Then it wouldn’t be a symbol, it would be the Thing Itself.

Elizabeth appropriately alludes to the relevant distinction, i.e. that symbolic information represents something other than itself in contrast to a sequence that is only "the Thing Itself." Every object -- even a symbol -- is always itself, but symbolic information is additionally a coded way of representing Something Else (other than itself). The problem is that no DNA sequence -- even one carrying symbolic information representing the recipe for a protein's amino acid sequence -- ever becomes an amino acid sequence itself. There are two possibilities: + All DNA sequences are (at least) themselves, i.e. a sequence of DNA nucleotides. + In addition, some may also symbolically represent Something Else according to an external coding convention (e.g. the amino acid sequence for a functional protein). Whether the translation of the symbolic information is performed in the cell by the ribosome or in the computer by an algorithm applying the same coding convention as the ribosome, the translation to the amino acid sequence for a functional protein would give identical sequence results. We could even engineer an artificial process for constructing the amino acid sequence physically based on the computer's translation of the identical symbolic information. Thus, the location of the DNA sequence is irrelevant to this distinction between those sequences that do and those that do not hold symbolic information. Those with symbolic information can be translated to yield the functional meaning of that symbolic information by applying the appropriate coding convention. ericB

Mark Frank @145 wrote (re: the definition for symbolic information):

Sorry about that. I am confused as to what is the definition you have provided – no doubt me being careless. Can you repeat it?

Here are the essential ideas that make up the concept of symbolic information. Every object has its own intrinsic properties (e.g. of physics, chemistry, etc.) that can be studied directly. These properties are inherent in the thing itself. The core idea of a symbol is that, in addition to and distinct from its own inherent properties, it also has an assigned or associated meaning such that it represents something other than itself. That assigned or associated meaning is extrinsic to the thing itself. It is not inherent, since the association is by an external convention, not by its inherent properties. Therefore, it is necessarily true that one can never determine the symbolic meaning of something (or even whether it has a symbolic meaning) by studying the thing itself. When we consider a sequence of objects, the sequence likewise has intrinsic properties that can be revealed through study of the sequence itself. In addition, the sequence may serve as a medium for holding symbolic information. In that case, the sequence also has an assigned meaning according to the convention of some external language or code. Since the convention is external, not a property of the sequence itself, the assigned or associated meaning (if any) cannot be determined by studying the sequence itself. The hallmark of symbolic information is the process of translation whereby the convention of the language or code is applied to convert between the symbolic sequence form and its meaning, i.e. the functional form. (This could be either encoding, going from functional to symbolic, or decoding, going from symbolic to functional.) Notice that it is not required that a conscious agent is the recipient of or observer of the process of translation. For example, we routinely make automated computing systems that manipulate symbolic information without human supervision or direct human involvement. Protein coding DNA and mRNA fully satisfy the requirements of symbolic information bearing sequences. They hold the recipes for protein amino acid sequences in a symbolic form. This is clearly symbolic information since it cannot be accessed apart from applying the correct coding convention for that organism. When the process of translation produces the functional protein, we observe the proof that the input sequence carried symbolic information. ericB

UB #150

DNA is not part of a semiotic system merely in theory; it is a demonstrated empirical reality. The demonstrated fact is that the cell processes information under the same steep physical requirements as found in an ant producing a pheromone, or a bee communicating the direction of food to the other bees, or a human writing “apple” on a piece of paper – and these material conditions are singularly unique among all physical conditions.

Let’s get precise here. I keep on writing just “information” when I mean “symbolic information” so it is my fault. Some systems that process information are semiotic - use signs or symbols - others do not. Your examples include a mixture. The ant does not uses a symbol and is not semiotic The human writing “apple” is semiotic. The bee is somewhat debatable although I would say not.  Do you want to claim DNA transfers information, which I would accept, or that it is semiotic, which I would not? What are these steep physical requirements and are they requirements of semiotic systems or any old information processing system?

Also, re: your position that in order to know that information exists we must first know the intention of the human sending it. Obviously this is unusably anthropocentric. We know any instance of recorded information exactly the same way as any other instance of recorded information – and that is by the functional effect it has within the animate natural world. When we see ants attacking their enemies in unison, we ask the question of how the ant coordinate their attack and we naturally look to the presence of information. When we see a bat honing in on its prey in the darkness, we do not look to gravity and thermodynamics, we look to complete systems capable of offering a valid explanation, and again, we look to the presence of information. The translation of information harnesses the laws of physics to produce material effect not reducible to those laws, but reducible only to the local organic systems that transcribe and translate that information. Human intention has nothing to do with it except where humans are concerned – a mere drop in the bucket to the total volume of information transfer taking place in nature.

Again there seems to be some confusion between symbolic/semiotic information and any old information. To know about the information conveyed by symbols we definitely have to know the intention of the agent creating the symbols. In theory this could be the intention of any animal but I think humans are probably the only ones capable of it. There are some debatable cases with apes.  On the other hand I agree that a wide range of living creatures and indeed non-living systems are capable of transferring information in the generic sense.  The light transmitted from a star conveys information about the gasses in that star. However, the light is not symbolic information about the gasses in that star. Mark Frank

Dr Liddle, your comments are duly noted. Where they are not incoherent, they are trivial. Upright BiPed

Mark,

I don’t dispute that DNA could in theory be used as a semiotic system and therefore meets the operational requirements.

Information processing systems have been characterized in this thread using language that does nothing to illuminate the operation of the systems in question. And from those characterizations, statements have been made that do not reflect the actual operation of those systems. DNA is not part of a semiotic system merely in theory; it is a demonstrated empirical reality. The demonstrated fact is that the cell processes information under the same steep physical requirements as found in an ant producing a pheromone, or a bee communicating the direction of food to the other bees, or a human writing “apple” on a piece of paper – and these material conditions are singularly unique among all physical conditions. This reality makes some people uncomfortable because of the potential implications it raises on the origin of such systems. But at last checking, the political and social discomfort of human beings did not alter reality in the natural world, it only impeded the recognition of that reality. Also, re: your position that in order to know that information exists we must first know the intention of the human sending it. Obviously this is unusably anthropocentric. We know any instance of recorded information exactly the same way as any other instance of recorded information – and that is by the functional effect it has within the animate natural world. When we see ants attacking their enemies in unison, we ask the question of how the ant coordinate their attack and we naturally look to the presence of information. When we see a bat honing in on its prey in the darkness, we do not look to gravity and thermodynamics, we look to complete systems capable of offering a valid explanation, and again, we look to the presence of information. The translation of information harnesses the laws of physics to produce material effect not reducible to those laws, but reducible only to the local organic systems that transcribe and translate that information. Human intention has nothing to do with it except where humans are concerned - a mere drop in the bucket to the total volume of information transfer taking place in nature. Upright BiPed

Joe #148

Mark: DNA/RNA sequences could be used to hold information. Joe: In living organisms they are.

That is exactly the issue we are debating.

Mark: As far as I know there is no evidence that they are. Joe: Biologists and information scientists say that they are.

I am sorry. I should have used the phrase “symbolic information” throughout. The word “information” is far too ambiguous. This particular discussion is specific to symbolic information. As far as I know, biologists and information scientists do not say that nucleotide strings hold symbolic information. If they do then I would like to understand what they mean by symbolic information and how they know nucleotide strings hold it.

Mark: Similarly you cannot tell whether a nucleotide sequence holds information by examining the sequence and the cell mechanism you need to know of an intention behind it. Joe: Umm we observe the nucleotide sequence doing something and try to figure out what it is doing and why. IOW you have it backwards.

I am having difficulty understanding this. We normally observe the protein doing something, not the nucleotide. Is that what you meant? But it is a big jump from observing that to deducing or assuming an intention behind it. Again that is what we are debating. Mark Frank

DNA/RNA sequences could be used to hold information.

In living organisms they are.

As far as I know there is no evidence that they are.

Biologists and information scientists say that they are.

Similarly you cannot tell whether a nucleotide sequence holds information by examining the sequence and the cell mechanism you need to know of an intention behind it.

Umm we observe the nucleotide sequence doing something and try to figure out what it is doing and why. IOW you have it backwards. Joe

Also, the Biped is confused. "Noise" =/= "meaningless". A meaningless signal can be transmitted noisily or losslessly. But a meaningless signal will not be symbolic. Both meaningful and meaningless signals can be transferred directly and physically into some other physical form (a footprint; a protein), in which case the medium is intrinsic to the data-transfer, and we wouldn't call (or I wouldn't) call the data-transfer "semiotic". But only meaningful signals can be read symbolically; however the medium doesn't matter. Elizabeth B Liddle

UB #144

The observation that a semiotic system can process a medium containing noise changes nothing whatsoever regarding the operational requirements of the system. This is understood in all semiotic systems, including the system of genetic translation.

I am sorry I didn't realise we were discussing the operational requirements of a semiotic system. I don't dispute that DNA could in theory be used as a semiotic system and therefore meets the operational requirements. Mark Frank

ericB #143

Now please consider this. DNA / RNA sequences can hold information and are designed to do so. My point is that sometimes they do not. The sequence of bases may mean nothing. You cannot tell whether a nucleotide sequence holds information just by examining the sequence. Is this not equally as true as your statements about paper tape? And for exactly the same reasons?

I don’t think so. DNA/RNA sequences could be used to hold information. As far as I know there is no evidence that they are. There is certainly no evidence they are designed to do so. The difference being that we know it was people who made the holes in the tape and roughly why they did it.

It is never possible to tell whether a potential information bearing medium actually holds information by examining the medium. This is because the meaning (if there is meaning, i.e. if it does hold meaningful information) is not inherent in the sequence itself. It is assigned and cannot be evaluated by examining any inherent property of the sequence itself.

True and I would go further than this. You cannot tell whether a medium such as a paper tape holds information just by examining the tape and the tape reader.  You need something else – the intention behind it. Similarly you cannot tell whether a nucleotide sequence holds information by examining the sequence and the cell mechanism you need to know of an intention behind it.

(I notice that you keep avoiding dealing with the definition I’ve provided. By changing the meaning to talk about something else does nothing to eliminate the reality that I am describing.)

Sorry about that. I am confused as to what is the definition you have provided – no doubt me being careless. Can you repeat it? Mark Frank

Actually, as I pointed in #133 a paper tape, magnetic tape, punched card need not contain any information at all. The holes/magnetic marks may be totally meaningless.

The observation that a semiotic system can process a medium containing noise changes nothing whatsoever regarding the operational requirements of the system. This is understood in all semiotic systems, including the system of genetic translation. Upright BiPed

Mark Frank @142 wrote:

Punched cards can hold information and are designed to do so. My point is that sometimes they do not. The holes may mean nothing. You cannot tell whether a punched card holds information just by examining the card and the card reader.

I agree with all of these statements. They are correct. In passing, as a side clarification, my point in bringing up that series of devices was to address a bad argument by Elizabeth B Liddle that implied that DNA/RNA could not be information because it can only do its work in the context of a ribosome. However, it is obvious that every input device (e.g. all of my examples) places constraints on the medium that it can work with, even if the information on the medium could potentially be stored in other mediums. Ergo, the bare fact that a particular medium needs a particular kind of device for its information to be read does not tell us that the medium cannot hold symbolic information. As you correctly observed, the medium may (or may not) hold information. This is despite any dependency on suitable input devices. Now please consider this.

DNA / RNA sequences can hold information and are designed to do so. My point is that sometimes they do not. The sequence of bases may mean nothing. You cannot tell whether a nucleotide sequence holds information just by examining the sequence.

Is this not equally as true as your statements about paper tape? And for exactly the same reasons? It is never possible to tell whether a potential information bearing medium actually holds information by examining the medium. This is because the meaning (if there is meaning, i.e. if it does hold meaningful information) is not inherent in the sequence itself. It is assigned and cannot be evaluated by examining any inherent property of the sequence itself. This is always the characteristic nature of symbolic information. (I notice that you keep avoiding dealing with the definition I've provided. By changing the meaning to talk about something else does nothing to eliminate the reality that I am describing.) On the other hand, when we study things themselves (i.e. objects not as symbols), we are able to learn about their own properties by studying their physics and chemistry (e.g. looking at spectral lines, etc.). ericB

Andre #140

I think you are mistaken Mark Frank Punch card technology was in use in 1832 for information storage….

I must have explained myself badly. Punched cards can hold information and are designed to do so. My point is that sometimes they do not. The holes may mean nothing. You cannot tell whether a punched card holds information just by examining the card and the card reader. PS I worked for IBM most of my career and quite frequently managed to create meaningless junk on a set of punched cards :-) Mark Frank

MF:

The word message already implies that the DNA contains information.

Obvioulsy the DNA inside of organisms does contain information.

So as not to prejudge the issue I will call the DNA/CD the medium.

Your position can't explain that medium. You still lose... Joe

I think you are mistaken Mark Frank Punch card technology was in use in 1832 for information storage....

A punched card, punch card, IBM card, or Hollerith card is a piece of stiff paper that contains digital information represented by the presence or absence of holes in predefined positions.</blockqoute http://en.wikipedia.org/wiki/Punched_card

Andre

#136 UB Actually, as I pointed in #133 a paper tape, magnetic tape, punched card need not contain any information at all. The holes/magnetic marks may be totally meaningless. All that the corresponding readers do is copy those holes into electronic equivalents which may or may not be information. But that is not the main point. Please read my #138 for the main point. Mark Frank

ericB I am not arguing "A causes B therefore A is not symbolic information about B." I am sorry I clearly did not explain that well enough. It would have saved you a lot of typing! I was pointing out that there are lots of instances where "A causes B and A is not symbolic information about B." i.e. A causing B is not sufficient for A to be symbolic information about B. So there has to be something in addition to a causal relationship between A and B for A to be symbolic information about B. DNA bases cause certain amino acids to be created. But this not sufficient to say DNA is symbolic information about the amino acids. In  #134 you write.

My point is that in the case of symbolic information, the meaning of the message cannot be derived from any amount of study of the physics and chemistry of the message. The meaning is extrinsic to the message, not intrinsic to the message. It is assigned according to a convention in the form of an arranged code, not derived from the properties of the sequence itself.

I don’t I agree with this. First a bit of terminology. The word message already implies that the DNA contains information. So as not to prejudge the issue I will call the DNA/CD the medium. The cell/CD player the environment. And the protein/music the result. For any medium it is not possible to work out the result by studying the physics and chemistry of the medium alone. I cannot do it for DNA or a CD or a pattern of minerals in a rock.  You have to know the environment. But once you know the environment you can, given sufficient expertise, work out what the result would be from the physics and chemistry of the medium for all three cases. So I don’t think this can be a decisive criterion for a medium containing symbolic information. I think the crucial element that makes something symbolic information about something else cannot be deduced just by examining A and B or the environment. It depends on external information about how A is intended to be used. For example, I would say that in normal use the bits on a CD are not information about the music it creates when put in a CD player. They are just a way of playing the tune. I think we are confused because it is digital. Would you say a vinyl record is information about the music it creates? What would make it information is if the CD were used to tell somebody something about the music, as in the example I provided earlier where the CD is given to me and on it is written “I think you will like this”. This goes back to your example of someone deliberately using DNA to store a recipe for making a protein. It is the external fact of the intention to communicate that makes it symbolic information. Mark Frank

Part 2: To help Elizabeth B Liddle, Mark Frank, et al see the irrelevance of certain arguments about symbolic information, consider how Elizabeth B Liddle @111 drew special attention to the chain of chemical interactions that involved chemicals binding to one another to fulfill the operations in a cell, including the sequence from DNA to mRNA to proteins. This is another variation on the cause and effect argument in Part 1 @135 concerning the red herring of whether a system operates in terms of cause and effect. In this particular case, the cause and effect are implemented in terms of chemical processes including chemical binding. The short version of seeing that this does not exclude symbolic information processing is to consider the use of chemical nanotechnology such as DNA storage in the context of computer systems -- a realistic scenario that is being considered given the amazing storage capacity of DNA for holding symbolic information. Elizabeth B Liddle effectively acknowledged that if DNA were employed in such a system, it could in fact function as the holder of symbolic information. Yet, in such a system, everything that was said about the use of chemical binding to retrieve that information in cells could be potentially said about retrieving the stored symbolic information from DNA in a computer system. The fact that chemical binding is used to reliably retrieve and process the information in a deterministic way tells us nothing about whether or not it is symbolic information. Rather, it tells us that we are using chemistry to implement this nanotechnology information processing system. A second way to see the confusion is to consider the example of paper and ink. The chemistry involved ensures that the ink binds with the paper. However, the chemical determinacy does not determine the message. The laws governing the binding between ink and paper do not determine the message that is written there. The same is true for DNA. The laws of chemistry for the DNA structure cannot determine the message written into the DNA. If they did, it would make it impossible for different genomes to carry different messages. The same is true for the relationship between the codons in the mRNA and the amino acids that are joined into a protein. As I wrote previously @ 110:

+ We can look at the structure of the transfer RNA molecules that implement the assigned associations for a given code and observe that there is no direct chemical interaction between the codon and the amino acid. That is what allows for an arbitrary association. There is no chemical requirement.

If the codon to amino acid link were chemically required, it would not be possible for there to be different coding conventions. Yet there are different coding conventions implemented in different organisms. This is possible precisely because there is no chemical obligation for any particular association. It is an implemented convention. Notice that all reliably implemented conventions for processing symbolic information are implemented reliably. The fact that they are connected by cause and effect in a reliable manner is true for any reliably implemented symbolic information processing system. See Part 1 @135. It would be absurd to suppose that a system does not process symbolic information on the basis of observing that the system operates reliably from cause to effect. Thus, there is a recurring red herring of being distracted by issues of implementation and processing, but these are irrelevant for determining whether a system processes symbolic information. They are easily shown to be irrelevant by considering how they would be applicable to comparable man-made implementations of symbolic information processing systems. This becomes especially plain once we consider employing chemical processing nanotechnology similar to what cells already do with the symbolic information in DNA. ericB

A) CD drives require compact disks within certain physical specifications. B) Computer card readers require specifically sized cards with punched holes. C) Paper tape readers require an input stream of paper tape with punched holes. D) Magnetic tape drives require reels of magnetic tape. E) Ribosomes require messenger RNA,

Each of these translates recorded information (an arrangement of matter) into a physical effect; each of them using a necessarily arbitrary relationship instantiated in a local system. Not only are there untold thousands of competent researchers (of every stripe) who know this well, but the system was predicted to exist as it does decades ago, and also served a Nobel Laureate in elucidating the operation of genetic translation for the very first time. To transfer information into a physical effect requires an arrangement of matter to evoke the effect within a system capable of producing it, where the arrangement is physically arbitrary to the effect it evokes; as well as a second arrangement of matter to establish the otherwise non-existent relationship between the first arrangement and its effect. This irreducible core is the fundamental material requirement to accomplish what has to be accomplished. It’s a known entity, and is singularly unique within the physical world. Attempts to characterize the system in language that doesn’t reference how the system actually functions is like trying to characterize thermodynamics without reference to heat or energy. Upright BiPed

Part 1: To help Elizabeth B Liddle, Mark Frank, et al see the irrelevance of certain arguments about symbolic information, consider the following argument regarding cause and effect. A. If a system operates according to cause and effect, then it must not involve symbolic information. B. A computer system (or a cell) operates according to cause and effect. C. Therefore a computer system (or a cell) must not involve any symbolic information. The underlying assumption that operating by cause and effect excludes symbolic information is obviously false and easily reduced to absurdity as soon as we consider any system made by man that does manipulate symbolic information. Consequently, thinking merely in terms of whether a system operates by cause and effect (as all implemented systems do) would only blind one from any ability to recognize and acknowledge any system as manipulating symbolic information. *** Observing that a system operates according to cause and effect tells us nothing about whether or not it manipulates symbolic information according to a coding convention that is extrinsic to messages bearing symbolic information. *** To detect symbolic information processing, the relevant distinction to look for is the activity of translation between the message bearing symbolic information and the functional assigned meaning of that message according to a language or coding convention not inherent in the message. Since the meaning is assigned according to convention, it cannot be inferred from any inherent properties of the message itself. That is the essence of symbolic information. The cell's translation of the symbolic information in protein coding DNA and mRNA into functional proteins via a coding convention fully qualifies as symbolic information processing. ericB

Mark Frank @133 writes:

You say in the case of DNA the effect is not determined by any physical or chemical property of the message itself. Surely this is not true?

Your difficulty comes from the fact that you have not paid close enough attention to what I actually pointed out. Your description is not correct. To understand the issue, you will need to discard the mischaracterization. My point is that in the case of symbolic information, the meaning of the message cannot be derived from any amount of study of the physics and chemistry of the message. The meaning is extrinsic to the message, not intrinsic to the message. It is assigned according to a convention in the form of an arranged code, not derived from the properties of the sequence itself. This is true for protein coding DNA and mRNA in exactly the same way as for man-made codes and translations. You cannot infer the meaning from any inherent property of the message itself. (If you think otherwise, show us how it could be done.)

In the end I cannot see any reason for claiming there is a convention involved with DNA.

Why do you think we call the "genetic code" a "code"? Why do we say that the ribosome performs "translation."? These are correct and applicable terms. Remember, not all organisms use the same code. It is a convention that is not universal. That is yet another way to see that it is a convention. Other organisms prove that they can operate according to a different convention. ericB

ericB @132

What matters is not whether the convention is “external” to the system as a whole (e.g. outside the box itself). The point of symbolic information is that there is a convention guiding translation that is external to the message (i.e. not determined by any physical or chemical property of the message itself). Notice what you wrote in your own post (emphasis mine). But cases A and E (the music CD and the DNA) do not require any kind of external convention. All you need is the translating mechanism and the message. In order to translate, the translation mechanism implements the relevant convention that converts the symbolic information into its intended meaning (which is then functional). Notice that this is true for every example that I gave. That is the point. I’ve said thattranslation is the hallmark of symbolic information. That is because it is translation that implements the convention to convert between the symbolic information and its meaning.

ericB. On reflection I realise the distinction between the CD player and B, C and D is not important.  For B,C and D as described the mechanism does not “implement the relevant convention that converts the symbolic information into its intended meaning”. All a tape reader does is convert holes in a paper tape into bits in some other storage medium. Those bits may have no meaning at all. However, if you understand what the bits are intended to do then you can build a device to do it. It is just that tape readers don’t do it while music CD players do. So let’s concentrate on the example of the CD player. In both cases (DNA and CD) the medium causes an effect. This depends on the medium being in an environment (Cell or CD player) – otherwise the medium does not cause the effect. But there are masses of cases of causes leading to specific effects depending on the environment and we would not say the effect was happening by convention. I already talked about soft rock causing indentations in an eroding environment. Why do we decide the CD leads to music by convention? And does the same apply to DNA? The reason the CD leads to music by convention is rather obvious. Both CD and CD player are man-made. The CD manufacturers have to come to an agreement with the CD player manufacturers. This is the convention. But this does not apply to DNA and proteins. You say in the case of DNA the effect is not determined by any physical or chemical property of the message itself. Surely this is not true? The base pairs are chemicals and in the environment of the cell you will get a different amino acid according to which base pairs are in the DNA. Sure in a different environment you will get a different effect – but that is true of many cause/effect relationships. In the end I cannot see any reason for claiming there is a convention involved with DNA. It is just a cause leading to an effect in a specific environment. Mark Frank

Mark Frank @131, you appear to be mislead by a misconception about the "external" convention. What matters is not whether the convention is "external" to the system as a whole (e.g. outside the box itself). The point of symbolic information is that there is a convention guiding translation that is external to the message (i.e. not determined by any physical or chemical property of the message itself). Notice what you wrote in your own post (emphasis mine).

But cases A and E (the music CD and the DNA) do not require any kind of external convention. All you need is the translating mechanism and the message.

In order to translate, the translation mechanism implements the relevant convention that converts the symbolic information into its intended meaning (which is then functional). Notice that this is true for every example that I gave. That is the point. I've said that translation is the hallmark of symbolic information. That is because it is translation that implements the convention to convert between the symbolic information and its meaning. (BTW, you are still assuming the CD holds music and that it is a musical CD player, but that is not what I described. Some CDs hold images or other data. This is relevant because if you tried to "play" a non-musical CD in a musical CD player, it would not work. The medium is still binary information on a CD, but the musical CD player would be using the wrong convention to try to translate the symbolic information on the CD.) I think you may have been thrown off by focusing instead on whether the humans involved (who are external to the system of translation) need to "know" something else. However, that is unrelated and beside the point. The key is to focus on the step of translation. When you see translation by a convention, then you have symbolic information. ericB

ericB But cases A and E (the music CD and the DNA) do not require any kind of external convention. All you need is the translating mechanism and the message. Given a CD and CD player you can get the music with no additional knowledge. Given a paper tape and paper tape reader you would still not have the foggiest idea what the message was without knowing the ASCII convention (or whatever convention was used). DNA falls into the first category. Given some DNA and the translating mechanism the protein will be generated. Sure a different protein might be generated by a different mechanism - but the mechanism determines what will be generated - not some external convention. What may be confusing is that the CD player is built according to a convention. That is because it is a man-made translation mechanism. That's why I introduced the other example where a pattern of softer rocks among harder ones (the message) will be translated by erosion (the mechanism) into a pattern of indentations. Mark Frank

Mark Frank @115, sorry but somehow I originally missed that post of yours. To clarify, I'm not talking about whether DNA is "a symbol" as that phrase carries connotations that I'm not referring to. I am saying the protein coding DNA and the derived mRNA hold symbolic information. I mean something very specific by this, not just the vague idea of being "a symbol". The hallmark of all symbolic information is that it requires translation according to a language or coding convention. This is because the meaning of the message is not intrinsic. It doesn't come from the physics or chemistry of the message itself. For example, the word "sun" is not hot. The meaning is attached to the word, not a property of the word. The very same is true for the meaning of the protein coding DNA and mRNA sequences. The manner in which the information is processed is irrelevant to whether or not the sequences are assigned meaning according to an external or extrinsic convention. The reason this matters is that we have no reason to believe that blind chemicals, operating only by law and chance, would ever construct a symbolic information processing system that relies on a coding convention. We've never seen chemicals behave this way and no one can provide a rational story about how or why they would do so. Biology requires chemistry plus symbolic information. But chemicals don't care. Chemicals do not require either symbolic information or biology. Chemicals in dead configurations still completely fulfill all the laws of physics and chemistry. They do not yearn to become biological. ericB

Sorry, Eric, yes I am a bit. But Mark is articulating my points better than I could anyway. Elizabeth B Liddle

Mark Frank @122, since Elizabeth B Liddle seems too busy to defend her own position, you are quite welcome to jump in. I'll be honest and say I'm not following some of your distinctions or points. For example, for all 5 cases A, B, C, D, and E, I followed the common pattern of Device requires appropriate information bearing media. So I don't follow why you see some difference regarding A and E. Furthermore, A, B, C, and D are all man made examples of devices reading digital information media. (My own small side quibble about your post -- you assumed the content of A was music, but that is not necessarily the case. But whether holding information about music or something else, it is still digitally encoded, as is true for all the rest. For contrast, a phonograph record is analog, not digital.) E is distinct because it uses a 4 state code (A, C, G, and U in RNA) rather than the two state binary code (0 and 1) used in man-made computing equipment. Nevertheless, it is still a digital code, not an analog code. For all these cases, the digital encoding of the information requires interpretation according to a digital coding convention. No exceptions. If you don't use the correct code, it doesn't work. As I mentioned before, some organisms have a different coding convention for interpreting mRNA. If the code used by the ribosome does not match the encoding of the information in the mRNA, the translation would not work to produce the intended functional protein. Since they all require translation according to an external convention that cannot be deduced from the message itself, they are all examples of symbolic information. I realize you are not persuaded of this for some of the cases, but it is not clear to me why you are finding a distinction. I don't see what distinction you are alluding to. Now if you think you could infer the meaning of a string of nucleotides, or the meaning of a string of 0s and 1s, just by studying the properties of the message, you would be doing something that I am claiming cannot be done. How would you go about that? ericB

#62: 'In short, it’s neither scientific nor particularly useful.' In short, CLAVDIVS, you are saying that, if God exists, science cannot. Alas, IDers have known this is the position of you pathologically atheist polemicists for all too long. It's all the most primitive scientism. Science could only have been developed within an ambience of metaphysical enquiry. You dullards can't see any further than your noses. Planck and Einstein would be turning in their graves, had they not been all too familiar with the obduracy of the myrmidon mind. Axel

Let me rephrase that: Reynard will help you out. He may envy your being ‘two peas in a pod’ with Einstein in your mutual world-view – apart from the library/junk bin thinggy – which he shares with you, but not Albert. I’m sure he’d rise above such pettiness. Axel

Reynard will help you out. He may envy your being 'two peas in a pod' with Einstein in your mutual world-view - apart from the library/junk bin thinggy - , but I'm sure he'd rise above such pettiness, which he shares with you, but not Albert. Axel

Why not respond to the substance, Elizabeth, for your critics' enlightenment? Axel

Louder, Mung, louder! People might not have heard you! Try all-caps next time! “I'M RATHER ADDLE-HEADED RIGHT NOW ” – Elizabeth Liddle Maybe some screamers too? “I'M RATHER ADDLE-HEADED RIGHT NOW”!!!!!!!1!!!!!!1!!1!!! – Elizabeth Liddle Elizabeth B Liddle

ericB #121 I hope you (and Lizzie) don't mind but I think I can contribute something to this. I am sorry it is rather long.

A) CD drives require compact disks within certain physical specifications. B) Computer card readers require specifically sized cards with punched holes. C) Paper tape readers require an input stream of paper tape with punched holes. D) Magnetic tape drives require reels of magnetic tape. E) Ribosomes require messenger RNA.

I have given each example a letter for ease of reference. Note - in some cases you are saying the medium requires the mechanism (A and E) and in other cases the mechanism requires the medium (B, C, and D). This is a minor quibble. They are both required but the asymmetry might be confusing. There is an important difference between A and E and the other three. Ribosomes require mRNA to create proteins from DNA i.e. the thing you claim the DNA symbolises. This is also true of A. On the other hand, a paper tape requires a paper tape reader to create bits in storage. These bits are not the things the paper tape symbolises. This is true of B and D as well. So B,C and D all require a level of convention that is not found in A and E. There has to a convention completely unrelated to the medium and mechanism to know what the string of holes in the paper tape symbolises. You couldn’t possibly know this just by examining the paper tape and the paper tape reader. So this leaves A and E (I am assuming the CD contains audio – if it were software then it falls into the same category as B, C and D). You could examine a CD and a CD player and deduce the relationship between the marks on the CD and the sounds it produces. That is because the marks cause the sounds (given a CD player) just as the DNA causes the proteins (given mRNA etc). However, I would not say that the CD is symbolic information about the music. It just creates the music. It is no more symbolic of the music than a pattern of soft rocks among hard is symbolic of the erosion pattern it creates. You might argue that there is a difference between the CD player and the rocks. The CD and CD player were intended to produce that music. However, unless you assume there was a designer, then there is no reason to assume the DNA and mRNA were intended to produce that protein. There is another context in which the CD could be symbolic of the music which goes back to my #115. Someone might use the CD as part of a message about the music taking advantage of the known causal relationship. For example, I might scrawl on the CD – “you will love this” and give it to someone. In this case it is part of the message. You described something similar for people using DNA to describing proteins in  #113. But for this kind of symbolism to happen you need some external context over and above the medium and the mechanism.  Mark Frank

Elizabeth B Liddle, perhaps it would be more helpful for me to provide some examples. CD drives require compact disks within certain physical specifications. Computer card readers require specifically sized cards with punched holes. Paper tape readers require an input stream of paper tape with punched holes. Magnetic tape drives require reels of magnetic tape. Ribosomes require messenger RNA. The information contained on any of these types of media could in principle be encoded onto any other form of symbolic information media. At the same time, these input devices all impose physical requirements on the physical form of the media they will accept. Trying to feed them media of a different type will not work, even if the information that is required is encoded onto the foreign media. The physical requirements for the expected media never negate the fact that all of these are examples that store symbolic information that must be interpreted according to a matching, assigned code that was created as a convention. So is there any principled and unbiased reason to deny that protein coding DNA and messenger RNA hold symbolic information? ericB

"I’m rather addle-headed right now." - Elizabeth Liddle Mung

Another nail in the coffin of Elizabethan naivete: Ban Discovery Institute Mung

Elizabeth B Liddle @116, your proposed justification for why the protein coding information in DNA in a cell is not symbolic information is inconsistent, which lands it into the realm of special pleading. Everything you've said about how the information in DNA (or RNA) is used to create proteins could be said with equal force about the symbolic information of the programming in any computer or the symbolic information stored on your DVD disks that drives the behavior of your DVD player. Would you really deny that a DVD holds symbolic information just because there is a relationship governed by physics and chemistry between what it contains and the behavior of the DVD player that plays the DVD? (NOTE: Exactly as is true for the various genetic codes, this must be done by a matched and coordinated choice of coding convention. Don't try to play a Blu-Ray DVD on a non-Blu-Ray DVD player.) Would you really deny that a computer contains any symbolic information once you discover that the processing of that information deterministically obeys the laws of physics and chemistry? (Again, don't try to run code for one kind of computer on another computer with different conventions for the symbolic information.) Every physically implemented system for manipulating symbolic information obeys the laws of physics and chemistry in order to fulfill its function. You surely wouldn't suppose that a modern computer operates independent of those laws. Nevertheless, in every such system, symbolic information is symbolic because of the use of symbolic coding according to translation conventions that are not required by either physics or chemistry. So what is the justification for acknowledging symbolic information in the latter cases of in situ symbolic information processing (e.g. DVDs, computers, etc.), but not in the cell's in situ information processing? Surely it cannot be a distinction of materials (what does that matter to the concept?), and it just as surely cannot be the shared fact that all these systems operate according to the laws of physics and chemistry in order to process the data. Nor can it be the fact that a program (composed of symbolic information) deterministically works its way to its proper conclusion. Would we say a computer needs to be indeterministic to qualify as a processor of symbolic information? Clearly not. The obvious distinction of definition -- meaning that cannot be inferred by the properties of the message in the medium, but which comes according to translation through an assigned convention, i.e. a code -- applies to DNA exons and messenger RNA exactly as it does in other symbolic contexts. So far, you still have no unbiased, principled distinction that does not apply just as well to all other clear examples of symbolic information processing systems. ericB

Mark yes, but you put it much more clearly, thanks! Elizabeth B Liddle

Suppose we have begun to use DNA to hold information for our computational needs. Would you grant that in that case the DNA is a medium for holding symbolic information? Eric, just a quick response:

Suppose we have begun to use DNA to hold information for our computational needs. Would you grant that in that case the DNA is a medium for holding symbolic information?

Yes.

If yes, suppose that one of the pieces of information we store in that DNA is the recipe for a protein sequence. Would that still be symbolic information? Or would it cease to be so?

Yes, unless of course you were using it in situ in the cell. Then it wouldn't be a symbol, it would be the Thing Itself.

If it would be symbolic information when we store it in DNA, how would the same information not be symbolic information when it is in the cell for a species that needs that information in order to translate it into a protein’s amino acid sequence?

Because in the first case you are using it as a symbol! Any system of elements could do equally well, letters, a row of m&ms, whatever, because all that matters is the sequence. The sequence is the symbol, not the physical medium. But if you are using to perform the actual function, i.e. be the jig on which the mRNA is formed, then it isn't a symbol, because only DNA can do the job - not a paper with letters written on it or a row of m&ms. And the mMRN isn't a symbol either, because again it is the physical substrate that binds to the tRNA. And that's not symbolic either, because the tRNA physically binds to the amino acids. Upright Biped likes the example of a musical box, and it's a good one. My position is that the pins on the barrel of a musical box are not symbols, although they could be read symbolically by some skilled at reading them as symbols standing for notes - and they could then transcribe that information into an alternate symbolic form, such as a piece of paper with pen marks on it. They do contain information, but not symbolic information as, I would say, the word is normally used. They are the physical means by which the notes are sounded in the right order. Elizabeth B Liddle

EricB #113 No doubt Lizzie can answer this but just in case she doesn't I think I can explain. Whether something X is symbolic information about Y depends on how X is used. You cannot determine it just by looking at X and Y. You need a wider context. Two examples. As I am sure you know different gasses give rise very distinctive spectral lines. A scientist can use the spectral lines to gain information about the gasses in a distant star or planet. However, no one would say the spectral lines are symbolic information about the gasses. However, if the scientist inserts the same spectral lines into a pictorial message to another scientist (perhaps on the lines of "I found" followed by an image of the lines) then they become symbols of the gasses. Suppose I draw a picture of a man with a woman who is not his wife without understanding their relationship. His wife accidentally comes across the picture. She may gain information about the relationship but the picture is not a symbol. Suppose I come to understand the relationship and show the same picture to the wife with a significant expression. Now the picture provide symbolic information. I am using it for a purpose which relies on a commonly understood convention between us. Similarly if the protein resulting from DNA is there for natural reasons then the protein does provide information about the DNA (or vice versa depending which one you have access to) but it is not symbolic. However, if the DNA is inserted so that someone (possibly the same person at a later date) can recognise why the DNA was put there - then it is symbolic information. Generally - if A causes B then A can provide information about B (or vice versa). But A is only a symbol of B (or vice versa)if one or more more people are using A to provide information to others via a commonly understood convention that A provides information about B. I hope Lizzie agrees with this - but I dare say she will correct me if she doesn't. Mark Frank

Elizabeth:

The transcription and translation of proteins, while being arbitrary, and possibly can be regarded as a code is not, in my view a “symbolic” system in any unstrained use of the term – it is achieved by the chemical and physical properties of the the system, albeit a system that extends beyond the proximal molecules involved.

1- Your position cannot account for transcription and translation 2- There isn't any evidence for your claim "it is achieved by the chemical and physical properties of the the system, albeit a system that extends beyond the proximal molecules involved". That is like saying computer outputs are achieved via the physical properties of the computer. Joe

p.s. to Elizabeth B Liddle (@111, @112). Consider this thought experiment. Suppose we have begun to use DNA to hold information for our computational needs. Would you grant that in that case the DNA is a medium for holding symbolic information? If yes, suppose that one of the pieces of information we store in that DNA is the recipe for a protein sequence. Would that still be symbolic information? Or would it cease to be so? If it would be symbolic information when we store it in DNA, how would the same information not be symbolic information when it is in the cell for a species that needs that information in order to translate it into a protein's amino acid sequence? ericB

Elizabeth B Liddle @111 wrote:

If, on the other hand, we see a DNA sequence, known to “indicate” Protein X – what do we do?

That's just the problem, though it is not clear to me whether you are catching the difficulty. We absolutely cannot look at a DNA sequence and say that this sequence itself indicates Protein X. In one organism, it might. In another organism, it might not. There is no inherent "means Protein X" to any DNA or RNA sequence. None. The only such meanings are associations by an extrinsic convention used by that organism. They are never intrinsic to the sequence.

But unlike a Nazi symbol in a forest, the DNA code can only do its job in the physical form of a DNA molecule, within a cell, where that cell also contains certain other molecules. The Nazi symbol, however, means the same thing (and does the same nasty job) whether it is rendered in larches, spray paint, or a tattoo).

The DNA is not the active part (which for translation would be the ribosome). The "job" of protein coding DNA is to hold information, and it does this job as a medium for holding information even when it is extracted from the cell. (In fact, there is consideration of DNA as a very compact storage medium for our own digital information.) Furthermore, the information content of that DNA is just as convertible as other forms of symbolic information. The medium is not the message. In the cell, we naturally see that information content converted into a reversed and complementary representation using RNA molecules rather than DNA molecules. We can also artificially convert that information ourselves into other forms, such as into text, whether electronic or on paper. The medium is not the message. Craig Venter et al has also closed the loop by converting computerized representations of a genome back into an actual DNA genome (with his own revisions) and implanting it into a cell superstructure to form new, revised working cells. The medium is not the message.

“Digital life and actual life are getting closer and closer together,” he says. “We can digitise a genome and transmit the information down the internet to a digital-biological converter, which can turn it back into DNA in a real cell.” Many applications are fermenting in Venter’s fertile imagination. “At some time in the future, you might have a little biological box attached to your computer,” he says. “You could use it, for example, if there is a pandemic. As soon as a vaccine is available, you could download the instructions and make it yourself, avoiding the huge delays and bottlenecks in manufacturing and distribution today.” from here

Your point that the cell is implemented in terms of physics and chemistry does not eliminate the reality that it processes symbolic information, just as the fact that our computers operate according to physics and chemistry does not eliminate the reality that they likewise process symbolic information. What relevant difference is there between the case of the computer and of the cell, with regard to whether each is in fact processing symbolic information? The physics and chemistry of the medium is a red herring with regard to the question of identifying the presence of symbolic information. Every physically represented example of symbolic information in some medium has physical and chemical properties. So far, you have not provided any principled distinction that would justify treating the symbolic information encoded and processed (physically and chemically) within a cell any differently than we would for any symbolic information found anywhere else in the universe, but outside a cell. ericB

Hi, Eric, thanks for this. Yes, I misspoke - you did define it. I'm rather addle-headed right now. What I should have said was that my answer would depend on your definition, and that there are others. So, to your question:

1. Is it reasonable to infer the involvement of intelligent agency from the presence of symbolic information (e.g. the “1933? in the photo for this thread)?

As Rev Lovejoy said to Ned Flanders: Short answer: No with an if, long answer, Yes with a but. Short answer: no, if we have no way of determining whether the information is in fact symbolic information. Long answer: yes, but that's because the symbol is one used by human beings to communicate with other human beings, specifically in the country of Germany, and so the first place to look for a cause would be a German human being.

2. Why do you say, ‘I do not think that DNA is “symbolic”’? The protein recipe information in DNA and in the transcribed messenger RNA is encoded according to an extrinsic code (i.e. the genetic code of that organism). In order to derive the meaning of the information of the sequence (i.e. the specified order of amino acids for a functional protein), the sequence must be translated. Translation is the necessary hallmark of symbolic information. Furthermore, no amount of study of the physics and chemistry of the DNA could possibly reveal the meaning of the sequences. The information and code are extrinsic, not intrinsic. They are assigned via a convention, not inherent in the DNA or RNA.

I disagree with your last paragraph. In fact, not only is the information and code discoverable by the study of physics and chemistry, it was in fact discovered by the study of physics and chemistry. Now, before you jump on me - yes I know that it wasn't discovered "bottom up" from knowledge of the fundamental physical and chemical forces at work in a cell, but that doesn't make it "symbolic". Many systems are so complex that we have to use a top-down approach to figure out what is causing what - specifically, systems with complex feedback loops, such that you have to model the entire system before you predict anything with your model - by which time you probably know how the thing works anyway. It is true, of course, that the particular set of molecules involved in transcription and translation are arbitrary, in the sense that there are probably other systems that could do the job as well. But unlike a Nazi symbol in a forest, the DNA code can only do its job in the physical form of a DNA molecule, within a cell, where that cell also contains certain other molecules. The Nazi symbol, however, means the same thing (and does the same nasty job) whether it is rendered in larches, spray paint, or a tattoo). In short, if we see something that is known to be a symbol used by intelligent agents for communicating with each other, then we have good reason to think that it was created by one of those agents. If, on the other hand, we see a DNA sequence, known to "indicate" Protein X - what do we do? Consider that some intelligent agent is trying to communicate "Protein X" to some other intelligent agent? And if the second agent doesn't, for some reason, receive the signal, could the first agent communicate it in some other form, possibly by writing it down somewhere? The analogy, in my view, simply breaks down. The transcription and translation of proteins, while being arbitrary, and possibly can be regarded as a code is not, in my view a "symbolic" system in any unstrained use of the term - it is achieved by the chemical and physical properties of the the system, albeit a system that extends beyond the proximal molecules involved. In fact, to be honest, I'd say that the very fact that other systems are possible, and even found in nature, suggests that the one that most organisms use is the one that just ended up in a lineage that did rather well. But I'd expect you to differ on that :) I did once have a shot at an evolutionary algorithm that evolved its own code - or rather optimised it. I started it off with a code that had a lot of ambiguities - so instead of sequences specify a single virtual "amino acid", they were less specific, and so which one the organism ended up with was a bit of a crap-shoot. Very rapidly, organisms that mutated so as to have more highly specified codes dominated the population, as they were the ones that left reliably viable offspring, and I rapidly ended up with unique specifications. Of course every time I ran it, the code was different - it was, indeed, "arbitrary". But what was selected was specificity, not any one code, and I was surprised to see how rapidly it converged on a unique code. Ogten, as with DNA, there were redundancies at the "sender" end - more than one sequence could, and did, specify a single "amino acid", but none at the receiver end: no one sequence specified more than one "amino acid". Elizabeth B Liddle

Elizabeth B Liddle @109 wrote:

eric, I’m not quite clear what you mean by “symbolic”, but clearly symbols are used by symbol users, and symbol users are intelligent. I do not think that DNA is “symbolic”, if that is what you are getting at.

I explained what I meant by symbolic information in the first of the two posts @106:

By symbolic information, I refer to information encoded according to a extrinsic convention, such that the meaning of the information cannot possibly be derived by any amount of study of the physical / chemical properties of the message itself

I don't want to put words in your mouth that you don't agree to. There are two related but distinct questions. 1. Is it reasonable to infer the involvement of intelligent agency from the presence of symbolic information (e.g. the "1933" in the photo for this thread)? On this point I understand you to have acknowledged that the use of symbols implies "clearly" the involvement of intelligent symbol users. (Obviously, those that arranged for the symbolic information (e.g. the "1933") need not be still present.) 2. Why do you say, 'I do not think that DNA is “symbolic”'? The protein recipe information in DNA and in the transcribed messenger RNA is encoded according to an extrinsic code (i.e. the genetic code of that organism). In order to derive the meaning of the information of the sequence (i.e. the specified order of amino acids for a functional protein), the sequence must be translated. Translation is the necessary hallmark of symbolic information. Furthermore, no amount of study of the physics and chemistry of the DNA could possibly reveal the meaning of the sequences. The information and code are extrinsic, not intrinsic. They are assigned via a convention, not inherent in the DNA or RNA. We can see that it is a convention in multiple ways. + A particular amino acid or stop code can be represented by different codons (about 3 different ones on average). + There is no universal code. We've known for decades that some organisms use alternate genetic codes that follow a different convention that makes different assigned associations between codons and a stop code or an amino acid. + We can look at the structure of the transfer RNA molecules that implement the assigned associations for a given code and observe that there is no direct chemical interaction between the codon and the amino acid. That is what allows for an arbitrary association. There is no chemical requirement. + We can even look at the fact that the grouping of bases into triplets (i.e. codons) is arbitrary and not intrinsic to the DNA or the RNA. This is shown by the fact that frame shifting can revise those groupings. They are not inherent in the DNA or RNA sequence, but rather imposed by a revisable convention. (+ If one wanted even more beyond that, one could look at any of the cell's other "natural information codes ..., each operating to arbitrary conventions (not determined by law or physicality)") By any unbiased evaluation, DNA and RNA certainly do hold symbolic information where a symbolic meaning is assigned and encoded by convention, rather than being intrinsic or derivable from the message itself. If there is no source for symbolic information other than intelligent agency, how would it be unreasonable to detect the involvement of intelligent agency as the best inference from this evidence? We would do it immediately for any other instance of symbolic information (e.g. the "1933"). How is the exclusion in the case of the cell not an arbitrary exclusion? ericB

eric, I'm not quite clear what you mean by "symbolic", but clearly symbols are used by symbol users, and symbol users are intelligent. I do not think that DNA is "symbolic", if that is what you are getting at. That doesn't mean that it can't have been intelligently designed, of course, but I don't think that's a good test. Elizabeth B Liddle

Elizabeth Liddle:

What, in your quoted source, suggests that “Darwinists” think that design can’t be detected, Mung?

Elizabeth, even I am not willing to say you are stupid. So why tempt people by posting obviously stupid statements? You have, perhaps, some "Theory of Unintelligent Design" that you can refer us to? Can you think of some alternative to "Intelligent Design" other than "Not-Intelligent Design"? So when you say: “I have no idea why ID proponents have this weird idea that “Darwinists” think that design can’t be detected. Of course it can.” – Elizabeth Liddle Are you talking about Intelligent Design or Non-Intelligent Design? Which of the following fall into which category? 1. archaeology 2. forensic science 3. SETI 4. cognitive psychology Are these all in the category of "Intelligent Design"? If so, are they therefore "NOT SCIENCE!"?

What, in your quoted source, suggests that “Darwinists” think that design can’t be detected, Mung?

Did you even bother to read the article?

Now BSU’s President Jo Ann Gora has declared that ID is a “religious” idea at variance with “the consensus of science scholars” and may not be discussed in science classes, since that would be a violation of “academic integrity.”

ID = Intelligent Design "the consensus of science scholars" = Darwinists You want to offer an alternative hypothesis? Be my guest. But don't you first need to substantiate your as yet unsubstantiated assertions? Or do you just not care about defending what you write? It doesn't really matter to you whether it's true or not. Mung

Elizabeth B Liddle, is there any non-teleological theory that provides explanatory power with regard to the origin of symbolic information (cf. my post @106)? Since you consider that essential (cf. @30), what do you propose is the reasonable conclusion to draw with regard to the origin of symbolic information? Is intelligent agency a reasonable inference to draw in cases concerning the origin of symbolic information? If not, why not? ericB

Elizabeth B Liddle, do you consider the presence of symbolic information (e.g. the 1933 in the forest image) to be clear evidence indicating intelligent agency? By symbolic information, I refer to information encoded according to a extrinsic convention, such that the meaning of the information cannot possibly be derived by any amount of study of the physical / chemical properties of the message itself? ericB

What Darwinists canNOT do is produce testable hypotheses for unguided evolution. Joe

What, in your quoted source, suggests that "Darwinists" think that design can't be detected, Mung? Anything there claiming that archaeology, or forensic science, SETI, or cognitive psychology are "religious"? Elizabeth B Liddle

Exposing Dr. Liddle's self-imposed naivete once again: "I have no idea why ID proponents have this weird idea that “Darwinists” think that design can’t be detected. Of course it can." - Elizabeth Liddle Mung: How? Feel free to quote your favorite Darwinists. Please. "By the usual scientific methods – figuring out a hypothesis and testing it against data." - Elizabeth Liddle

Now BSU's President Jo Ann Gora has declared that ID is a "religious" idea at variance with "the consensus of science scholars" and may not be discussed in science classes, since that would be a violation of "academic integrity."

Ball State University President Imposes Gag Order on Scientists Supportive of Intelligent Design “By the usual scientific methods – figuring out a hypothesis and testing it against data.” - Elizabeth Liddle ri..i..i.i...ght Mung

"Of course design can be detected!" - Elizabeth Liddle Mung

No comment Elizabeth? Prefer to pretend like you never made such an absurd statement? Mung

Right... Darwinists believe design can be detected by following the scientific method. heck, there's scores of quotes to that effect in the literature and that same literature is replete with examples of design hypotheses and the data to support them. Only a fool would disagree. Right... Where's your evidence Elizabeth? I'm guessing it's the decided lack of evidence for the truth of what you claim which leads ID proponents to have the "weird idea," that Darwinists think that design can’t be detected. That and the fact that they are on record in numerous cases arguing against those who would make the case that it can be. Mung

By the usual scientific methods - figuring out a hypothesis and testing it against data. Elizabeth B Liddle

Elizabeth Liddle:

I have no idea why ID proponents have this weird idea that “Darwinists” think that design can’t be detected. Of course it can.

How? Feel free to quote your favorite Darwinists. Please. Mung

Elizabeth Liddle:

I have no idea why ID proponents have this weird idea that “Darwinists” think that design can’t be detected. Of course it can.

I laugh. gpuccio, did you see this one? Upright Biped? Mung

Clavdivs, @ 86 “As you describe it, the only thing the Explanatory Filter is doing is applying the explanation “designed by an intelligence” to one set of phenomena – i.e. those that are improbable and specified – and not to others. It is no surprise whatsoever that this explanation can be applied to some subset of phenomena, because as we all know this explanation can apply to all possible phenomena” Responding to the last sentence, yes it can be used but it isn’t because the filter doesn’t allow it. I am saying that an inference to design via the filter gives you only true positive results for design. Meaning it won’t incorrectly infer design. There may be design in some other phenomenon, but without the necessary conditions design won’t get inferred. For example, I may put a stone in the road for a purpose. That would be by design. But chance could explain that as well so design would not be inferred. If followed correctly there will be no false positives when using the filter (which it seems to me is what you are concerned with). There would be limits on what you could infer. If it doesn’t pass the filters criteria (Complex Specified Information) then design could never be inferred as per design theory. My explanation of the filter may not have been that helpful though here is a link that shows the flow of logic and it might make more sense. http://www.conservapedia.com/File:Explanfilter.jpg TJ

Clavdivs, I think you may be trying to take too hard of a line on the distinctions between philosophy science and truth. Granted, philosophy was once (and still ought to be) defined as the “love of truth.” However, part of the task of attaining truth is realizing its unified and hierarchical nature. From science, for example, we learn that the earth revolves around the sun. To know that fact is to know something about the truth and to assert it as fact is to make a truthful statement. A fact, however, is not nearly the highest level of truth that is available or attainable. The more important philosophical question is, “why is that the case?” One philosophical answer is that the Divine Creator designed the universe that way. Cosmological arguments for the existence of God point not just to the existence of the solar system but also to its ultimate (not simply scientific) explanation. Now you may not agree that this second order explanation is the truth, but surely you can discern that, if correct, the level of truth that has been attained is of a higher order. In other words, if true, it is a more important to know that God chose to create the solar system that to simply know that the solar system exists. There is, however, yet another level of truth to be attained at the theological level. If it is true that God designed the universe, the question remains, “why did He do it?” Again, there is an answer to that question. According to some philosopher/theologians, God created a universe of “soul making,” that is, a place for each person to work out his eternal destiny. I would hold that this is the right account. Again, you may not agree with this explanation, but surely you can understand that this consideration is more important and significant than the former one, which was, in turn, more important that the one previous to that. In this sense, truth comes in the form of a hierarchy such that theological truths illuminate philosophical truths, which in turn, illuminate scientific truths. The other important consideration is that fact that truth must, by definition, be unified. Philosophy, for example, cannot point to one truth while science points to another truth. Truth divided would not be truth. In that context, then, theology, philosophy, and science all point to different aspects of the same truth. If rationality has any meaning at all, then truth must be hierarchical and unified. StephenB

heh. And I note with a gleeful smile your willingness to concede that non-organic beings could be conscious :) That gives me hope that some day you might be open to a further conceptual extension - that consciousness is an emergent property of certain complex systems, regardless of their provenance, and could even be designed by an intelligent human designer :) In the mean time, glad to have found yet more common ground. I've enjoyed this conversation - thanks! Elizabeth B Liddle

Elizabeth: I would probably agree with your interpretation of your scenario, but of course I would be cautious, e.g., robots in the future will have very sophisticated programming which will be able to mimic many human responses, and voice modulation technology which will give their responses the "feel" of human emotional responses, and mere external simulation does not prove that there is true consciousness. But I concede that in practice, at some point, one might simply be convinced that one was dealing with conscious beings, not machines faking consciousness. And that point, the point at which one felt certain, might be very hard to nail down "scientifically." So I agree with you. However, I note with a gleeful smile that our normal experience has been that consciousness is associated only with *organic* beings. Your willingness to concede that this association might not be a necessary one, that it might be possible for consciousness to exist outside of association with *living* bodies, gives me hope that some day you might be open to a further conceptual extension, i.e., that consciousness might not need to be associated with bodies at all. :-) Timaeus

CLAVDIVS- Obvioulsy you don't know anything about science.

Not my logic, Joe; please try and keep up. We’re discussing the logic of the design inference “it was designed by an intelligence”, and how it can apply to any phenomena.

It is your "logic" and the design inference cannot be applied to anything.

No, Joe, the design inference does not mention murder,

It does if there is a murder. Ya see murder needs a murderer, so it is all the same.

it only gives the unqualified explanation “designed by an intelligence”.

And a murder would be such a case, duh.

Rocks? They were all designed that way – prove it isn’t so. LoL! You do NOT prove a negative! As I said you are scientifically illiterate and apparently proud of it.

The philosophical speculation of design comes first,

Except it isn't philosophical speculation. It is science based on our knowledge of cause and effect relationships. But any CLAVDIVS, thanks for proving that the current scientific paradigm isn't science at all. Nice job...

Joe

Joe @ 88 & 89 Ignoring your ad hominems and invective, that, really Joe, just reflect very badly on you indeed ...

By your “logic” all lightning is artificial because humans can make lightning.

Not my logic, Joe; please try and keep up. We're discussing the logic of the design inference "it was designed by an intelligence", and how it can apply to any phenomena. As you helpfully point out, since humans can make lightning, then the explanation "designed" can be applied to lightning, as well as to stones and leaves. See? There's no limit to the things the design inference applies to, as I've been saying all along.

So all deaths are murders then- by your stupid logic. Everything is a crime- and all rocks are artifacts.

No, Joe, the design inference does not mention murder, it only gives the unqualified explanation "designed by an intelligence". Why do people die? We were designed to do so. See how easy that is? That's all I'm saying - the explanation "it was designed" explains anything you like. Rocks? They were all designed that way - prove it isn't so.

CLAVDIVS: Regarding the artifact on Mars, of course any reasonable person would agree it was designed. However, that is a purely philosophical inference that is profoundly vague and unsatisfying. I would immediately want to know when was it made, how and by whom? Joe: So what? You figure that out AFTER you have determined it was designed. THAT is how it works with archaeology and forensics. Heck we still don’t know who dsigned Stonehenge. We don’t know how and when keeps changing.

Yes. Exactly. We agree, Joe, though you don't seem to realise it. The philosophical speculation of design comes first, followed by scientifically testable hypotheses that can give us practical information, as I have stated numerous times already on this thread. Pointing out the initial design inference is not scientific is not a criticism of it; it is just a recognition that only certain types of explanation are scientifically testable, and that the explanation "this was designed" is not one of them. CLAVDIVS

Claudius: When you say that truth is the province of philosophy, not science, you're making a statement that depends entirely on what notion of "science" one has in mind. Certainly in earlier periods of history, many if not most scientists thought they were getting at "truth." I realize, of course, that in more recent times, many scientists have backed away from such language. This backing-away, however, has grave meta-scientific consequences, including social and political consequences, which the scientists seem rarely aware of. However, that is a colossal subject of its own which has nothing to do with our current discussion. For the purposes of our current discussion, I grant that many modern scientists would agree with you that they don't produce "truth" by their investigations, but something else. But on the other hand, you appear to be agreeing with me that scientific knowledge does not exhaust all genuine knowledge. So we may not be disagreeing over anything important here. I'm perhaps a bit different from some ID supporters in that I don't place a lot of weight on the word "scientific" -- partly because the word is often used in these debates for its cultural "clout" (i.e., both sides want to claim it because science is perceived as an intellectual authority, and by many as the most reliable or even only reliable intellectual authority), and partly because my scholarly work has taken me deep into parts of the history of science and I'm aware of how the meaning of the term has changed in the past and may change in the future. If we take "science" in the narrowed sense that many modern people use it (and which is the sense generally employed by the anti-ID crowd), then I'm not sure I want to demand that the world certify ID inferences as "scientific" inferences. On the other hand, ID inferences (whether valid or not) clearly try to base themselves on the current results of science (molecular biology, information theory, etc.), so even if they are "philosophical" inferences, they are philosophical inferences drawn from scientifically generated knowledge, not from, say, the stories in Genesis. So modern ID certainly has some connection with scientific knowledge. Of course, I hope you can tell that these remarks are not trying to make a case for the conclusions of any particular ID argument (Behe's, Dembski's, etc.), but are merely aimed at further clarifying the subject you are raising, i.e., "What sort of investigation is ID, and what sort of knowledge can it potentially generate"? I do not have time now to take up your argument about finite versus infinite designers (as I summarized it above, with your approval). I think I can give you a reasonable answer, but I am tied up with practical business, and the answer has to be thought out well and carefully worded. So you will have to be patient. Timaeus

CLAVDIVS:

Regarding the artifact on Mars, of course any reasonable person would agree it was designed. However, that is a purely philosophical inference that is profoundly vague and unsatisfying.

Perhaps to you it would be unsatisfying. But to investigators it would be huge

I would immediately want to know when was it made, how and by whom?

So what? You figure that out AFTER you have determined it was designed. THAT is how it works with archaeology and forensics. Heck we still don't know who dsigned Stonehenge. We don't know how and when keeps changing.

How like us are they? To answer these interesting, practical questions we need scientifically testable hypotheses.

Those questions come after design is determined. As I said you anti-IDists don't seem to undersatnd how science operates.

And, a discussed at length, “this was designed” is not such a testable hypothesis, however true it may be.

Yes, it is testable and archaeology and forensics prove that it is testable. Joe

CLAVDIVS:

Yes, thanks Joe, as expected the feebleness of your response simply proves my point.

The only feebleness is your mind.

You’re claiming, contra all experience and common sense, that intelligent designers could not possibly arrange stones, dust, leaves or snow into natural-looking patterns.

Nope, you just don't understand how science operates. By your "logic" all lightning is artificial because humans can make lightning.

Therefore my point stands that the bare inference “this was designed” cannot be scientifically tested because it cannot possibly be disproven.

So all deaths are murders then- by your stupid logic. Everything is a crime- and all rocks are artifacts. OR CLAVDIVS is just ignorant. Joe

Timaeus @ 84 I broadly agree with your post @ 84, and I concur with Ms Liddle that it is pleasing to have reached such a point in the discussion. It is admirable that you seek truth. However I believe it is crucial to recognise that truth is the province of philosophy, not science, and there are important differences between these two disciplines. There are many ideas in this world that may be true, but cannot be scientifically tested, and it is not necessarily a criticism to point this out. Regarding the artifact on Mars, of course any reasonable person would agree it was designed. However, that is a purely philosophical inference that is profoundly vague and unsatisfying. I would immediately want to know when was it made, how and by whom? How like us are they? To answer these interesting, practical questions we need scientifically testable hypotheses. And, a discussed at length, "this was designed" is not such a testable hypothesis, however true it may be.

As for your more systematic statement, if I understand it correctly, you are saying that, in principle, God could have designed everything — particular rock formations, particular thunderstorms, particular atoms and molecules, etc. In such a scenario, there would be nothing in the universe that was *not* designed. In that case, design inferences, insofar as they are based on a distinction between what is designed and what is not, would become useless. In contrast, if we are talking about limited designers such as human beings, we can discuss whether a rock formation is natural (e.g. a stalactite) or artificial (e.g., a Hindu temple carved out of cave rock) in origin, because we have an idea of the capacities of human beings versus the capacities of natural forces and objects. So design inferences can be useful only in the case of limited designers. Is that what you are arguing?

Yes, you pretty much nailed it. I would add that it's not necessary, I think, to bring God into it, which may generate more heat than light in this context. The "designed by an intelligence" explanation is so vague on its face that it's clear it cannot be scientifically tested. My hope is that ID proponents will give serious consideration to the problem with the scientific testability of the bare inference "it was designed". Cheers CLAVDIVS

TJ As you describe it, the only thing the Explanatory Filter is doing is applying the explanation "designed by an intelligence" to one set of phenomena - i.e. those that are improbable and specified - and not to others. It is no surprise whatsoever that this explanation can be applied to some subset of phenomena, because as we all know this explanation can apply to all possible phenomena. What is more, it is as plain as the nose on your face that the phenomena that are supposedly filtered out by the Explanatory Filter could be perfectly well explained by "design" should one choose to do so. Common experience and common sense tells us intelligent agents can mimic natural regularities and can design things that are both highly improbable and unspecified. In my view, the problem that ID has with scientific testability is inherent in the concept "designed by an intelligence", because it is so unbounded and unqualified that it has an unlimited range of applicability. Just because someone may choose, in a particular case, to apply that explanation to some phenomena, and refrain from applying it to others, does not change the fact that the explanation "designed by an intelligence" is inherently capable of explaining any and all phenomena, and is thus inherently not a scientifically testable idea. The Explanatory Filter has exactly this same problem with scientific testability, because the explanation that pops out at the end of the procedure is also exactly the same: an unqualified "designed by an intelligence". In order to solve this problem, this explanation would have to be qualified in some relevant way so it does not automatically apply to all possible phenomena. For example, "designed and built by humans between 2600 and 2500 BC" is an explanation that's qualified enough that it's capable of being scientifically tested. So I really do not think that the Explanatory Filter somehow makes the "design" explanation scientifically testable, because its untestability derives from the unlimited range of applicability inherent in the explanation itself, not in the procedure followed to arrive at that explanation. Cheers CLAVDIVS

Timaeus: FWIW, I enjoyed your post at 84. I agree largely with the first half, and if the second is not CLAVDIVS's argument, it would be mine :) To extend the argument slightly: If I found inorganic, but apparently sentient, sensible, intelligent, productive, reactive, communicative entities on Mars I would infer that they were conscious. I don't have a scientific test for that (or not one that most people would regard as such). I just think it would be a reasonable inference. Would you agree? Elizabeth B Liddle

Claudius (80): I'm much less concerned with whether or not something is "scientifically testable" than with whether or not it is true. In the case of the machine on Mars, if I said to the Dawkins-clone in the story: "This is designed," and he replied to me, "That is not a scientifically testable conclusion," I'd shrug and say, "So what?" Or I'd ask him if he personally agreed with me that the object was designed, and if he said "Yes," I'd ask him: "If you agree with me regarding the conclusion, then why do you care in the slightest whether or not it is a 'scientifically testable' conclusion?" Either the difference between a "reasonable conclusion" and a "scientifically testable conclusion" has practical significance, or it doesn't. In the case of the machine on Mars, I'd say it has no practical significance, because the two people are agreeing on what is in fact the case. Neither one of them has the slightest *sincere* doubt -- doubt that would affect their lives, as opposed to purely "academic" doubt -- that the thing is designed. Perhaps in other cases, the distinction you are making might have some practical significance. Perhaps you could provide me with a few simple examples, so I can see better why you think "scientifically testable" is so important. As for your more systematic statement, if I understand it correctly, you are saying that, in principle, God could have designed everything -- particular rock formations, particular thunderstorms, particular atoms and molecules, etc. In such a scenario, there would be nothing in the universe that was *not* designed. In that case, design inferences, insofar as they are based on a distinction between what is designed and what is not, would become useless. In contrast, if we are talking about limited designers such as human beings, we can discuss whether a rock formation is natural (e.g. a stalactite) or artificial (e.g., a Hindu temple carved out of cave rock) in origin, because we have an idea of the capacities of human beings versus the capacities of natural forces and objects. So design inferences can be useful only in the case of limited designers. Is that what you are arguing? Timaeus

Clavdivs, "Why? Because the explanation “designed by an intelligent agent”, without any qualification, can be applied to absolutely any observation, measurement or phenomenon without the possibility of being disproved." No it can't when you use the filter, which is what ID theory advocates. TJ

Clavdivs @81 The limits on explanatory power that you are looking for are I think built into the explanatory filter. This is a dumbed down version 1. Can it be attributed to regularity? 2. Is it highly improbable? 3. Is it highly improbable and specified? Unless it cannot be the other two options design doesn't get invoked. It seems your worries about always inferring design are unwarranted, because design would never be attributed to something that could be explained by either chance or regularity. TJ

StephenB @ 79 Yes, that's not an unreasonable point and was already mentioned by Timaeus @ 63. However, I dealt with it @ 68 by showing it doesn't actually affect my argument. Cheers CLAVDIVS

Timaeus @ 78 What I have been talking about all along is the scientific testability of the explanation "designed by an intelligent agent". As I have already acknowledged @ 68, on observing a complex machine on Mars or a pyramid, it would be perfectly reasonable to infer that an intelligent agent was somehow involved in the design of that object. However, that inference would be a philosophical or metaphysical speculation, not a scientifically testable explanation. Why? Because the explanation "designed by an intelligent agent", without any qualification, can be applied to absolutely any observation, measurement or phenomenon without the possibility of being disproved. Therefore, that explanation cannot be scientifically tested, which puts it in the realm of philosophy or metaphysics, not in the realm of science. If you disagree, you should give me an example of an observation, measurement or phenomenon that cannot possibly be explained by saying it was designed by an intelligent agent. Cheers CLAVDIVS

Clavdivs

If ID does not propose any limits to the designer, then it logically follows that ID’s concept of the designer is unlimited.

As it turns out, your "then" does not follow from your "if." If ID does not propose any limits to the designer, then it follows that ID does not rule out an unlimited designer. That is a long way from saying that the designer is unlimited. StephenB

Claudius (68): It seems to me that you are making a simple thing difficult. Suppose you woke up tomorrow and found yourself on Mars. As far as you know, no human beings have ever travelled to Mars. So you expect to find nothing but sand, red rocks, possibly some frozen water or carbon dioxide at the poles, etc. -- unless you accidentally stumble across one of the Mars probes. You wander around a bit, and eventually, you come across what looks to you like a gadget. It has wheels, and gears, and in general parts that seem very precisely shaped and very well meshed with other parts, and one part seems to make another part move in a predetermined way, etc. You aren't sure at first what this gadget is supposed to do -- it isn't one of the Mars probes, and it is like nothing you have ever seen or heard about on the earth -- but it sure looks to you like something that someone designed. Now, a follower of Richard Dawkins, sporting a "There's Probably No God" button, who also has mysteriously found himself on Mars, comes up to you and asks you whether or not you think the gadget in front of you was *really* designed, or only has the *appearance* of design, i.e., is only the product of chance collisions and transformations of Martian matter and blind forces of Martian nature that just happened, by a rare freak of Martian conditions, to produce a metal assembly with well-coordinated parts. Would you say, "It's designed, of course, you idiot!"? Or would you say: "I cannot answer that question unless you tell me what sort of designer you have in mind"? Timaeus

Clavdivs You say, 1. Ok, Joe – Give us an example of a phenomenon, observation or measurement that we *cannot* explain by saying “an intelligent agent designed it that way”. If you cannot provide one, this proves my point that the design inference is not a scientifically testable explanation because it cannot possibly be disproven. It can’t be disproven as you are formulating it. But ID theory does not advocate inferring design in cases where chance or necessity is warranted. As I said earlier it is set infer design only when the other options have failed. Meaning you would only get design as a result when that had to be the answer. Now a designer could design something and design it so that it didn’t look designed. The explanatory filter wouldn’t give you design in that case. TJ

Clavdivs @ 68 I will respond to this, “The reason ID is not scientifically testable is precisely because “ID people have not defined the bounds of the term ‘designer’”. An explanation for which no bounds have been defined has unlimited explanatory potential.” The design inference uses physical law as the first explanation, then it goes to chance. If those other two options are not viable then design is inferred. The limits are built into the explanatory filter, because design is inferred until chance and necessity are eliminated. The filter was built to allow false negatives, but not false positives. TJ

Clavdivs @69 What I said was not intended as anything other than being what I thought was a mildly amusing way of saying that he said what my response would have been. I could have respond directly to you, but he made the same points I was going to so I actually just cut down on the reading and responding for you. If you want it in my words I could that though. TJ

Joe @ 73

CLAVDIVS: Give us an example of a phenomenon, observation or measurement that we *cannot* explain by saying “an intelligent agent designed it that way”. If you cannot provide one, this proves my point that the design inference is not a scientifically testable explanation because it cannot possibly be disproven. Joe: Anything that nature, operating freely can produce. That is how it works in archaeology and forensics. That would be the pattern of stones in my driveway. The leaf pattern at the bottom of my pool that I haven’t yet cleaned. The dust bunnies under my chest of draws. Snow drifts after a snowstorm.

Yes, thanks Joe, as expected the feebleness of your response simply proves my point. You're claiming, contra all experience and common sense, that intelligent designers could not possibly arrange stones, dust, leaves or snow into natural-looking patterns. Obviously this is utterly incorrect, as the designers of movie sets can attest. Therefore my point stands that the bare inference "this was designed" cannot be scientifically tested because it cannot possibly be disproven. CLAVDIVS

CLAVDIVS:

Give us an example of a phenomenon, observation or measurement that we *cannot* explain by saying “an intelligent agent designed it that way”.

Anything that nature, operating freely can produce. That is how it works in archaeology and forensics. That would be the pattern of stones in my driveway. The leaf pattern at the bottom of my pool that I haven't yet cleaned. The dust bunnies under my chest of draws. Snow drifts after a snowstorm. The explanatory filter tells you how to test ID, CLAVDIVS. It also tells you how to falsify any given design inference. And guess what? It is the same for archaeology and forensics... Joe

Joe @ 71 Ok, Joe - Give us an example of a phenomenon, observation or measurement that we *cannot* explain by saying "an intelligent agent designed it that way". If you cannot provide one, this proves my point that the design inference is not a scientifically testable explanation because it cannot possibly be disproven. CLAVDIVS

CLAVDIVS:

The reason ID is not scientifically testable is precisely because “ID people have not defined the bounds of the term ‘designer’”.

And yet we have said how to test it. BTW ID still is NOT about the designer. And BTW is NS is also scientifically untestable then ID would be on the SAME level as the current paradigm and as such needs to be in science classrooms. Or evolutionism needs to be removed. So to recap- IDists have said EXACTLY how to test and possibly refute ID, and all CLAVDIVS can do is whine and say "No, it can't be tested". Pathetic. Joe

CLAVDIVS:

And the idea the pyramids were built by ancient Egyptians can be scientifically tested, because those proposed designers have limitations.

They are all dead. They cannot build anything. It cannot be tested.

To satisfy your curiosity I do believe Darwin’s ideas of descent with modification and natural selection are scientifically testable.

And they have failed at being a designer mimic. Joe

TJ @ 64 That's really classy, TJ. CLAVDIVS

Timaeus @ 63 We can just stop referring to a "being of unlimited power" if you feel that's misleading. It was just my rhetorical device to illustrate the problem ID has with scientific testability, and it's not necessary to my point. The reason ID is not scientifically testable is precisely because "ID people have not defined the bounds of the term 'designer'". An explanation for which no bounds have been defined has unlimited explanatory potential. This is simply a logical consequence of having no defined bounds, which means no limitations on the explananda that the explanation can apply to. No matter what the phenomenon, measurement or observation, one can always say "Yup, follows from the explanation." And as discussed previously, an explanation from which all possible phenomena follow is not scientifically testable.

If your premise is that explanations that are compatible with almost any outcome are useless scientifically, because they can’t ever be decisively verified or falsified, then you should be just as concerned about “natural selection” as an explanation — or else you are imposing a double standard, whereby ID is expected to give much narrower and more precise predictions than “natural selection” theory can give.

On this thread we've been talking about the Nazi tree patterns and the design inference and its scientific testability. Let's grant to you, just for the sake of making this point, that natural selection is completely untestable and that I am imposing a double-standard. Now does this in any way affect my argument about how ID is not scientifically testable? No it does not. If ID is not scientifically testable because it has no defined bounds, then it's not, regardless of the existence of other untestable theories or, indeed, the existence of people with double-standards. This is why I'm really not interested in discussing Darwinian evolution in this context, because it's irrelevant to my argument.

I don’t see why you say that the proposal that a mind was required to build the Pyramids is “not testable.” ... I therefore think that the conclusion of design in the case of the Pyramids would be both testable and scientific — though what you mean by "scientific" you have not said.

I explained @ 15 what I mean by scientific testing:

The sorts of explanation that can be scientifically tested involve a general rule, and a logical argument showing how phenomena follow from that rule e.g. Jupiter’s orbit follows from Newton’s law of gravitation. Checking whether phenomena follow the rule or not is what is meant by scientific testing. If a rule is so general that all possible phenomena follow from it, then the rule can’t be tested and it doesn’t explain anything.

The concept that the pyramids were designed by an intelligent agent is a perfectly sensible metaphysical speculation. However, it is not a scientifically testable explanation because *absolutely anything* could be claimed to be "designed by an intelligent agent", and no measurement or observation could possibly disprove that claim because the explanans "intelligent agent" has no defined bounds. Finally, to answer your questions:

1. What textual evidence do you have from ID theorists that ID postulates an unlimited designer? (Passages and page numbers, please.) 2. Why is the design inference not testable? (It seems to be obviously testable in many cases.) 3. Given that the design inference is at least sometimes testable, why is it not in those cases a scientific inference? 4. Do you recognize that Darwinian explanation of evolutionary outcomes contains a great deal of elasticity which enables evolutionary theorists, after the fact, to justify a wide variety of evolutionary outcomes from similar initial situations? Do you recognize that this makes it very difficult in principle to ever falsify a good number of “explanations” offered by evolutionary theorists? Do you recognize that this is the same sort of “defect” that you have charged ID theory with, i.e., of being compatible with too many outcomes and therefore theoretically useless?

1. None - see 1st and 2nd paragraphs above. 2. The bare "design inference" without any defined bounds is not scientifically testable because the claim "it was designed" could be applied to absolutely any phenomenon, and no observation could possibly disprove it. To be scientifically testable, an explanation must be capable of being checked to see if it's true or not. 3. The bare "design inference" without any defined bounds is not scientifically testable. 4. Darwin's theory of descent with modification and natural selection, as he outlined in Origin of Species, is capable of being scientifically tested because it is consistent with some phenomena (e.g. fossils), inconsistent with other (possible) phenomena (e.g. hippogriffs) and has a limited scope of applicability (e.g. doesn't apply to the evolution of neutron stars). I can't comment on the testability of "a good many explanations by evolutionary theorists" unless you tell me which ones you have in mind. Cheers CLAVDIVS

Test (having trouble posting...) CLAVDIVS

And I would agree, Timaeus, that attempting to "reverse engineer" any trait back to a selectable first appearance can rarely be anything other than speculation. I don't think this is how the theory of natural selection is, in practice, tested, and so I don't think natural selection should be dismissed as a theory because this testing method is inadequate (useless, in fact). I think you agree that there are other methods, which I would argue are those by which it is, in practice, tested. Elizabeth B Liddle

Timaeus:

So I repeat: when you read one evolutionary theorist affirming with great certainty that natural selection explains the development of selfish individualism (the critter is trying to preserve its own genes, and doesn’t give a hoot about anyone else’s) and another evolutionary theorist affirming with great certainty that natural selection explains the development of altruism (the critter is trying to preserve the genes of critters closely related to it, so it will sacrifice its own life and its own genetic line for the good of the tribe, through which at least part of its genetic makeup can survive), you should be suspicious about a theory of “natural selection” that is so elastic that it can explain two such different results.

Could you provide citations for these? They sound like evolutionary psychology to me, which is, I agree, largely codswallop. But the theory of "natural selection" is not the same as evolutionary psychology, as I'm sure you would agree. Evolutionary psychology is simply an attempt to use natural selection to explain psychological traits. The problem there, I'd say, is not with the theory of natural selection, but with its (totally inappropriate) application to psychology. And the first thing: "that natural selection explains the development of selfish individualism (the critter is trying to preserve its own genes, and doesn’t give a hoot about anyone else’s)" isn't even evolutionary psychology! It's just wrong more ways than Sunday! That's why I'd be interested to know where you read it. Elizabeth B Liddle

Clavdivs I would reply to what you said, but after reading the above post I'll refer you there and only add "har har" TJ

Claudius: I thank you for your reply. However, it seems to me that you haven't dealt very directly with most of what I said, which is disappointing to me. I tried to make clear -- and I'm not sure how I could have been clearer -- that ID is not about, and has never claimed to be about, detecting an "unlimited designer." I don't know where you got the idea that ID pretends to be able to demonstrate such an entity. Certainly not from any writing of Behe, Dembski, Meyer, Nelson, etc. that I have read. Yet your rejoinder here returns to unlimited designers. As far as I can tell, your insistence on tying ID to unlimited designers is based on the following inference: "If ID does not propose any limits to the designer, then it logically follows that ID’s concept of the designer is unlimited." This sentence plays with the ambiguity of "does not propose any limits" and "unlimited." "Does not propose any limits" could mean merely "it is not ID's concern what are the limits of the designer, and therefore it does not talk about them." This would be parallel to "it is not ID's concern whether the designer is male or female, so it does not talk about the designer's sex." Similarly, an "unlimited concept of the designer" could mean "the designer is infinite in size, mass, power, range of operation, etc." or it could mean simply "ID people have not defined the bounds of the terms "designer," i.e., no one bothered to specify any limits because the question of limits was deemed unimportant for the purpose of detecting design. So your inference trades on ambiguities, and especially on the ambiguity of "unlimited." So you can correctly say that ID has an "unlimited conception of the designer," in the technical sense of "ID theory does not specify the character of the designer"; but *the average English reader or listener* will hear or read that as "ID theorists conceive the designer to be unlimited" -- i.e., that ID affirms the designer to be a being of unlimited power, i.e., God. But this in no way follows from ID theory. The designer of life on earth, for example, supposing that there was such a designer, could have been an alien biochemist -- a being who certainly is not "unlimited" in size, power, etc. And of course no one supposes that the designers of Stonehenge were "unlimited" in power, wisdom, etc. I hope this sufficiently explains why your inference is potentially seriously misleading. I would ask you to go through the ID literature and tell me where you find statements from the ID theorists that the designer detected in design must be an "unlimited" one, an "infinite" one, an "all-powerful" one, etc. If you cannot find such statements, I think you should withdraw your claim that ID demands this. And if you withdraw your claim, the premise on which your original argument rests vanishes, and the problem dissolves. On the other main point: it was legitimate of me raise the testability of the action of "natural selection," because you were treating the alleged non-testability of ID inferences as proof of ID's "unscientific" character. If your premise is that explanations that are compatible with almost any outcome are useless scientifically, because they can't ever be decisively verified or falsified, then you should be just as concerned about "natural selection" as an explanation -- or else you are imposing a double standard, whereby ID is expected to give much narrower and more precise predictions than "natural selection" theory can give. So I repeat: when you read one evolutionary theorist affirming with great certainty that natural selection explains the development of selfish individualism (the critter is trying to preserve its own genes, and doesn't give a hoot about anyone else's) and another evolutionary theorist affirming with great certainty that natural selection explains the development of altruism (the critter is trying to preserve the genes of critters closely related to it, so it will sacrifice its own life and its own genetic line for the good of the tribe, through which at least part of its genetic makeup can survive), you should be suspicious about a theory of "natural selection" that is so elastic that it can explain two such different results. You should at least *consider* the possibility that "natural selection" is a flawed principle; or, more cautiously, you should question its applications to the question of the origin of altruism; or, you could decide that evolutionary theorist A is simply wrong and evolutionary theorist B is simply right. But you should be *thinking* about the problem raised by an apparent contradiction such as the one I've given. You should be asking whether the apparent contradiction weakens the idea of "natural selection" or whether the concept can still be rescued by suitable distinctions. Of course, the example of animal altruism is only one of scores that could be given, where "natural selection" can be called in to explain a whole variety of outcomes, and it is almost impossible to specify an outcome which would definitely establish that "natural selection" was *not* operating. Let me say that I think that many of the proposals of Darwinian theory are testable. I was merely pointing out that if someone says that a particular creature developed the properties it has due to "natural selection," one can easily point out very similar environmental circumstances in some other country, where "natural selection" led to no such result (there are plenty of countries with tall trees and droughts, for example, but only Africa has giraffes); and one can point to very different environmental circumstances where very similar results were obtained, which would mean that natural selection cannot by itself be the explanation. (At this point, we interrupt this program for a commercial break: Elizabeth, if you are reading and just itching to jump in to give me a long lecture on how Darwinian theory does not simplistically rely on natural selection alone, but on the interplay of factors, of which natural selection is only one, variation another, etc., you can save your effort. I know that. But it doesn't affect the overall structure of my argument. (Let's say that someone says: "It's unreasonable to expect giraffes in South America, because while the environment may have been conducive there, the necessary variations may not have occurred there." I grant this entirely. I grant that "natural selection must be false because there are no giraffes in South America" would be an unwarranted inference. But the point is that, since there is a vast number of paths variation might have taken (and Elizabeth knows well how vast, from her mathematical training), and since natural selection itself is a quite elastic principle, able to provide *plausible* explanations for a wide variety of outcomes, when you combine selection with variation and any other factors you want to bring in, you can explain almost *any* outcome, after the fact, as compatible with "heritable variation plus natural selection." (Thus, if someone says: "Why didn't X evolve in North America here, where the plains are very similar environmentally to the plains in the Ukraine?" you can argue that the genetic material was different in the two places; and if you say, "Why didn't this critter evolve in Europe where there were proto-critters in both Europe and North America with very similar genetic stuff," you can argue for some subtle difference in the European environment which worked against that kind of evolutionary change. Because evolutionary theorists are always explaining *after the fact*, they can always suppose that the balance of factors -- variation, selection, whatever else -- was such that the outcome we observe was precisely the outcome required by that particular balance of factors. But if placed back in the time period involved, and given a whole lab full of equipment to sequence genomes, measure all environmental factors, etc., six evolutionary theorists would give you seven different answers regarding what they would expect to evolve. The marvelous insight of evolutionary biologists into the effect of the various factors seems available only *after* nature has made its decision; before that, the evolutionary theorist hardly knows how to begin to weight all the factors -- or even, truth be told, what all the factors are. (So we have natural selection, itself very elastic as an explanatory concept, mixed in with unpredictable genetic variation which makes projections of the path of evolution quite uncertain, and we have a recipe for "just so stories" (why the giraffe is found only in Africa, how the coelacanth managed to survive, why there is similarity between marsupial and placental "wolves," why many large mammals died out but elephants survived, etc.), stories which any skilled evolutionary biologist can invent from an armchair, which are almost always superficially plausible, but almost never falsifiable.) End of commercial break; back to main comments: I don't see why you say that the proposal that a mind was required to build the Pyramids is "not testable." It seems to me that it is eminently testable. We have millions of square miles of sandy desert around the world, with sand swirling in all kinds of combinations, for thousands and thousands of years. We have never observed the sand coalesce into stone blocks with neat edges, and we have never observed such blocks, or even sand itself in loose form, arrange itself in a mathematical form as precise that that of the Pyramids. We can easily build huge laboratories the size of aircraft hangars, and play around with factors of all kinds -- different substances, e.g., plastics, molten glass, wood -- different wind velocities and temperatures, and see if *any* combination of substances and environmental conditions *ever* produces *anything like* the Pyramids. And I think that both the historical observation of mankind and our experiments would point to the same conclusion: all such structures are designed, not the product of natural laws and chance alone. I therefore think that the conclusion of design in the case of the Pyramids would be both testable and scientific -- though what you mean by "scientific" you have not said. So, in summary: 1. What textual evidence do you have from ID theorists that ID postulates an unlimited designer? (Passages and page numbers, please.) 2. Why is the design inference not testable? (It seems to be obviously testable in many cases.) 3. Given that the design inference is at least sometimes testable, why is it not in those cases a scientific inference? 4. Do you recognize that Darwinian explanation of evolutionary outcomes contains a great deal of elasticity which enables evolutionary theorists, after the fact, to justify a wide variety of evolutionary outcomes from similar initial situations? Do you recognize that this makes it very difficult in principle to ever falsify a good number of "explanations" offered by evolutionary theorists? Do you recognize that this is the same sort of "defect" that you have charged ID theory with, i.e., of being compatible with too many outcomes and therefore theoretically useless? Timaeus

TJ @ 58

Anthropologists infer design in certain cases period. ID infers design in certain cases period. They both infer design.

And when either ID or anthropologists infer "design period", without in any way limiting the proposed designer, then they are both engaging in a metaphysical or philosophical speculation, and they are not proposing a scientifically testable concept. That has been my point all along. There's nothing wrong with metaphysical speculation, but it's not the same thing as a scientifically testable explanation. However, since anthropologists typically go on to propose specific designers (humans) that acted on their environment at specific times and places in specific ways that are scientifically testable, this makes those anthropological explanations scientific.

Am I too understand what you are saying to mean that if I was to propose aliens as the agent of design who only exist at particular times and places, and have particular abilities, tools and technologies that strictly limit their ability to manipulate their environment that would be an acceptable hypothesis?

That would depend on the nature of the limitations on your proposed aliens. If you said the aliens acted sometime in the last 100 billion years, but were otherwise all-powerful, then clearly that's still not a scientifically testable explanation, even though you have limited the timescale. What you would need to do is actually propose a specific explanation and what tests you would run to check it.

Because ID includes that kind of hypothesis which would meet all your criteria. That’s not my version of ID but it is ID.

Well, what are the details of this ID hypothesis where the designing agent is limited in specific ways, such that the hypothesis can be scientifically tested?

CLAVDIVS: What matters is that logically the concept of the designer itself, as you acknowledge, is capable of explaining anything, and thus it cannot be scientifically tested. It may be a true concept, but it’s not very useful and not scientific. TJ: It can be scientifically tested. Predictions have been made and confirmed. While the specific abilities of a designer may not be known they may inferred from the design. It may be a true concept but not helpful? True concepts are always helpful in making predictions and understanding the world. How could it be true but not useful? Even if the truth was that everything is ultimately unpredictable (cause the designer is crazy and sporadic) at least we would be able to predict lack of certainty.

It is no surprise predictions have been made from the ID concept of an unlimited, all-powerful designer, because such a designer can explain *anything*. Triangular planetary orbits? Yep, the all-powerful designer wanted it that way. See how that works? What I meant was this is not practically useful because it cannot tell us why we observe X instead of Y, Z or Q. An unlimited explanation explains X, Y, Z and Q all equally well - and equally badly. As you say, an unlimited explanation is "ultimately unpredictable", and hence of no practical use. That said, it may be metaphysically satisfying to infer the truth that an unlimited designing intelligence is responsible for the universe and life. But that does not change the fact that the concept is practically useless.

If there is a rock in my yard I could explain it through a random process (a car drove over a rock and the rock was subsequently thrown into my yard). Or I could explain it through an agent (the neighbor kid put a rock there while he was playing and that rock was supposed to represent the bad guy’s hideout). If however, there are a bunch of rocks arraigned that spell “Johnny” I rule out random processes. This story illustrates how lots of things can be explained by design, but we infer it and only it in cases of functional specified complexity (just like an anthropologist)

And so long as you leave your inference at the level of "it is explained by design" it will remain a metaphysical or philosophical speculation, unable to be tested scientifically and of no practical utility. There's nothing wrong with that. But it's not science. CLAVDIVS

Cladvdivs An unlimited designer being unscientific honestly doesn't make sense it's an arbitrary restriction. If it is possible that an unlimited designer could have done something, science should be able to consider the possibility. Otherwise we restrict science so that it might not be able to discover what is true. TJ

Timaeus @ 38

CLAVDIVS: So do you acknowledge that the ID concept of an unlimited designer cannot be scientifically tested? Timaeus: I know of no ID concept of an unlimited designer. I know of Christian, Jewish, and Muslim conceptions of an unlimited designer. But ID is not any of those religions. ID is about designers, period. No specification of “unlimited” is essential to the theory of design detection. The idea is that we can detect design, not whether or not the designer is unlimited.

If ID does not propose any limits to the designer, then it logically follows that ID's concept of the designer is unlimited. You may well claim one can detect design whether or not the designer is unlimited. My point is that that is not an idea that can be scientifically tested, because an explanation that has no limits can be used to explain any measurement or observation whatsoever. As such, ID as currently described on this site is not very useful and it's not scientific, because we can't test it.

Timaeus: So the stones of the Pyramids could have been arranged by an unlimited designer (God) or by limited designers (ancient Egyptians).

And the idea the pyramids were built by ancient Egyptians can be scientifically tested, because those proposed designers have limitations. If that idea failed testing (it hasn't, but just for example) then that would not somehow make the idea of an unlimited pyramid designer testable. An unlimited designer is always untestable in principle. Inferring that "a mind was involved" may well be a valid metaphysical or philosophical position. However, that position remains untestable and unscientific so long as the proposed designer is potentially an all-powerful agent.

Timaeus: Now let me ask you a question in turn, since you did not comment on my discussion of Darwinian explanation: Do you acknowledge that Darwinian explanation (in terms of natural selection, as described) is too fluid, too flexible, too adjustable to whatever happens, to be truly rigorous, fully testable scientific explanation?

I didn't comment on your discussion of Darwinian evolution because my comments in this thread have been solely on the subject of the scientific testability of ID, and you in turn did not comment on this subject at all but instead appeared to want to change subjects to the testability of Darwinian evolution. I'm really not interested in that. To satisfy your curiosity I do believe Darwin's ideas of descent with modification and natural selection are scientifically testable. I cannot answer whether they are "truly rigorous" or "fully testable" because I'm not sure how that would be different from just scientifically testable. CLAVDIVS

That should have read functional specified information TJ

CLAVDVIS “What I am saying is that the designer proposed by ID (as per the FAQ on this site) does not have any limitations, and therefore must be all-powerful and can achieve anything possible. Such a designer is not just “unpredictable”; rather, it is maximally unpredictable because it explains any phenomenon or measurement whatsoever” ID as proposed by Demski who I believe wrote the FAQ uses a filter that filters out design as an explanation. I fail to see the problem you are proposing. “No, ID does not make inferences like anthropologists because anthropologists place limits on the intelligent agent they propose to explain phenomena: they have particular requirements, they only exist at particular times and places, they have particular abilities, tools and technologies that strictly limit their ability to manipulate their environment etc.” Anthropologists infer design in certain cases period. ID infers design in certain cases period. They both infer design. Because of the fact that the origin of life is in the distant past the identity of the designer is not clear. Am I too understand what you are saying to mean that if I was to propose aliens as the agent of design who only exist at particular times and places, and have particular abilities, tools and technologies that strictly limit their ability to manipulate their environment that would be an acceptable hypothesis? Because ID includes that kind of hypothesis which would meet all your criteria. That’s not my version of ID but it is ID. “What matters is that logically the concept of the designer itself, as you acknowledge, is capable of explaining anything, and thus it cannot be scientifically tested. It may be a true concept, but it’s not very useful and not scientific” It can be scientifically tested. Predictions have been made and confirmed. While the specific abilities of a designer may not be known they may inferred from the design. It may be a true concept but not helpful? True concepts are always helpful in making predictions and understanding the world. How could it be true but not useful? Even if the truth was that everything is ultimately unpredictable (cause the designer is crazy and sporadic) at least we would be able to predict lack of certainty. If there is a rock in my yard I could explain it through a random process (a car drove over a rock and the rock was subsequently thrown into my yard). Or I could explain it through an agent (the neighbor kid put a rock there while he was playing and that rock was supposed to represent the bad guy’s hideout). If however, there are a bunch of rocks arraigned that spell “Johnny” I rule out random processes. This story illustrates how lots of things can be explained by design, but we infer it and only it in cases of functional specified complexity (just like an anthropologist) TJ

Hi, jerry: Well, it's fairly easy to verify with a simple model. I just made one to check! But I don't see an easy way of posting my output. Anyway: With a small population of 50, and a neutral mutation rate of 2%, the gene pool diversity rapidly reduces (alleles drop out of the population faster than new alleles are generated) But with a population of 5000, and same neutral mutation rate, the gene pool diversity rapidly increases (drop out is low and many new alleles propagate through the population). This is with no selection at all (all variants have an equal chance of reproductive success). Elizabeth B Liddle

If it makes sense, check it out. If it doesn’t, tell me why.

Your use of the term. "drift", confused me. Which is why I immediately went to Wikipedia to verify that my understanding was not off. Every time I have seen it used it was to talk about fixing alleles. Of course the frequency of lots of things that are not being selected could vary over time. No one denies that. The chance of it becoming important is a possibility but it still is the same gene pool and the same species. No one denies that. The gene pool can get bigger especially in large gene pools but I am not sure how that promotes any significant changes. The chance that it completely changes the species to something very different is what is being debated. I have never seen an argument that supports that could happen by such changes in the gene pool. I do not think any serious evolutionary biologist believes that can happen which is why people are looking for other mechanisms. Either they invoke "Deep Time" which is a cop out or they don't think it is the process that leads to a major change. It sounds like you disagree but you have to understand I have never seen anyone present a good case for Darwinian processes or gradualism leading to anything but trivial changes. I use the word "trivial" not because it may not affect the survival of the species but that it won't ever lead to major changes in evolution.. Why don't you point us to someone who does make a good case for your beliefs. I have mentioned Dawkins, Coyne and Futuyma don't do it and they are supposedly experts. People at Cornell and Pigliucci say they do not know how it happens. You seem sure but our better judgment says it has never been shown. But we can always be surprised. jerry

Elizabeth:

It’s also why irreducible complexity is not necessarily the problem that Behe envisaged – because neutral or even deleterious alleles can still propagate through a population, thus multiply the opportunities for a second mutation that is advantageous but only when paired with the first.

Behe's IC refers to systems and subsystems consisting of multiple proteins. Hie "Edge..." refers to more than two new protein-to-protein binding sites (which are required for these multi-protein configs). Joe

jerry

For example, if a mutation changed an allele so that a different fur color in an animal was then expressed, that could be an increase in CSI from what was previously there. It is a small increase in information in the sense that the gene pool is now expanded.

I don't see how a different fur color or a smaller/bigger beak could represent a real increase in body organization. Evolutionists have to explain their microbe-to-man process, not only trivial examples of microevolution where there is zero increase in organization/CSI. niwrad

I don't think this is accurate

Seriously, the Darwinian mechanism – believe us – created not even a single bit of the whole biological CSI on Earth!

For example, if a mutation changed an allele so that a different fur color in an animal was then expressed, that could be an increase in CSI from what was previously there. It is a small increase in information in the sense that the gene pool is now expanded. The idea that a series of mutations could produce a new protein with useable folds is another story. That is probably way beyond the ability of Darwinian processes. This is a major point in Meyer's book, the inability of mutations to create new folds. However, this is only a starting point for creating new species unless you want something like a new beetle species. Also unknown at this time is if there can be mutations to the assembly instructions for the organism. We know so little about them other than they are not in the genome but apparently in the cytoplasm and cell wall of the zygote. And it is here that changes have to be made if a truly new species is to appear. Otherwise we just get a new variety of beetle or a bird with a different beak. jerry

jerry:

My understanding of drift was that it reduced the number of alleles in a population which would make the organism less able to adapt. The statement also seems contradictory. First, the gene pool is getting smaller through drift while in the next sentence there is reference to a rich variety of variants which seems to imply the opposite of drift. Doesn’t drift reduce the number of variants?

Drift is simply the name given to the phenomenon by which near-neutral alleles can propagate through the population simply by luck - but they can also get bad luck and unpropagate back out again, unless they become fixed i.e. the only allele in the population. Essentially it's a random walk. If the population is small, the rate of loss may be greater than the rate of generation of new neutral variants, and so genetic diversity falls, and of course this is a major factor in accelerating extinction once populations fall below a critical level. However, if the population is large, and the rate of loss of alleles less than the rate of generation of near-neutral variants, then there is a constant "drip-feed" of neutral variation into the population, providing a diversified pool of alleles that may prove helpful if the population changes. For example it might provide a range of shades of fur, so that if the environment changes - perhaps a new predator arrives, and suddenly, instead of your shade of fur not mattering, being stone-coloured is suddenly very advantageous. This is important as it would mean that "micro-evolution" need not meet an edge by running out of alleles, if the population is large enough. It is also why I (personally) think it is mistake to think of new mutation that prove advantageous as normally proving advantageous on first appearance. I suspect this is fairly rare, though I don't know. I suspect that when a variant sequence becomes advantageous, it does so when there are already many copies of it around. It's also why irreducible complexity is not necessarily the problem that Behe envisaged - because neutral or even deleterious alleles can still propagate through a population, thus multiply the opportunities for a second mutation that is advantageous but only when paired with the first. And, as I tried to make clear to Timaeus: don't take my word on this. If it makes sense, check it out. If it doesn't, tell me why. But it's the way I see it, and it's certainly the way it works in the models I have experience of. Elizabeth B Liddle

Timaeus, You are seething with resentment. And that's just one example of many! You seem to be saying to yourself, "keiths and Lizzie shouldn't be so confident. It's wrong!", and then working yourself into a tizzy over it. Suppose you're right, and that our confidence is unwarranted. Why get so worked up about it? Why not just show that our confidence is unwarranted by exposing all of the silly errors you assume we are making? I think the problem is that you can't do so. You have this feeling that we're wrong, and that we're bluffing, because we're not evolutionary biologists or physicists or philosophers or specialists in whatever the topic of the moment happens to be. Yet you can't show that we're wrong, which frustrates you terribly. If you think we're overconfident, then show us that we're wrong. That will bring us down to earth. If you can't, then why get so worked up over it? How does this seething resentment help you? keiths

Hi Elizabeth, I don't find you irratating. I find that you lack the facts and evidence to support what you say. Not only that you refuse to understand the debate, for example you cannot grasp the "designed to evolve/ evolved by design" concept even though that is what EAs and GAs employ. That's not irratating, that's just plain ole ignorance which will continue to be corrected until you somehow find the ability to learn. Joe

Timaeus: Just come back from what was supposed to be a trip to a pub for supper, but they'd stopped serving food! I'm glad you liked my post at 41, but let me respond a little to your response to my 40 (not in a spirit of antagonism, however): I understand that you find me irritating, and I guess we will both just have to live with that. I find your "credentialism" a bit irritating too, it must be confessed, but I guess we can both live with that as well. But let me make something very clear about me: I do not expect people to believe me because of what the do, or do not, know about my "credentials". They are completely irrelevant to an internet argument. For authoritative information, the only proper resources are text book or a peer-reviewed papers, and even their our skepticism should be to the fore. When I make an argument, or say what I think is the case, or tell you I think you have made an error, I am not attempting to "school" you, nor belittle you. Indeed, I think that an objective observer could make the case that at least as much belittling has been going on in the other direction. But that's OK - my back is broad. And the reason my back is broad is that I myself have very little inherent respect for credentials - what I respect are clearly laid out arguments that are well supported by verifiable data. And I expect to be treated on that basis too. If you have a problem with an argument or evidence that I present - I fully expect you to tell me what is wrong with the argument or why the evidence is faulty. Indeed, I do you that respect. The very arrogance you think I display could (and should) be read quite differently: I expect you to treat my arguments solely on their merits, and rather than feel stung by any perceived implied tone of superiority, come right back at me with what you think is wrong, on the assumption that I would not have presented my argument nakedly as I did had I not done you the credit of assuming that any counter argument you had would be worth hearing. And if I find I agree, I will most readily concede. I may irritate people, but I think (though I may be flattering myself of course) that people who know me generally regard me as someone who will change their view, quite radically, if required, if persuaded of an alternative view, or by infirming evidence. I think that the view of Darwinian theory you laid out in that post was quite extensively mistaken. That doesn't mean I think I'm better than you. It just means I think you are wrong, for the reasons I gave. It's perfectly possible that I am. But rather than take umbrage at my tone, why not actually argue the points? BTW, My reference to chaos theory was not "technobabble" at all, nor did I attempt to imply any expertise in economics. But quite clearly (as I assumed you would agree) economic systems are profoundly non-linear, as are evolutionary systems, weather systems, and indeed brains (and by the way I am not a neurologist - I am not a clinician at all). This has important implications for predictability. Anyway, I'm glad at least you liked my second post. We should probably give each other a substantial breather at this point. And thanks (truly) for the conversation. Cheers Lizzie Elizabeth B Liddle

Elizabeth

Because I think that the Darwinian mechanism has far more power than it is generally credited with by IDers,…

I want to be generous with you, I concede that the Darwinian mechanism is one billion more powerful than thought by me. I think it has exactly zero creative power, then 1,000,000,000 x 0 = 0. :) "Far more power"? Seriously, the Darwinian mechanism - believe us - created not even a single bit of the whole biological CSI on Earth! niwrad

Maybe someone could explain the following quote because I have never seen it argued this way.

I’d say, is not genetics (although that is mechanistically huge) but the mathematics of drift. We can now see from models that even I can construct that drift allows neutral and even slightly deleterious variants to propagate through the population and thus, in a large enough population, offer a rich variety of potential, already numerous, variants, to prove advantageous when things change.

My understanding of drift was that it reduced the number of alleles in a population which would make the organism less able to adapt. The statement also seems contradictory. First, the gene pool is getting smaller through drift while in the next sentence there is reference to a rich variety of variants which seems to imply the opposite of drift. Doesn't drift reduce the number of variants? From Wikipedia:

Genetic drift may cause gene variants to disappear completely and thereby reduce genetic variation.

I am always looking for some clarification because the statement is contrary to what I understand. jerry

Elizabeth:

Because I think that the Darwinian mechanism has far more power than it is generally credited with by IDers,...

Why do you think that? Lenski's 50,000+ generations tells us the the IDists are right and the evolutioners are wrong. Joe

Elizabeth: I find your comments in 41 reasonable. Many of your suggested starting points sound useful, and I think many IDers would agree with you about them. I of course don't agree with all the side-comments about thermodynamics and theology that you make, but I won't take them up. Your post 41 was much better than your post 40! Dialogical, and relaxed/speculative, for a change, instead of didactic (bordering on pedantic). :-) Timaeus

CLAVDIVS @ 28 If you agree that ID establishes that functionally complex specified things like cells do not, and cannot, make themselves by accident then ID has established something of paramount importance, something that consigns neo-Darwinism to the scrap-heap. And all without knowing a single thing about who or what designed the cell. Chris Doyle

Elizabeth (re 40): It's a pretty large statement to say that I misunderstand "evolutionary theory." Evolutionary theory covers a lot of ground, from pre-Darwinian writings to very modern ones. I certainly have not read as much detailed population-genetics mathematical theory as you have read; but I have read a large amount of evolutionary theory, including extensive amounts of Darwin, Gaylord Simpson, Bergson, and others, and of course many secondary accounts written by competent scientists and historians of science. I would certainly deny that "evolutionary theory" is simply equatable with what *you* call "evolutionary theory"; that would be like saying that "Christianity" is equivalent to "post-Enlightenment Protestantism." Your "explanation" of natural selection is not necessary. I understood every word you say above about natural selection when I was about 20 years old. I disagree with your *application* of what you say. You are not seeing my point, because my point is not the point *you* (interrupting my conversation with someone else) think I should be making. The fact is that you apparently have not considered the ease with with selectionist explanations can be made, how easy it is to concoct "just so" selectionist stories which "explain" nothing because they can in fact explain everything. And giving me a textbook explanation of natural selection (as if I need it, when I could have written the same thing myself, without your help and without looking it up) doesn't impress me much. It's your overall intellectual *judgment* I'm disputing, not your memorized schematizations of how natural selection or population genetics work. And indeed, this is not an uncommon experience for me, when I clash with scientists. I find their knowledge often impressive, but their judgment questionable, on any question that is not *entirely* technical. And the conversation I'm having with Claudius goes beyond the merely technical into meta-questions about epistemology of science. I don't think I need your help in that area, as such remarks as I've heard you make in the philosophy of science area don't impress me as profound or learned, in comparison with authors I've read who really know the territory. Also, by the way, don't assume that you are laying out the only responsible account of these matters even on narrowly technical grounds. You describe Darwin's conception as that of a "tree" and then you go on to say that this is confirmed by the data. I have been assured by many scientists with more specialization in evolutionary theory than you that the "tree" notion is wrong and that a "bush" or "network" or the like would be much more in conformity with the data. So you don't speak for evolutionary biology, and I wish you would stop writing with a declaratory tone which suggests that you think you do. Is this a longstanding dialogical habit of yours, this assertiveness? Are you like this in personal conversation, or is this only an internet writing habit? If you're like this in personal conversation, I'm glad there is an ocean between us! I'd be tempted to throttle you! :-) Always remember, Elizabeth: I don't regard you as my *teacher* when it comes to evolutionary biology. Maybe regarding the math of population genetics -- if I ever wanted to do such calculations, I would accept you as my teacher. But for the rest, to me you are just a psychologist/neurologist with a hobbyist's interest in evolutionary theory, a bright gal with an internet connection and a library (the same resources as I have), who is largely an autodidact when it comes to evolutionary theory -- you're in the same position as I am. (And if you disagree, disagreement's free, but I take no notice of it.) Yeah, yeah, I know that scientists often use "prediction" in the sense that you describe, and I don't deny it. But I'm talking about "prediction" in the more normal sense, and it's a fact that some sciences are as useless as boobs on a bull when it comes to prediction in the normal sense, whereas others are very strong on it. I have much, much more respect for the latter sciences, and always will. As for your techno-babble about economics and chaotic systems (I suppose you are now an expert on economics, too, as well as thermodynamics, evolutionary theory, music, etc.), it is irrelevant to my main point, which is, that, as far as "prediction" in the normal sense goes, economics is midway between the experimental sciences and evolutionary theory. Evolutionary theory scores zero; economics, moderately low but still vastly better than evolutionary theory; physics and chemistry, quite high. These are the facts. They may not be facts that interest you, but they interest me. This is one of your worst posts, Elizabeth. You interrupt a conversation; you try to take control of the conversation by arguing that the whole frame of reference, terminology, etc. is all wrong; and you aren't really *listening* to the conversation, or putting yourself in the place of the parties, trying to find out what question *they* are concerned with. And that is actually quite typical of your internet attitude. Dialogue in the sense of "tuning in" to another person's set of priorities, concerns, etc., is not your strong point (maybe it is in your personal life, but not in your internet life). You always want to take charge, set the agenda, decide which questions, which approaches, which vocabulary are the right ones, and then be the teacher who straightens out the people who don't see as clearly as you. As a psychologist, perhaps you know of various terms to describe people who regularly display this controlling behavior. I won't venture to apply any of them to you, as I'd be accused of misusing them. But it seems to me that one or more of them might well fit your politely bullying manner. Best wishes. :-) Timaeus

Elizabeth:

First of all, what Darwin’s idea (of descent with modification plus natural selection)...

Descent with modification via natural selection- Darwin's book- "On the Origin of Species by Means of Natural Selection".

...explains is simply why populations adapt to their environments (because traits that confer greater probability of reproductive success in the current environment will tend to become more prevalent).

And we know "current environments" change. Not only that but there are more than one trait that can confer an advantage.

So unless the environment is extremely simple, or we do a controlled experiment with very few environmental variables, the theory makes no specific predictions – it merely predicts that the population, if it does not go exinct, will evolve adaptations.

Again, if a population waits for an accidental change to provide some advantage, it's too late. Also what Lizzie says is vague. Organisms with "built-in responses to environmental cues" will evolve adaptations.

Darwin’s theory also predicts a tree structure in longitudinally heritable data...

No, it does not. For one it says nothing about origins and there could have been many. And that means many trees would be possible. Also Darwin didn't explain reproductive isolation- meaning as far as he knew there could be many branch crossings.

Natural selection is neither a category nor vague. It’s a metaphor for a process that is very precisely defined: the process by which heritable traits that confer greater probability of reproductive success will become more prevalent in the population.

According to Mayr, natural selection eliminates the weak and deficient. Also the variation HAS TO BE happenstance. That is natural selection is differential reproduction DUE heritable RANDOM (as in chance) variation. And nothing in that definition says natural seelction is a designer mimic.

The classic example is Tiktaalik, but more literally, any evolutionary hypothesis must make testable predictions, and those predictions must be tested on new (i.e. future) data.

LoL! With Tiktaalik the fossils show fish->tetrapods-> fish-a-pods. And it says nothing about a mechanism. And as far as phylogenetics is concerned, the similarities observed could very well be due to a common design. Joe

Timaeus:

Can we agree that it looks at the moment as if the universe is of finite age? And that it seems that the same is true of the earth? And that therefore, we cannot avoid explaining the existence of life on earth by postulating an everlasting universe in which life was always there, but must come to grips with the question of when and how life originated on the earth?

Yes. Most emphatically.

Can we further agree that there must have been a chronologically first life-form on the earth? (Even if life had several separate origins on the earth, there would have been one that was first.)

Yes.

Now, let’s talk about this hypothetical first life-form on the earth, whatever it was. I’ll let you define that hypothetical form in any way you want: give it a cell wall or not, give it DNA, or just RNA, or some unknown self-reproducing basis of your choosing. Give it organelles of your choosing. All I ask is that it be a coherent entity, with parts and systems that interact in such a way as to enable it to thrive and reproduce, and thus potentially to become the ancestor of a whole range of later and more complex living forms. Now, I want to ask the question: Did this first living entity arise (probably through a series of steps, rather than all at once) purely out of chance and natural laws, or did its arrival involve some intelligence (expressed in planning, manipulation, or both)? That is the historical way of putting the question. An alternate way of putting it, with a different and more intellectually ambitious causal slant, would be: *Could* this first living entity have arisen purely out of chance and natural laws, or would it have *necessarily* involved some intelligence? I am not at this point asking, as you might wish later to ask, if this question is *testable* by the techniques of current science; I am asking if this question is *intelligible*. Is it a question about facts which can *in principle* be answered one way or the other (even if in practice it is very hard or impossible to answer)? That is, it is a meaningful, logical, sensible proposition to answer: “No, this entity did not require anything other than chance and natural laws to come into being” or alternately to answer, “Yes, this entity required something other than chance and natural laws to come into being?”

Yes, I think it is an intelligible question, and indeed, one worth asking.

If you answer that these are not even *intelligible* questions and answers, then discussion is at an end; we can’t get further. But if you agree that they are intelligible questions and answers, then you presumably do not object when people raise or suggest them. So your objection — if you have an objection — to a “design hypothesis” regarding the origin of life would be — what? That no such hypothesis should be allowed? That such a hypothesis should be allowed, but only in philosophy, not in natural science? Or that such a hypothesis is allowable even in natural science, but that it has to be formulated in certain ways different from the way ID people would formulate it?

Closest to that last thing – but let me rephrase: that such a hypothesis is allowable even in natural science, but that it has to be formulated in certain ways different from the way ID people so far have formulated it.

I want to stick to the origin of life example, because then we don’t have to get involved in many tangled discussions about evolutionary mechanisms, where we have already established that we have momentarily irreconcilable disagreements. I want to talk about the origin of the basic biological structures without which no evolutionary change would be possible.

Good idea. I think ID is on much firmer ground with OOL. Though it may still become swampy.

So, if you were to address the question whether the first life was/wasn’t or had to be/didn’t have to be designed, how would you go about addressing it? What preliminary premises would you want to get both ID and anti-ID folks to agree on, in order to get a profitable discussion going about how we might decide between one answer or the other?

Because I think that the Darwinian mechanism has far more power than it is generally credited with by IDers, the first think I’d probably want to do is to focus on just how simple the simplest possible Darwinian-capable self-replicator had to be (with the additional constraint that it also had to be capable of evolving as far as the basic modern cell, i.e. with DNA-RNA-protein pathways). So that’s a discussion worth having, but of course that’s exactly what OOL researchers are already focussing on. So the interesting question I think, for those who want to figure out whether some kind of ID mechanism is a better candidate for the simplest possible self-replicator is: if an actual intelligent agent was involved, how might the design be physically implemented? If discussion had got as far as an agreement that life was probably self-designing, as it were, from Darwin capability onwards (which is a big if, of course), then we’d be talking about how those first molecules got assembled, and the competing hypotheses might be: chemical reactions in, say, a soup of organic molecules possibly within some kind of convection gyre; some kind of hitherto unknown force that pulled the relevant molecules together. Nagel, for example, suggests that there may be an inherent property of nature that makes assemblies that have the potential to become conscious more probable than assemblies that don’t – a kind of teleological “gravity” if you like that supplies an additional attractive force between molecules that have the potential to result in consciousness. So that’s one approach (dunno how you’d actually do it though – I’m just putting stuff out there). Another approach, although it’s scientifically unsatisfying, is to say: this looks impossible; it must be something beyond the realm of science. In essence, that’s the current ID position (although I’m sure IDers will come down on me like a ton of bricks for saying so), and while I don’t think it’s necessarily unreasonable, it doesn’t actually take us very far, and is always prone to literal falsification if someone figures out that it isn’t impossible. Thus, my view is that ID really does need a positive hypothesis. Nagel’s might be one (although I have other reasons for thinking not). Other possible approaches might be exploration of the “front-loading hypothesis” – that might make real differential predictions i.e. predict patterns in DNA that would not be predicted by Darwinian evolution, for instance, stretches of highly conserved DNA that nonetheless appears to have no phenotypic function, and can be readily activated by a minor mutation. I think that is what motivates ID interest in the “junk DNA” story, although I think that a huge amount of junk is written about junk DNA. Yet another approach would be to say: OK, if we assume that life was designed, what does that tell us about the designer’s methods and purposes? Because I think it could tell us quite a lot. Then, knowing that, it might be possible to predict future directions, for example, for a population threatened with extinction. I’m not being very creative here, because, as you say, I’m quite strongly biased against the project, not out of dislike of the implications (well, perhaps a little – I certainly don’t like the theology!), but because I think that in order to work, it does require that an immaterial something did physical Work on physical Matter, but left no trace in terms of a system with commensurately reduced entropy. That essentially means something outside our understanding of how designers work (human designers do not violate the 2nd Law, and while I don’t wish to get into another argument about this, I do think it’s what makes that whole 2nd Law thing very important), and means that the ID designer hypothesis is NOT simply an extrapolation from human design, as many claim (“design is the only known cause of CSI”), but invokes something very different – something that transcends one of the most powerful properties we think the universe has. That’s fine – so must the universe’s cause itself, but it would be going further than that – it would be saying: whatever supra-universal cause caused the universe is also operant within it, while simultaneously transcending the properties of that universe. And my own view is that at this point the thesis really does verge on the untestable, because how could we make any predictive hypothesis about a force that does not behave according to the predictive laws we have? But what I am really pleased about, regarding this conversation, is that we seem to have got to a place where we can actually discuss the nuts-and-bolts of the ID project, and what the various ID options might be, and which ones are testable, potentially. I’m sure there are much more interesting ideas that could be discussed that could be raised here, but if I were the DI, and wanting to fund such investigation, these are the kind of questions I’d be wanting people to ask. I’d also want to see much more rigor regarding comparison between different ID hypotheses and positions. YEC positions are vastly different from OEC, for instance, and anti Darwinian positions vastly different from OOL positions, and fine-tuning positions vastly different from OOL positions. OK, Must. Drag. Myself. Away. From. Computer…. Thanks again! Elizabeth B Liddle

Ah. Timaeus. I can address this, in some detail. Please do not, however, interpret my words as being de haut en bas but an attempt to explain how I understand evolutionary theory, and why, in my view, you have misunderstood it, which I think you have, although, of course, I could be wrong!

The same can be said of Darwinian-style theorizing. It has been used to explain, for example, both why evolution favors selfishness and why it favors altruism, why it favors competitiveness and why it favor cooperativeness. It can explain why some species stay the same way for hundreds of millions of years and why others are rapidly transformed — but of course it can do this only in retrospect, never on a predictive basis (which is about as scientifically useful as economic models that can explain depressions only after they have occurred, and never articulate their causes in such a way that they can be avoided or at least mitigated).

First of all, what Darwin’s idea (of descent with modification plus natural selection) explains is simply why populations adapt to their environments (because traits that confer greater probability of reproductive success in the current environment will tend to become more prevalent). So unless the environment is extremely simple, or we do a controlled experiment with very few environmental variables, the theory makes no specific predictions – it merely predicts that the population, if it does not go exinct, will evolve adaptations. It does not tell us what those adaptations will even be. If the thing that enables the population to survive a changed environment is “selfishness” and if “selfishness” is on the menu of the gene pool, then that will evolve; if “altruism” is on the menu, and that is advantageous, then that will evolve. The key thing about the evolutionary mechanism is that it is powerfully non-linear, because it involves feedback loops, and therefore chaotic, in the technical sense, and therefore as unpredictable in specifics as weather, even though, like climate, it is broadly predictable in general. The same problem besets economics, because again, economic behaviour is a chaotic system. The theory can explain why it is a chaotic system (because of feed-back loops) and why it can produce striking effects, but not precisely what, or when. Darwin’s theory also predicts a tree structure in longitudinally heritable data, which is supported by our data, although again, it cannot tell us what branches will appear when, where, or when extinction events will occur – although it can tell us to expect rapid radiation following big extinction events, and periods of rapid adaptation followed by longer periods of homeostasis as the population optimizes. This can be demonstrated mathematically. Again, this is exactly what the data suggest. This is quite different from the case for Design. Design doesn’t tell what to expect at all. It is actually predicated on the lack of predictive power – the principle is: nobody could have predicted this (aka “this is improbable”) from data, therefore it must be designed. Darwinian theory as very little forecasting power, although, like weather forecasters, we can predict a few things on a short time-scale – spots on guppies, beaks on finches. But it does have huge power to predict patterns and what it predicts is very much what we observe.

And “natural selection” is such a vague category — on what basis does nature “select”? Strength? Speed? Ferocity? Attractiveness to mates? (What if the most attractive mates turn out to be the most useless providers of food? Or tend to eat more of their own infant offspring than less attractive mates? What cost/benefit analysis must we then perform to predict what natural selection will choose?) And does natural selection operate on individuals or communities (the case of beehives with different organizations, etc.)? Because there are so many factors that might determine what is “selected,” the Darwinian theorist has almost infinite play in concocting his after-the-fact explanatory narratives for why some species died out and others thrived..

I think this is quite wrong. Natural selection is neither a category nor vague. It’s a metaphor for a process that is very precisely defined: the process by which heritable traits that confer greater probability of reproductive success will become more prevalent in the population. It does not tell us what will confer reproductive success, because that is constantly changing, as the environment itself changes. Indeed it is a huge strength of the theory (one greatly underestimated by, for example, Axe, Gauger and Dembski) that because, potentially, so many slight variants can offer some slight advantage in some slight way that the fitness landscape is so high-dimensioned and thus so traversable. A longer leg, a shorter beak, a lighter feather, a sharper eye, all can confer reproductive advantage. Not only that, but the one big advance since Darwin’s day, I’d say, is not genetics (although that is mechanistically huge) but the mathematics of drift. We can now see from models that even I can construct that drift allows neutral and even slightly deleterious variants to propagate through the population and thus, in a large enough population, offer a rich variety of potential, already numerous, variants, to prove advantageous when things change. And you raise a good question when you ask about units of selection above the phenotype. I agree entirely that this is important (and was what I found myself musing on, aged 12, in that biology class, while my bench mate was etherizing the earthworm) – clearly natural selection can operate at any level at which an entity renews and maintains itself – whether at the level of the cell, the colony, the population, or even a population of populations. And so, we’d expect (if we’d been smart enough earlier, but we know are, thanks to people like Shapiro) that evolutionary processes are themselves evolvable – populations of individuals whose offspring neither resemble them too closely nor too remotely will tend to adapt more readily than those where the offspring are too identical or too unlike. So “smoothness” of the landscape is itself a selected trait, at the level of the population. Similarly, populations in which genes are laterally, as well as vertically, mixed, so that populations remain robust in the face of changing environments, ditto populations in which there is a certain amount of “slack” between phenotypic traits and heritability. Evolutionary theory is extremely rich, but the riches are not “ad hoc patches” as some IDists seem to think – they are rather a reflection of just how powerful, and how deeply applicable, Darwin’s basic theory is.

And he never has to do what physicists, chemists, and engineers have to do: use his scientific model to predict what will happen in the future, and admit that his model has been falsified or at least seriously weakened by repeated false prognostications. The retrospectivity of the whole enterprise makes it much less scientific, as the world normally understands scientific, than other scientific activity

Again, I think this is mistaken. Biologists predict the future all the time – not necessarily future events, but future data. The classic example is Tiktaalik, but more literally, any evolutionary hypothesis must make testable predictions, and those predictions must be tested on new (i.e. future) data. This could be new organisms in a lab like Lenski’s, or it could be predicted patterns in existing data that have not hitherto been tested for. Phylogenetics is heavily predictive, and involves falsification of null hypotheses, just as research in physics, chemistry and engineering does. It is simply not true that evolutionary theory, or other so called “historical” sciences (not that evolution is entirely historical – it’s happening all around us as we type, and can be observed in real time) are fundamentally different from the “experimental” sciences. Much science is correlational rather than experimental, but evolutionary biology includes both techniques, and both involving fitting models to existing data that then predicts new data. OK, those sweet peas are getting desperate, must go! Cheers Lizzie Elizabeth B Liddle

Meyer has a couple chapters in his book on whether ID is science or not. In one place he makes an argument similar to one I have made here several times, namely ID subsumes Darwinism, Neo Darwinism, the Modern Synthesis and what is today called the Extended Synthesis. All these modifications of Darwinism can definitely explain some minor but important stuff but they are very limited. ID uses the same data and same procedures as so called traditional science but sometimes makes a different conclusion based on the data. In other words everything is identical to traditional science except ID can expand the potential conclusions from the results of the study. A typical science study is Background, Methods, Results and Conclusions. ID just expands the potential range of conclusions. It is not looking for a designer behind every tree but in some instances, nearly all origin events, ID is the only conclusion that can explain the data. If there was a naturalistic explanation for these events, ID would disappear very quickly. The interesting thing is that these are the same objections that were raised here 4-7 years ago and answered. But like a Whack a Mole, they keep appearing. jerry

Claudius asked: "So do you acknowledge that the ID concept of an unlimited designer cannot be scientifically tested?" I know of no ID concept of an unlimited designer. I know of Christian, Jewish, and Muslim conceptions of an unlimited designer. But ID is not any of those religions. ID is about designers, period. No specification of "unlimited" is essential to the theory of design detection. The idea is that we can detect design, not whether or not the designer is unlimited. So the stones of the Pyramids could have been arranged by an unlimited designer (God) or by limited designers (ancient Egyptians). We can tell they are arranged by design; but nothing in the *design* (i.e., the mathematical arrangement) tells us whether the designer was a mortal or a God. We might be able to tell whether the *assembly* was by mortals rather than a perfectionist God -- from slight flaws of measurement, stonecutting, etc. But the design -- we can't tell which mind it came from. All we can tell is that the Pyramids weren't made by centuries of winds blowing sand that just happened to harden into blocks in those positions. We can tell that a mind was involved. Now let me ask you a question in turn, since you did not comment on my discussion of Darwinian explanation: Do you acknowledge that Darwinian explanation (in terms of natural selection, as described) is too fluid, too flexible, too adjustable to whatever happens, to be truly rigorous, fully testable scientific explanation? Timaeus

Elizabeth: I understand everything you have said in 30, I think, but you are not getting at what I want to get at. Let us try to make things a bit simpler. Can we agree that it looks at the moment as if the universe is of finite age? And that it seems that the same is true of the earth? And that therefore, we cannot avoid explaining the existence of life on earth by postulating an everlasting universe in which life was always there, but must come to grips with the question of when and how life originated on the earth? Can we further agree that there must have been a chronologically first life-form on the earth? (Even if life had several separate origins on the earth, there would have been one that was first.) Now, let's talk about this hypothetical first life-form on the earth, whatever it was. I'll let you define that hypothetical form in any way you want: give it a cell wall or not, give it DNA, or just RNA, or some unknown self-reproducing basis of your choosing. Give it organelles of your choosing. All I ask is that it be a coherent entity, with parts and systems that interact in such a way as to enable it to thrive and reproduce, and thus potentially to become the ancestor of a whole range of later and more complex living forms. Now, I want to ask the question: Did this first living entity arise (probably through a series of steps, rather than all at once) purely out of chance and natural laws, or did its arrival involve some intelligence (expressed in planning, manipulation, or both)? That is the historical way of putting the question. An alternate way of putting it, with a different and more intellectually ambitious causal slant, would be: *Could* this first living entity have arisen purely out of chance and natural laws, or would it have *necessarily* involved some intelligence? I am not at this point asking, as you might wish later to ask, if this question is *testable* by the techniques of current science; I am asking if this question is *intelligible*. Is it a question about facts which can *in principle* be answered one way or the other (even if in practice it is very hard or impossible to answer)? That is, it is a meaningful, logical, sensible proposition to answer: "No, this entity did not require anything other than chance and natural laws to come into being" or alternately to answer, "Yes, this entity required something other than chance and natural laws to come into being?" If you answer that these are not even *intelligible* questions and answers, then discussion is at an end; we can't get further. But if you agree that they are intelligible questions and answers, then you presumably do not object when people raise or suggest them. So your objection -- if you have an objection -- to a "design hypothesis" regarding the origin of life would be -- what? That no such hypothesis should be allowed? That such a hypothesis should be allowed, but only in philosophy, not in natural science? Or that such a hypothesis is allowable even in natural science, but that it has to be formulated in certain ways different from the way ID people would formulate it? I want to stick to the origin of life example, because then we don't have to get involved in many tangled discussions about evolutionary mechanisms, where we have already established that we have momentarily irreconcilable disagreements. I want to talk about the origin of the basic biological structures without which no evolutionary change would be possible. So, if you were to address the question whether the first life was/wasn't or had to be/didn't have to be designed, how would you go about addressing it? What preliminary premises would you want to get both ID and anti-ID folks to agree on, in order to get a profitable discussion going about how we might decide between one answer or the other? Timaeus

Mark Frank:

But it does require some kind of hypothesis (however vague) about the designer and/or design mechanism so that it can be assessed.

No, it doesn't. What are those hypotheses wrt Stonehenge? Please do tell- and tell us how they helped make a design inference. IOW show us that we could not determine design without them. Good luck with that Joe

CLAVDIVS:

So do you acknowledge that the ID concept of an unlimited designer cannot be scientifically tested? It can be tested- however ID does not have that concept. I told you how to test it- Newton told you how to test it. Don't blame us for your willful ignorance.

Joe

Elizabeth:

But the more important point is that “is it designed”? isn’t a readily testable hypothesis.

No, it's a question, duh. However your position doesn't have any testable hypothesies, Lizzie. "Did it evolve via accumulations of genetic accidents?" isn't testable.

And we can only test hypotheses that make testable predictions, ...

Try leading by example, Lizzie. We all know that you cannot, but at least try. The point being is your position doesn't make any predictions based on its proposed mechanisms.

Notoriously, it is the default in the Explanatory Filter – the think you conclude when you have rejected all others.

LoL! Lizzie doesn't know what "default" means! No one takes you seriously seeing taht you make such simple errors, Lizzie. For one it cannot be the default if alternatives were/ are actively considered- and that is what the EF mandates-> active consideration of alternatives. Then there is the FACT that the EF mandates that not only do those alternatives have to be eliminated but ALSO there has to be some specification present.

I can think of lots of ways of testing specific design hypotheses, but they all involve a hypothesis involving a postulated designer.

That is proof that you don't know what you are talking about. I can test specific design hypotheses without knowing the designer.

And IDists insist that this is irrelevant – that “Design detection” should only involve the observed pattern, not any hypothesis about the designer.

That's what reality dictates, Lizzie. We do not have to know anything about the designer(s) before inferring design.

And, specifically, we cannot distinguish between teleonomy and teleology in a system that is self-reproducing, or which has feedback-loops that maintain some kind of homeostasis.

Your position can't explain self-reproduction, so stuff it already.

Teleonomy can sometimes be ruled out, as in the case of non-living artefacts, but there is no obvious reason to rule it out in the case of living things, because we already have an non-design candidate optimizing process that can operate in self-perpetuating systems.

That's your opinion and that is all it is. Your opinion lacks evidentiary support.

So if we want to find out whether or not living things were designed or not, we need to dig deeper, and look at specific hypotheses regarding not only the postulated designer’s design processes (which we can do)...

LoL! No, Lizzie, first we determine design is present and THEN we may be able to figure out the "how" by studying the design and all relevant evidence. As I said you ain't an investigator- you are totally clueless.

If the postulated designer is a physical being (a genetic engineer for instance) that is easy enough.

And yet we still don't know how they built Stonehenge! And living organisms are much more complex than Stonehenge. IOW once again you prove that you are ignorant. Joe

Timaeus @ 31 So do you acknowledge that the ID concept of an unlimited designer cannot be scientifically tested? CLAVDIVS

CLAVDIVS:

“Infer design” is not a testable explanation.

No, it's an inference reached after the investigation is conducted.

It is simply an assertion that there is some sort of explanation, which is not defined enough for testing, that involves an intelligent agent.

That is how archaeology and forensics do it, CLAVDIVS.

The sorts of explanation that can be scientifically tested involve a general rule, and a logical argument showing how phenomena follow from that rule e.g. Jupiter’s orbit follows from Newton’s law of gravitation.

Let's see- evolutionism cannot be scientifically trested. Universal common descent cannot be scientifically tested. OTOH all design inferences can be scientifically tested. Archaeologists do it as do forensic scientists. You just don't know what you are talking about, and it shows. But please, do tell us how to test the premise that accumulations of genetic accidents can produce, say, a bacterial flagellum... Joe

Claudius (29): The same can be said of Darwinian-style theorizing. It has been used to explain, for example, both why evolution favors selfishness and why it favors altruism, why it favors competitiveness and why it favor cooperativeness. It can explain why some species stay the same way for hundreds of millions of years and why others are rapidly transformed -- but of course it can do this only in retrospect, never on a predictive basis (which is about as scientifically useful as economic models that can explain depressions only after they have occurred, and never articulate their causes in such a way that they can be avoided or at least mitigated). And "natural selection" is such a vague category -- on what basis does nature "select"? Strength? Speed? Ferocity? Attractiveness to mates? (What if the most attractive mates turn out to be the most useless providers of food? Or tend to eat more of their own infant offspring than less attractive mates? What cost/benefit analysis must we then perform to predict what natural selection will choose?) And does natural selection operate on individuals or communities (the case of beehives with different organizations, etc.)? Because there are so many factors that might determine what is "selected," the Darwinian theorist has almost infinite play in concocting his after-the-fact explanatory narratives for why some species died out and others thrived. And he never has to do what physicists, chemists, and engineers have to do: use his scientific model to predict what will happen in the future, and admit that his model has been falsified or at least seriously weakened by repeated false prognostications. The retrospectivity of the whole enterprise makes it much less scientific, as the world normally understands scientific, than other scientific activity. Timaeus

Timaeus

Elizabeth wrote: “Just because our methods don’t detect design where you detect it, KF, doesn’t mean we don’t have methods that detect design.” This comment springs from either insincerity or self-delusion.

Well, no, but I do accept your emendation.

“Our methods” — as Elizabeth means the phrase — can of course detect design if the object is a radio or a coded message or a pyramid in the sands of Egypt. The Darwinists will gladly grant that we can know for a fact that all these things were designed, and not merely the product of chance and natural laws.

Yes, indeed.

But there is not a living, breathing soul on her side who has ever proposed a method for determining whether or not *a living system* or *a living organism* is designed. Or is even interested in investigating that question. And it is design *in living systems* that the debate is about, not design in computers or Stonehenge.

This is not strictly true, although you will not like my counter examples: there has been some really interesting research into whether certain plants, famously, maize and bananas, but also other species, were “designed” deliberately by our ancestors in order to produce more edible populations. In other words domestication by human beings can be detected retrospectively in a kind of biological application of archaeology. And of course, now that we deliberately design genomes by inserting sequences from a distantly related organism into a genome , in future, those will be detectable in the genetic phylogenetic signal, just as other horizontal transfer mechanisms are now. But the more important point is that “is it designed”? isn’t a readily testable hypothesis. In fact “Design” isn’t a hypothesis at all – it’s at best a very vague theory. And we can only test hypotheses that make testable predictions, and we can derive these from some theory that has some explanatory power. In other words for a design hypothesis to be testable, it has to be motivated by a proper theory, and “Design” just isn’t one. Notoriously, it is the default in the Explanatory Filter – the think you conclude when you have rejected all others. I can think of lots of ways of testing specific design hypotheses, but they all involve a hypothesis involving a postulated designer. And IDists insist that this is irrelevant – that “Design detection” should only involve the observed pattern, not any hypothesis about the designer. This is ludicrous, frankly. As I keep saying, the “probability” of a pattern is meaningless, absent some hypothesis regarding its generative process. Without such a hypothesis we cannot detect design. And, specifically, we cannot distinguish between teleonomy and teleology in a system that is self-reproducing, or which has feedback-loops that maintain some kind of homeostasis.

The *working expectation* of everyone on her side, including Elizabeth herself (if she is entirely frank) is that *all* cases of apparent design will, in the long run, turn to be just that — cases of *apparent* design only. So why would her side ever try to develop methods of design detection for *natural* objects and systems? (Why would you develop possible designs for a perpetual motion machine, if your working expectation was that one could never be made?)

I do get somewhat irritated when people assume me to take stances I do not have. It is perfectly true that I do not see any overpowering need at present to postulate an alternative to non-design processes to account for life, but it’s perfectly possible that that will change, in the light of new data. However, the data that are advanced as evidence that we should be seeking a design-based causal account, are not, in my view, persuasive, at least so far. But far more importantly, we would waste a heck of a lot of time and resources if we pursued any theory at all on the principle that we have not ruled it out. If a theory is to be pursuable it needs to have some explanatory power, from which hypotheses can be derived. “Design” is not such a theory.

Maybe Elizabeth will show us some of the methods of design detection that the Darwinian side has devised? And let us know who devised them? Mayr, perhaps? Or Crick? Or Monod? Or Coyne? Or Moran? It would all be news to us.

I would say that the methods in use detect can tell us that something was optimised for a purpose – serves some function, in other words. I think this is a useful insight that the ID community has highlighted, and I have always acknowledged it. However, I do not think the method necessarily distinguishes between teleology and teleonomy. Teleonomy can sometimes be ruled out, as in the case of non-living artefacts, but there is no obvious reason to rule it out in the case of living things, because we already have an non-design candidate optimizing process that can operate in self-perpetuating systems. So if we want to find out whether or not living things were designed or not, we need to dig deeper, and look at specific hypotheses regarding not only the postulated designer’s design processes (which we can do) but also the designer’s fabrication processes. If the postulated designer is a physical being (a genetic engineer for instance) that is easy enough. If the postulated designer is an immaterial mind, the problem is far greater, because we’d have to look for evidence that Work had been done, or was being done, on a system in order to produce the designed configuration. And that lands us back in trouble with the 2nd Law of Thermodynamics. Elizabeth B Liddle

TJ @ 23

Okay I see where you are coming from. A physical theory like relativity can be formulated mathematically, gravity can be expressed mathematically and we can calculate an orbit with those types of things. A designer doesn’t count because he doesn’t fit into that type of box. Is this a correct interpretation of what you are saying? I’m going to assume it is and continue feel free to correct me though.

What I am saying is that the designer proposed by ID (as per the FAQ on this site) does not have any limitations, and therefore must be all-powerful and can achieve anything possible. Such a designer is not just "unpredictable"; rather, it is maximally unpredictable because it explains any phenomenon or measurement whatsoever.

However, anthropology is a science. They infer intelligence when they see things like writing on cave walls. ID isn’t rooted in physics. But it does make inferences just like an anthropologist might.

No, ID does not make inferences like anthropologists because anthropologists place limits on the intelligent agent they propose to explain phenomena: they have particular requirements, they only exist at particular times and places, they have particular abilities, tools and technologies that strictly limit their ability to manipulate their environment etc.

A designer might be able to explain anything, but nobody is saying that a designer should be invoked “ALL THE TIME” instead we are saying that maybe sometimes in certain specific cases (where we see FSI) design should be considered. Which to me seems more moderate. “Sometimes design” rather than “never design”.

It doesn't matter who is saying what. What matters is that logically the concept of the designer itself, as you acknowledge, is capable of explaining anything, and thus it cannot be scientifically tested. It may be a true concept, but it's not very useful and not scientific. CLAVDIVS

Chris Doyle @ 25

Basically, you’re not really interested in design. You’re only interested in the designer, because if that designer is God, then you can start moaning endlessly about religion… rather than focusing on the science of Intelligent Design. If you ever had to do that, you’d have to kiss good-bye the one thing that you’ve put your faith in (a very silly thing to put your faith in): Chance.

What I have been pointing out on this thread, is that if ID does not place any limitations on the proposed intelligent designer, then it logically follows that the proposed designer has no limits on its power i.e. can achieve anything possible. That this happens to coincide with some concepts of deity is neither here nor there. However, it matters because it means that ID, in its current form, cannot be scientifically tested, because something that has no limits can be used to explain *anything at all*. It cannot tell us why things are like X, and not like Y, because it equally explains both X and Y. In short, it's neither scientific nor particularly useful. CLAVDIVS

Mark Frank (25): All right, in light of your intervention, and in the interest of non-polemical dialogue with Elizabeth, I'll withdraw the unnecessarily aggressive phrase "insincerity or self-delusion." Let me put the words to Elizabeth differently: "This comment appears to imply that Darwinists have methods for design detection that apply to organic as well as inorganic things, but there is no obvious evidence for the existence of such methods in the Darwinian literature." OK, now I will reply to your further comments. Obviously the people on your side *do* think there is something different about the case of living organisms than the case of inanimate objects, e.g. Stonehenge, arrowheads, clocks, etc., since they completely *agree* with ID people about the inanimate objects and completely *disagree* with ID people *in every single case* when it comes to living organisms or systems. How could this neat division happen, if your side did not believe that a different (and apparently much higher) standard applies to inferences of design in the case of organic things which appear designed, than in the case of inorganic things which appear designed? Note also that it is not always the case that a hypothesis about the designer is necessary in order to successfully infer design. I can imagine all kinds of situations in which I could place you in which, confronted with some inorganic object, say, a stone sculpture or contraption of some kind, you would unhesitatingly infer that the object was designed even if you knew nothing about who might have designed it. If I transported you to Mars tomorrow and you found an anemometer there, made of an unknown metallic alloy never manufactured on earth, you would infer both from the material and from the function that the anemometer was designed, without having a clue who put it there, or why. But, if confronted with a living thing a billion times more complex than an anemometer, a thing which even Dawkins would say strongly exhibits *apparent* design -- say, the first bacterium on the planet earth -- you would not make such a design inference, would you? You would cast about for explanations for how such a thing might have come about *without* design, would you not? You would in fact *prefer* a non-design explanation, no? And if so, then how can you say that the design detection process is "no different" in the case of inorganic objects, contraptions, etc. than in the case of living systems? Timaeus

You answered your own question, Mark: "Why this continuing refrain from so many ID supporters that any opponent is either insincere or self-deluded?" Because our opponents repeatedly submit nonsense like this: "But it does require some kind of hypothesis (however vague) about the designer and/or design mechanism so that it can be assessed." Basically, you're not really interested in design. You're only interested in the designer, because if that designer is God, then you can start moaning endlessly about religion... rather than focusing on the science of Intelligent Design. If you ever had to do that, you'd have to kiss good-bye the one thing that you've put your faith in (a very silly thing to put your faith in): Chance. Chris Doyle

Why this continuing refrain from so many ID supporters that any opponent is either insincere or self-deluded? This is no basis for a productive debate. There are real, intelligent, sincere arguments to be made by both sides. Detecting design in a living organism is no different from detecting design in any other instance. But it does require some kind of hypothesis (however vague) about the designer and/or design mechanism so that it can be assessed. Mark Frank

Elizabeth wrote: "Just because our methods don’t detect design where you detect it, KF, doesn’t mean we don’t have methods that detect design." This comment springs from either insincerity or self-delusion. "Our methods" -- as Elizabeth means the phrase -- can of course detect design if the object is a radio or a coded message or a pyramid in the sands of Egypt. The Darwinists will gladly grant that we can know for a fact that all these things were designed, and not merely the product of chance and natural laws. But there is not a living, breathing soul on her side who has ever proposed a method for determining whether or not *a living system* or *a living organism* is designed. Or is even interested in investigating that question. And it is design *in living systems* that the debate is about, not design in computers or Stonehenge. The *working expectation* of everyone on her side, including Elizabeth herself (if she is entirely frank) is that *all* cases of apparent design will, in the long run, turn to be just that -- cases of *apparent* design only. So why would her side ever try to develop methods of design detection for *natural* objects and systems? (Why would you develop possible designs for a perpetual motion machine, if your working expectation was that one could never be made?) Maybe Elizabeth will show us some of the methods of design detection that the Darwinian side has devised? And let us know who devised them? Mayr, perhaps? Or Crick? Or Monod? Or Coyne? Or Moran? It would all be news to us. Timaeus

CLAVDIVS “The problem is that there are no limitations proposed for the intelligent designer, so the intelligent designer can be assumed to be all-powerful and can therefore “predict” or “explain” anything” Okay I see where you are coming from. A physical theory like relativity can be formulated mathematically, gravity can be expressed mathematically and we can calculate an orbit with those types of things. A designer doesn’t count because he doesn’t fit into that type of box. Is this a correct interpretation of what you are saying? I’m going to assume it is and continue feel free to correct me though. Intelligence for sure isn’t going to be that predicable. It isn’t the same type of thing. (Which is one reason why it is powerful as an explanation. It is has all the things previous attempts to explain life don’t.) However, anthropology is a science. They infer intelligence when they see things like writing on cave walls. ID isn’t rooted in physics. But it does make inferences just like an anthropologist might. A designer might be able to explain anything, but nobody is saying that a designer should be invoked “ALL THE TIME” instead we are saying that maybe sometimes in certain specific cases (where we see FSI) design should be considered. Which to me seems more moderate. “Sometimes design” rather than “never design”. TJ

It's good to know that I (at least indirectly) taught Elizabeth something, even if she doesn't here acknowledge it. A couple of years ago we debated here, and I mentioned teleology in evolution, thinking the term would be unproblematic for anyone who had a basic knowledge of the historical roots of evolutionary theory or even of "design versus chance" arguments today. Elizabeth, though she spoke very confidently about evolutionary theory, evolutionary mechanisms, etc. didn't know what I meant by "teleology," and asked me if it was the same as "teleonomy." I was quite surprised that anyone would show such confidence in discussing Darwinian evolutionary concepts without being familiar with the concept of teleology (which of course Darwin was deliberately and systematically opposing). Be that as it may, a discussion ensued. Now I see (#9 above) that she is referring confidently to teleology in compact references, as if she is an old hand at the subject: "Methods that distinguish between teleology and teleonomy." Well, it would be nice to get an acknowledgment that, if not my own explanation, at least some subsequent reading Elizabeth did as a result of conversing with me, is the cause of her now being able to toss off a word she didn't know the meaning of before. :-) Timaeus

TJ @ 17

CLAVDIVS: “Infer design” is not a testable explanation. It is simply an assertion that there is some sort of explanation, which is not defined enough for testing, that involves an intelligent agent. TJ: It is testable in that it can make predictions and those predictions can be falsified or corroborated. The results of that process can then be compared with other explanations for the same phenomenon.

The problem is that there are no limitations proposed for the intelligent designer, so the intelligent designer can be assumed to be all-powerful and can therefore "predict" or "explain" anything. As I said @ 15: The sorts of explanation that can be scientifically tested involve a general rule, and a logical argument showing how phenomena follow from that rule e.g. Jupiter’s orbit follows from Newton’s law of gravitation. An explanation that is so general that literally anything follows from it, like ID, cannot be tested, because no matter what we observe or measure it can be said to follow from the explanation. Hence such an explanation really doesn't explain anything at all, because it doesn't tell us why things work this way rather than that way. Instead, it operates like a version of the sharpshooter fallacy, drawing bullseyes around bullet-holes - no matter where we find a bullet-hole, ID can draw a bullseye around it, because the proposed intelligent designer has no limitations. And that's why ID is not regarded as science. CLAVDIVS

Lizzie, In response to what you said in 3. It is because that is the argument that many of the Darwinist's I talk to make, unfortunately. TJ

Yes, it's like the inference of the product of 2 + 2 being 4. Axel

ENCODE anyone? Prediction FULFILLED! trying not to gloat and failing. TJ

Clavdivs: "“Infer design” is not a testable explanation. It is simply an assertion that there is some sort of explanation, which is not defined enough for testing, that involves an intelligent agent." It is testable in that it can make predictions and those predictions can be falsified or corroborated. The results of that process can then be compared with other explanations for the same phenomenon. TJ

wookieeb @ 14

CLAVDIVS: See, lots of testable explanations about when, where, who and how. That makes such an investigation scientific. wookieeb: Of course. For biology, both ID and Neo-Darwinian theories are concerned with this, perhaps with the exception of “who”. ND doesn’t think there is a “who”, and ID does think there is a “who” but isn’t concerned with identifying it.

OK, putting aside the "who", tell me about the when, where and how proposed by ID? Unless ID places some limitations on the nature of the proposed intelligent designer, we must assume the intelligent designer is all-powerful and can achieve anything possible. This is not a testable explanation, because any given measurement or observation can be "explained" by saying that's just the way the all-powerful intelligent designer wanted it. Whilst this may be true, it's not a testable explanation. CLAVDIVS

Joe @ 12

CLAVDIVS: ID as defined on this site does not propose any testable explanations for any features of the universe and life. Joe: Yes, we do. If nature, operating freely can produce it, we do not infer design. And if nature, operating freely cannot produce it and it meets the design criteria, we infer design.

"Infer design" is not a testable explanation. It is simply an assertion that there is some sort of explanation, which is not defined enough for testing, that involves an intelligent agent. The sorts of explanation that can be scientifically tested involve a general rule, and a logical argument showing how phenomena follow from that rule e.g. Jupiter's orbit follows from Newton's law of gravitation. Checking whether phenomena follow the rule or not is what is meant by scientific testing. If a rule is so general that all possible phenomena follow from it, then the rule can't be tested and it doesn't explain anything. Therefore, the idea that life on earth was created by - for example - an all-powerful, intelligent genie means that any given phenomenon follows from this rule by explaining that's just the way the genie wanted it. So that's not a testable explanation of anything. Accordingly, unless the ID movement explicitly rules out an all-powerful intelligence as part of its explanation (i.e. by specifying some limiting characteristics on the intelligent agent as to time, space, etc.) then the idea of ID will remain unscientific. CLAVDIVS

CLAVDIVS:

- They are connected with Nazi symbolism. Test: Determine age of trees to see if they precede Nazism, or come after. - The trees were planted by humans. Test: Find independent evidence humans were around the area at the time of planting. - Deliberate transplanting of different species to make a pattern. Test: Is the species that makes the pattern local to the area? Is that species typically found to cluster together closely, or are they rather widespread?

In each of your examples, you are pre-supposing design and then testing against it, providing a method to falsify design. But your tests don't lead to a design inference, you've already done that before you started.

See, lots of testable explanations about when, where, who and how. That makes such an investigation scientific.

Of course. For biology, both ID and Neo-Darwinian theories are concerned with this, perhaps with the exception of "who". ND doesn't think there is a "who", and ID does think there is a "who" but isn't concerned with identifying it.

ID as defined on this site does not propose any testable explanations for any features of the universe and life. It just asserts that there’s an explanation involving an intelligent agent, but does not vouchsafe what the explanation actually is, let alone propose any tests. There’s nothing wrong with that, but it’s not science.

Nonsense! Even if you start from the point of pre-supposing design, the tests to falsify it are there, it is the work biologists are doing. Suppose ID - is there any other process (like Neo-Darwinism) that can demonstrate how complex life developed? Suppose ID - does the fossil record support any other process (like Neo-Darwinism)? Suppose ID - within information theory, is there any other process (like Neo-Darwinism) that can explain the CSI we see in biology? Etc.. Now there is debate on the answers to those questions (I would say "No" to all), but you cannot say that there are no tests to ID. wookieeb

- They are connected with Nazi symbolism. Test: Determine age of trees to see if they precede Nazism, or come after.

The swastika was adopted by the Nazis.

- The trees were planted by humans. Test: Find independent evidence humans were around the area at the time of planting.

Humans being around doesn't mean humans planted them. Or do you think all trees were planted by humans?

- Deliberate transplanting of different species to make a pattern. Test: Is the species that makes the pattern local to the area? Is that species typically found to cluster together closely, or are they rather widespread?

Birds and other animals carry seeds and can deposit them where the plants are not. Joe

CLAVDIVS:

ID as defined on this site does not propose any testable explanations for any features of the universe and life.

Yes, we do. If nature, operating freely can produce it, we do not infer design. And if nature, operating freely cannot produce it and it meets the design criteria, we infer design. Joe

Notice how we can generate testable hypotheses about the origin of the swastikas: - They are connected with Nazi symbolism. Test: Determine age of trees to see if they precede Nazism, or come after. - The trees were planted by humans. Test: Find independent evidence humans were around the area at the time of planting. - Deliberate transplanting of different species to make a pattern. Test: Is the species that makes the pattern local to the area? Is that species typically found to cluster together closely, or are they rather widespread? - Etc. See, lots of testable explanations about when, where, who and how. That makes such an investigation scientific. ID as defined on this site does not propose any testable explanations for any features of the universe and life. It just asserts that there's an explanation involving an intelligent agent, but does not vouchsafe what the explanation actually is, let alone propose any tests. There's nothing wrong with that, but it's not science. CLAVDIVS

So you don't have any idea- why don't you just say that? Joe

Methods that distinguish between teleology and teleonomy. Elizabeth B Liddle

Elizabeth:

Just because our methods don’t detect design where you detect it, KF, doesn’t mean we don’t have methods that detect design.

What methods do you use? Please do tell.

We just think that your method generates false positives, or, at least, dubious positives.

Think whatever you want. You definitely cannot demonstrate that our methods generate false positives nor dubious positives. And that means what you say is meaningless. Joe

Just because our methods don't detect design where you detect it, KF, doesn't mean we don't have methods that detect design. We just think that your method generates false positives, or, at least, dubious positives. Elizabeth B Liddle

Elizabeth:

I have no idea why ID proponents have this weird idea that “Darwinists” think that design can’t be detected.

LoL! Just look at this debate and you have your answer, duh. Joe

Okay, double-denial. The very ones who have expended tons of bits in and around UD denying the ability to reliably detect design on empirically tested reliable signs now show up to pretend or suggest otherwise. Priceless. KF kairosfocus

Lizzie,

I have no idea why ID proponents have this weird idea that “Darwinists” think that design can’t be detected.

It's strange, isn't it? keiths

I have no idea why ID proponents have this weird idea that "Darwinists" think that design can't be detected. Of course it can. Elizabeth B Liddle

Oh no, no, no, kairosfocus. THat's too much like teleology. It's not intentional. It's all a big load of Darwin. (O'Leary) News

News: Did seeds blowing in the wind just accidentally fall into the shape of glyphs that illustrate swastikas and/or spell out the number 1933, in Germany? In short, we can see from the explanatory filter that lucky noise is not a credible explanation. We infer that twerdun. Now, whodunit? Let's see the news account you clip, on fair use:

Reschke chartered a plane to fly over the area, and indeed, a neatly delineated swastika was clearly visible. The local forester, Klaus Göricke, set out to uncover the origin of the troubling larch formation, and he found out that the trees had been there for a long time. By measuring the trees, he came to the conclusion they had been planted in the late 1930s. That means that for decades, during every spring and autumn, a massive swastika took shape in the Kutzerower Heath -- surviving the Russian occupation, Communist rule in East Germany and the fall of the Berlin Wall without ever attracting notice. The fact that it went undiscovered for so long was in part due to the short period of time each year that it was visible. Furthermore, it could only be seen from a certain altitude, and the airplanes that headed north out of Berlin were already much too high for passengers to see the swastika in the forest. Private planes, on the other hand, were forbidden in East Germany.

Now, clue the explanatory filter deniers in 4, 3, 2, 1 . . . KF kairosfocus