Evolution: Education and Outreach is usually a disappointment. The journal could do with more philosophically savvy writers and more critical reviewers. The various contributions provide very little evidence that they understand Kuhn’s thesis about the way science develops. Most of the authors are working in a silo and fail to understand anyone who operates outside their tightly defined paradigm. A notable exception was Daniel R. Brooks (2011) who wrote on “The Extended Synthesis: Something Old, Something New” (blogged here). Another is the theme of this blog: a review of Alan Feduccia’s “Riddle of the Feathered Dragons” by Egbert Giles Leigh Jr. What caught my eye was the acknowledgement that Feduccia provides a “powerful criticism of prevailing views of bird evolution”. Leigh explains that he is relatively new to this theme, and he appears shocked to find out what an intense battlefield he was entering.
“I was blissfully unaware of the raging dispute over just what group of reptiles gave rise to birds. The introduction, which opens with bitter comments on uncritical media hype about dinosaur ‘discoveries’, and the first chapter, subtitled ‘Blame to Go Around’, cured me rather brutally of that ignorance.” (p.1)
Leigh summarises the arguments of John Ostrom, who championed the thesis that birds evolved from theropod dinosaurs. He knew that dinosaurs like Deinonychus had many similarities with Archaeopteryx, and he promoted the idea that flight evolved ground up. The ancestors of birds were considered to be runners, flapping their forelimbs to catch insects, thereby evolving the functionality for flapping flight. Leigh reports Feduccia’s objections to Ostrom, obviously impressed by his arguments, and noting that “More recently, the tide of evidence has turned strongly against Ostrom’s case.” Part of this evidence relates to protofeathers, and Leigh is positive about the case for them being collagen fibres. (For further on this, go here and here.)
“The discovery that the ‘protofeathers’ of the bipedal, cursorial theropod Sinosauropteryx were collagen fibers representing various stages of skin decay (Lingham-Soliar et al. 2007) undermined the argument that feathers evolved for purposes other than flight. If Anchiornis and Archaeopteryx were ancestral birds, it would appear that that feathers, which Feduccia shows to be complex, intricate structures well adapted for flight, evolved for that purpose. Feathered wings did not first evolve to be clapped together to catch insects, as Ostrom (1974, 1979) had proposed.” (p.2)
The reason why this is important relates to the major point being made by Leigh: “The argument between Feduccia and Ostrom was later engulfed by a methodological one.” This methodological issue concerns cladism. Rarely does one read words like this:
“This method seemed to lend an objective rigor to inferring phylogenies from phenotypic data. Many practitioners of this method proclaim that birds derive from theropod dinosaurs.” (p.2)
What follows is one of the best concise critiques of cladism that I have read. It deserves to be quoted in full, but this seems unwise – especially as the review is Open Access. The issue of protofeathers is located at the beginning of the critique. If they are interpreted as primitive feathers, they constrain the cladistic analysis towards the theropod-bird evolutionary pathway. If however they represent collagen fibres released during skin decay, the outcome is quite different. Leigh sees this as an example of scientists craving for an objectivity that brings authority, latching on to a method that seems to offer this, and losing sight of other data that disturbs their conclusions.
“More generally, the search for the one objective scientific method, where subjective judgments play no role, is a recipe for ignoring what is crucial. So it was for the psychologists who saw stimulus-response analyses as the way to make animal behavior an objective science by avoiding the subjective world of consciousness. As Changeux (1985, p. 97) remarked, ‘Concerned with eliminating subjectivity from scientific observation, behaviorism restricted itself to considering the relationship between variations in the environment (the stimulus) and the motor response that was provoked’. This approach does not let us see that animals have intentions and project their hypotheses onto the external world (Changeux and Ricoeur 2000, p. 42). Is this also true of those cladists who see a particular algorithm for inferring phylogenies from phenotypic data as the one way to practice objective taxonomy? Such methods demand that their practitioners ignore those kinds of data that their methods cannot handle. Indeed, as in the case of scientific Marxism, supposed recipes for objectivity can become dogmas defended with religious zeal (Polanyi 1962, pp. 227-228). Feduccia (p. 2) cites instances of this process among some cladists. This process can discourage interesting science, as did the Roman inquisition of the 17th century (Changeux and Ricoeur 2000, p. 35). Feyerabend’s (1975) Against Method is a salutary warning against seeking one scientific method, apt for solving all problems.” (p.3)
In his concluding words, Leigh points to the BAD advocates (Birds Are Dinosaurs) as “intellectual prisoners of their cladistic methodology”. Although he represents the minority BAND (Birds Are Not Dinosaurs), and although the controversy is draining, Feduccia is presented as the champion of authentic science.
“[H]is book is eloquent testimony to the role of connoisseurship in effective science. For all its bitterness, Feduccia’s is a liberating voice, a reminder that methodology should be our servant, not our unquestioned master.” (p.3)
It’s a great review and it deserves to be widely read. This is not just a controversy over dino-fuzz – it has the potential to stimulate thinking about the way science is practised.
Alan Feduccia’s Riddle of the Feathered Dragons: what reptiles gave rise to birds?
Egbert Giles Leigh Jr
Evolution: Education and Outreach, March 2014, 7:9, (3 pages)
This book’s author is at home in the paleontology, anatomy, physiology, and behavior of birds. Who could be more qualified to write on their origin and evolution? This book is unusually, indeed wonderfully, well and clearly illustrated: its producers cannot be praised too highly. It is well worth the while of anyone interested in bird evolution to read it. [snip]
There are lots of paleontologists who meet this description, and almost all of them disagree with Alan Feduccia. He is a good example of what happens if an otherwise good scientist fails to recognise the moment when his favourite hypothesis can’t be reconciled with new data and had better be abandoned. He’d rather continue digging than leave his precious hole.
Recently, he has begun to reduce his position ad absurdum, reinterpreting feathered theropods as “cryptic birds”. One day, perhaps, he’ll take the next logical step and declare all dinosaurs to be stem avians. If so, his BAND hypothesis will finally converge with the mainstream view (and he will have rediscovered the wheel).
But make no mistake: although Feduccia doesn’t believe that birds are dinosaurs, he believes that birds are “thecodonts”, closely related to dinosaurs.
The ancestors of birds were considered to be runners, flapping their forelimbs to catch insects, thereby evolving the functionality for flapping flight.
Let me get this straight: an animal (or a human, presumably) flapping their arms long enough and hard enough will eventually, through natural selection acting on random mutations (beneficial mutations, no doubt), evolve wings?
Let me get this straight: an animal (or a human, presumably) flapping their arms long enough and hard enough will eventually, through natural selection acting on random mutations (beneficial mutations, no doubt), evolve wings?
No.
darn. i better stop then.
maybe i’ll just try being good. then i can get some angel’s wings.
@Barb: I’ve been fapping at least 3 times a day. My biceps got stronger… I haven’t developed any wings, though.
Ostrom wasn’t right about every detail (and little wonder, considering that he had very scanty data at his disposal), but the core of his hypothesis remains correct: birds are a group nested within Theropoda. Wings are an example of exaptation: feathers developed before flight. They played other functions originally (and, by the way, still play them in modern birds). Flight was not the purpose of bird evolution; it became a fortuitous possibility for some small dinosaurs, and long pennaceous feathers were co-opted to generate aerodynamic lift and thrust.
wd400 @3: That seems to be the implication.
Barb @7:
Adaptations don’t happen because you need them. They have to be physically possible, and they are constrained by the random occurrence of mutations. No matter how heroically you flap your arms, your DNA won’t be affected, and no effect of your flapping will be passed along to your offspring.
Piotr writes,
If adaptations don’t happen because an organism needs them, then how does that organism survive and reproduce, which is the entire point of evolution?
Feathers aren’t the only requirement for flying. Practically every part of a bird is designed for flight. Birds have light, hollow bones as well as an unusually efficient respiratory system and specialized muscles to flap and control its wings. It even has a number of muscles to control the position of individual feathers. And it has nerves that connect each muscle to the bird’s tiny but amazing brain, which is preprogrammed to control all these systems simultaneously, automatically, and precisely. The whole package–not just feathers–is necessary for flight.
Oh, and every bird develops from a tiny cell that contains the complete instructions for its growth and instincts, so that one day it can take to the sky. And evolution teaches that all this arose from a long string of advantageous accidents.
stupid things evolutionists believe
Because it’s already the descendant of billions of ancestral generations, every single one of them fit enough to leave offspring. If it happens to be additionally the lucky carrier of an innate feature conferring a slight adaptive advantage, it has a slightly better chance of producing offspring with a similar slight advantage.
Many of these features were already present in flightless theropods. They were originally adaptations to something else (skin insulation, fast metabolism, tree-climbing, chasing smaller prey, scurrying away from larger predators). They made parachuting, gliding or flapping flights possible, and then selection began to favour any changes improving flight.
Yes, more or less.
“then selection began to favour any changes improving flight”
translation into common sense English:
“Just add imagination and you get wings”
BA77
Once you can fly and your reproductive success depends on it, it pays to do it better: the development of efficient flight accelerates, and adaptive evolution gives it a clear direction. We can see the effects very well in the fossil record.
Piotr, I hate to burst you bubble since you seem to have so much of your heart invested in believing these just so stories you spout, but as far as empirical evidence itself is concerned, Natural Selection has been undermined as having the causal adequacy that neo-Darwinists have attributed to it. First off, to the extent that Natural Selection does do anything, Natural Selection is found to be a eliminative force not a generative force:
“…but Natural Selection reduces genetic information and we know this from all the Genetic Population studies that we have…”
Maciej Marian Giertych – Population Geneticist – member of the European Parliament – EXPELLED – Natural Selection And Genetic Mutations – video
https://www.youtube.com/watch?v=6z5-15wk1Zk
From a Frog to a Prince – video (17:00 minute mark Natural Selection Reduces Genetic Information) – No Beneficial Mutations – Gitt – Spetner – Denton – video
https://www.youtube.com/watch?v=ClleN8ysimg&feature=player_detailpage#t=1031
“A Dutch zoologist, J.J. Duyvene de Wit, clearly demonstrated that the process of speciation (such as the appearance of many varieties of dogs and cats) is inevitably bound up with genetic depletion as a result of natural selection. When this scientifically established fact is applied to the question of whether man could have evolved from ape-like animals,’.. the transformist concept of progressive evolution is pierced in its very vitals.’ The reason for this, J.J. Duyvene de Wit went on to explain, is that the whole process of evolution from animal to man ” ‘ . . would have to run against the gradient of genetic depletion. That is to say, . . man )should possess] a smaller gene-potential than his animal ancestors! [I] Here, the impressive absurdity becomes clear in which the transformist doctrine [the theory of evolution] entangles itself when, in flat contradiction to the factual scientific evidence, it dogmatically asserts that man has evolved from the animal kingdom!” —Op. cit., pp. 129-130. [Italics his; quotations from *J.J. Duyvene de Wit, A New Critique of the Transformist Principle in Evolutionary Biology (1965), p. 56,57.]
http://www.godrules.net/evolut.....vlch15.htm
“We found an enormous amount of diversity within and between the African populations, and we found much less diversity in non-African populations,” Tishkoff told attendees today (Jan. 22) at the annual meeting of the American Association for the Advancement of Science in Anaheim. “Only a small subset of the diversity in Africa is found in Europe and the Middle East, and an even narrower set is found in American Indians.”
Tishkoff; Andrew Clark, Penn State; Kenneth Kidd, Yale University; Giovanni Destro-Bisol, University “La Sapienza,” Rome, and Himla Soodyall and Trefor Jenkins, WITS University, South Africa, looked at three locations on DNA samples from 13 to 18 populations in Africa and 30 to 45 populations in the remainder of the world.-
As well, Natural Selection is grossly inadequate to do the work required of it because of what is termed ‘the princess and the pea’ paradox. The devastating ‘princess and the pea’ paradox is clearly elucidated by Dr. John Sanford, at the 8:14 minute mark, of this following video,,,
Genetic Entropy – Dr. John Sanford – Evolution vs. Reality – video
http://vimeo.com/35088933
Dr. Sanford points out, in the preceding video, that Natural Selection acts at the coarse level of the entire organism (phenotype) and yet the vast majority of mutations have effects that are only ‘slightly detrimental’, and have no noticeable effect on phenotypes, and are thus far below the power of Natural Selection to remove from genomes before they spread throughout the population.
“Selection Threshold Severely Constrains Capture of Beneficial Mutations” – John Sanford – September 6, 2013
Excerpt of concluding comments: Our findings raise a very interesting theoretical problem — in a large genome, how do the millions of low-impact (yet functional) nucleotides arise? It is universally agreed that selection works very well for high-impact mutations. However, unless some new and as yet undiscovered process is operating in nature, there should be selection breakdown for the great majority of mutations that have small impact on fitness.,,,
We show that selection breakdown is not just a simple function of population size, but is seriously impacted by other factors, especially selection interference. We are convinced that our formulation and methodology (i.e., genetic accounting) provide the most biologically-realistic analysis of selection breakdown to date.
http://www.worldscientific.com.....08728_0011
Here are a few more notes on this insurmountable ‘princess and the pea’ problem for natural selection:
Evolution vs. Genetic Entropy – Andy McIntosh – video
https://vimeo.com/91162565
The GS Principle (The Genetic Selection Principle) – Abel – 2009
Excerpt: The GS Principle, sometimes called “The 2nd Law of Biology,” states that selection must occur at the molecular/genetic level, not just at the fittest phenotypic/organismic level, to produce and explain life.,,, Natural selection cannot operate at the genetic level.
http://www.bioscience.org/2009.....lltext.htm
Moreover, as if that were not devastating enough as to undermining any credibility Natural Selection might have had as to having the causal adequacy to explain the highly integrated levels of overlapping functional information found in organisms, dimensionally speaking, Natural Selection is now known to not even be on the right playing field in the first place:
The predominance of quarter-power (4-D) scaling in biology
Excerpt: Many fundamental characteristics of organisms scale
with body size as power laws of the form:
Y = Yo M^b,
where Y is some characteristic such as metabolic rate, stride length or life span, Yo is a normalization constant, M is body mass and b is the allometric scaling exponent.
A longstanding puzzle in biology is why the exponent b is usually some simple multiple of 1/4 (4-Dimensional scaling) rather than a multiple of 1/3, as would be expected from Euclidean (3-Dimensional) scaling.
http://www.nceas.ucsb.edu/~dre.....18_257.pdf
“Although living things occupy a three-dimensional space, their internal physiology and anatomy operate as if they were four-dimensional. Quarter-power scaling laws are perhaps as universal and as uniquely biological as the biochemical pathways of metabolism, the structure and function of the genetic code and the process of natural selection.,,, The conclusion here is inescapable, that the driving force for these invariant scaling laws cannot have been natural selection.” Jerry Fodor and Massimo Piatelli-Palmarini, What Darwin Got Wrong (London: Profile Books, 2010), p. 78-79
Here is, what a Darwinist termed, a ‘horrendously complex’ metabolic pathway (which operates as if it were ’4-Dimensional):
ExPASy – Biochemical Pathways – interactive schematic
http://web.expasy.org/cgi-bin/.....mbnails.pl
And remember, Darwinian evolution has yet to explain a single gene of those ‘horrendously complex’ metabolic pathways.
“Charles Darwin said (paraphrase), ‘If anyone could find anything that could not be had through a number of slight, successive, modifications, my theory would absolutely break down.’ Well that condition has been met time and time again. Basically every gene, every protein fold. There is nothing of significance that we can show that can be had in a gradualist way. It’s a mirage. None of it happens that way.
– Doug Axe PhD. – Nothing In Molecular Biology Is Gradual – video
http://www.metacafe.com/watch/5347797/
The reason why a ‘higher dimensional’ 4-Dimensional structure, such as a ‘horrendously complex metabolic pathway, would be, for all intents and purposes, completely invisible to a 3-Dimensional process, such as Natural Selection, is best illustrated by ‘flatland’:
Flatland – 3D to 4D shift – Dr. Quantum – video
http://www.youtube.com/watch?v=BWyTxCsIXE4
I personally hold that the reason why internal physiology and anatomy operate as if they were four-dimensional instead of three dimensional is because of exactly what Darwinian evolution has consistently failed to explain the origination of. i.e. functional information. ‘Higher dimensional’ information, which is bursting at the seams in life, simply cannot be reduced to any 3-dimensional energy-matter basis:
John Lennox – Is There Evidence of Something Beyond Nature? (Semiotic Information) – video
http://www.youtube.com/watch?v=F6rd4HEdffw
That’s the funniest thing I’ve read all day!
Piotr says authoritatively:
I see. The core of his hypothesis remains correct.
My question is this: “How do you really know?”
The flapping after insects idea and airbourne seems very unlikely. Did bats come this way too?
I think they are guessing but get to say its science because of a degree on the wall.
By the way. Studying bones and making conclusions about relationships is alsi just guessing. its not biological scientific investigation what so ever.
Piotr @ 8.
You confidently say that flapping your arms won’t pass on anything to your offspring yet we know that through mechanism Darwinian evolution cannot really account for that epigenetic control and imprinting mean that things can be “written” into DNA and passed on.
For example it has been shown fear of particular events (eg a smell associated with pain) means that offspring can fear that smell even though they never experienced the pain association.
so you confidently say something here which in principle has actually been disproven. Things that happen to us/experiences can in fact be passed on. Amazing how complex “evolution” is isn’t it…
Prokaryotes do not have arms.
Therefore flapping arms confers no selective advantage.
If flapping arms conferred a selective advantage, even prokaryotes would have wings.
Q. E. D.
Next to the development of the eye, the fabulous accounts of how lizards first took flight are some of the most strained, forced accounts that I hear from the Darwinians. Yet, those of us who doubt this “power” of evolution are the deniers? What kind of mixed up, crazy world do we live in??
Imprinting doesn’t “write” anything into the DNA sequence, and the effects of DNA methylation or histone modification don’t last longer than a few generations. You can neither cause nor fix an adaptive mutation in this way.
Lizards? Why not snakes or turtles?
podcast – Tom Woodward and Stephen Meyer on the Cambrian Explosion”
http://intelligentdesign.podom.....3_15-07_00
Piotr,
I am impressed that you take such a non-evidenced based approach to your science. Few would be so willing to admit that.
So what do you reckon happened first-the vertebrate bones fused first, or they flew without fused bones, and then got that after a few million generations?
Are fused vertebrates a pretty common random mutation? What about hollow bones, do they happen with regular frequency in animals just sporadically and accidentally ?
More just lucky mutations Piotr? These are pretty common results of damaged copies of DNA, that just so happen to be useful?
There’s no need to speculate; we’ve got the fossils. Can you take a look at them on your own, or do you need a guide?
Poitr wrote:
There’s no need to speculate; we’ve got the fossils…
No fossilized one way flowing lung system to date, that I’ve heard of? If even one of these could have been preserved it could hardly provide insight into the how of its development unless perhaps you had many, spanning the changes in detail, preferably of a single or very closely related species, and following the ‘evolutionary transformations’ of the lung system in minutiae. Well perhaps not even then.
In detail, how does one get the fine grained re-arrangements of the tissues and cells, in a low metabolic rated reptilian, to a high metabolic rated avian? Specifically the unique ‘double bellow’ like structure Phoodoo’s post mentions?
At what point does an ‘evolving’ creature with reptilian like lungs, acquire some kind of ‘proto’ anterior and posterior air sack, connected to these archaic lungs {not to mention the other changes to the plumbing of which flow direction is but one perhaps}? Something that is selectable without compromising the health of the creature, before any workable arrangement is achieved. This has to segue into it’s proposed evolution into actual flight of course. Carrying around preformed airsacks connected to an old style reptilian lung, without the as yet avian modifications to it, suggests a very long term {and in evolution we are talking in very, very long terms time wise} sub par performance. Even if these other changes are separated time wise {and how could they be conveniently so?}, how much stress can the organism withstand? The intense bone, cartilage, and muscle mass changes, that are involved in the keel like chest structure, must also be initiated at some point … and all that flapping it required?
Some seem to insist that a very minimal process of incredibly small changes can achieve this, as opposed to say for example, gene manipulation in the developmental stages of a fruit fly and the non functioning 4 winged like results sometimes produced? There appears to be a large disconnect between evolutionary claims and an actual workable explanation in detail, or any experimental demonstration of this. Biological systems have very stringent engineering requirements inflicted upon them, by universal laws do they not? To suggest unguided restructuring by some natural process, requires that some revelation as to the detailed steps be demonstrated? If not, then it would be speculation only.
So what are those workable detailed steps that have caused a natural engineering of the unique avian lung system, or its powerful and purposefully adapted skeletal and muscle structure allowing flight? The fossil record is not providing or demonstrating any process in detail at all. It is just a record of certain shapes and some structure. Saying mutation worked upon by natural selection is like saying people build houses with bricks and wood and some other stuff, with a hammer etc etc.
Sure we have fossils but without supporting genetic evidence the fossils don’t say anything that you don’t already believe.
willh:
There is ampole evidence of postcranial skeletal pneumaticity in dinosaurs, especially Saurischia (the group containing birds, but also non-avian theropods and sauropodomorphs). For example, sauropods (such as diplodocids and titanosaurs), which certainly couldn’t fly, had pneumatic vertebra and a system of air sacks and diverticulae. Far from causing any stress to them, the system offered thermoregulatory and respiratory advantages, and the added bonus of reducing body density. The extreme elongation of necks and tails in neosauropods would not have been possible without it.
As for non-avian theropods, see this link.
So, to return to phoodoo’s question, pneumatic bones and airsacks are phylogenetically older than birds and did not develop as an adaptation for flight. However, their presence in small feathered theropods was one of the features that enabled them to fly.
Who said dinosaurs (and more especially theropods) had a low metabolism? The size of cells in theropods, estimated from the size of their preserved osteocytes, was small — a feature that correlates with high metabolic levels in some groups of vertebrates (for reasons such as a higher surface-to-volume ration in blood cells).
I can’t, and therefore I won’t, give you a full account of anatomical and physiological developments in long-extinct animals. But phoodoo’s question (also the remaining ones, about fused bones, finger and tail reductions, etc.), can be answered on the basis of the fossil record alone. Many (perhaps most) of the “typically avian” features were already present in their ancestors before the development of flight.
Self-correction: “ration” => ratio, etc. Sorry for any such errors — I’m a messy typer.
LOL. Yes, once upon a time, a genetic miracle occurred, and feathers appeared on a confused reptile.
Later, while trying to catch an insect with its claws rather than its mouth or tongue, it accidentally found itself airborne. Landing, however, was another matter. Actually, “plummet” is a more descriptive term. Many of these reptiles plunged into soft, deep mudflats where, under the anaerobic conditions, they quickly became fossilized.
Complete fantasy.
-Q
Piotr,
Please. Did you not even understand the question? I asked you if these types of changes are what we can see when we have sporadic dna mutational copying errors.
Yes, of course we know these systems developed, they exist! Is someone arguing that these systems don’t exist? The thing that we have to figure out is how to build them through disruption, and meandering, and damage.
As I said, go ahead and use science as a canvas for your imagination, but you can’t fool people here into accepting you have evidence for that. Just because you like to call people idiots, that doesn’t mean they really can’t see through your rube.
How often do we see random accidental mutations for missing bones and airsacks for animals that don’t want them? Because in order for those that do use them to get them, they also need to sporadically pop-up in ALL species, in any location in their body..because according to you its simply random-and when the lucky one hits the spot, we keep it even longer, until the next lucky one.
No, please leave such errors. They are proof of the process of evolving brand new, coherent sentences. 😉
-Q
phoodoo noted,
Exactly!
My dog evolved big, floppy ears—you should have seen them flap when she chased birds! Once I found a feather on one of them, but it turned out it was just stuck there.
But, what will happen over millions of years is that her descendants will acquire some of that bird DNA that she likes to chow down on for their ears and tails. Gradually, their front legs will become vestigial and evolution will produce mammalian (versus reptilian) birds. A placental version of this process can be clearly seen in kangaroos. 😉
-Q
LOL Q. Isn’t it amazing that one of these predecessors flapped and suddenly was able to fly and their offspring just knew to do the same? What is it forgot? We wouldn’t be here!!
Piotr claims epigenetic cannot account for lasting effects past a few generations but that does not make much sense in particular scenarios (nor in the literature in fact pro-evo lit) but also how does the selfish gene explain instinct? How does a once non-flying bird gain the instincts to fly, glide, land…etc?
Querius,
I am pretty sure kangaroos are evolving to eventually be upside down.
They will then become semi-aquatic, and when global warming hits, they will plant their nose underwater, and use their feet to attract dragon flies like a pseudo venus flytrap. Eventually they will mutate a sort of scuba bell housing around their upside down head. There will be an awkward stage before this is fully formed, where they will have to breathe through their tail, thanks to a fortuitous snorkel mutation.
Poitr wrote:
There is ampole evidence of postcranial skeletal pneumaticity in dinosaurs, especially Saurischia (the group containing birds, but also non-avian theropods and sauropodomorphs). For example, sauropods (such as diplodocids and titanosaurs), which certainly couldn’t fly, had pneumatic vertebra and a system of air sacks and diverticulae. Far from causing any stress to them, the system offered thermoregulatory and respiratory advantages, and the added bonus of reducing body density. The extreme elongation of necks and tails in neosauropods would not have been possible without it … Who said dinosaurs (and more especially theropods) had a low metabolism? … I can’t, and therefore I won’t, give you a full account of anatomical and physiological developments in long-extinct animals.
I wouldn’t argue with whether or not such features existed in sauropods or theropods, but only as to how they acquired them. Like the question of developing such in birds, T-Rex and co have to answer to earlier lunged forbearer’s getting different kit, or non-pneumatic skeletal origins. Again much more detail than supposition, drawn from related fossil remains, that provide little or no soft tissues structures, is required for say the lungs atleast.
Yes a fully formed theropod with uni-directional lung flow and the necessary airsack and redirection of passage ways could be a fitter animal, though not because I say so. But I was not debating the fully functional form of T-Rex or say a Hawk. I am more concerned with the dramatic changes required from a wholly different ‘wired’ creature and specifically the how. It is the steady progression of a developing and wholly different lung, or muscle, or bone structure. Here is where the stress could be a factor, and not as I would agree, in the well developed animal forms.
We both can examine fossil evidence, or even if the impossible happened, a fully functional theropod; we do that with modern avians now. It doesn’t mean we can draw the slightest demonstrable conclusion as to it’s long term development vis a vis origins.
I could refer to modern human ‘evolution in designs’ when confronted with a lineage of modern machines or structures. They would demonstrate slight or more than slight changes over time. I may wonder as to the processes that produced these changes. But once I venture into the manufacturing world, I can see the how of the matter.
This ‘how’ in regards to avians and theropods, cannot be done with the fossil record, and so far efforts to give us insight by real time experimentation, eludes Darwinian claims. Now I would suggest similarities in animal form is by design, to among other things, satisfy necessity. If high efficiency avian type lungs existed in theropods, it was a chosen and manufactured construct. But I do admit that I cannot show you the step by step creative process … but neither can you demonstrate a Darwinian alternate in minutiae, as you politely agreed. It is an unfortunate but unavoidable fact for both of us.
I would suggest though that despite this intractable dilemma, the demonstration of human originated creation, is a strong indication for something similar in biological origins. Darwinian claims have less examples as a positive indicator?
I appreciate the link Poitr, and am interested in any information as to the biology of extinct species. And don’t get ‘stressed’ as to spelling and such, I often strain my pre-post attempts through a word processor, but with little to show for it. My language gene probably suffered from an irreparable mutation hit at some point or something.
Didn’t Lamarck say this?
JDD says
Which scenarios or papers? The reason people get excited about the possibility of trans-generational epigenetics is that is might make for rapid environmentall-induced change. But if such changes can fluctuate rapidally they can’t contribute to long-term change.
Why do you think is a particular problem? This isn’t just YEC-101 “everything is so complex and it has to happen all at once” is it?
phoodoo @ 37 lol
“There will be an awkward stage before this is fully formed, where they will have to breathe through their tail, thanks to a fortuitous snorkel mutation.”
LOL
====
Not really. Lamarck’ theory had animals striving toward some goal (so I guess he’d have therapods really wanting to fly). In fact, part of Darwin’s theory of inheritance were more like the “use and disuse” scenario (and really a lot more like modern theories of trans-generational epigenetics than Lamarck’s)
Phoodoo:
You also miss some of the bones that were present in your ancestors (os penis, for example). If you are 35 or older, your sacral vertebrae are in all likelihood completely fused. Your tail has become reduced to 3-5 small vertebrae forming the coccyx. The facial bones of your skull are pneumatic and contain air-filled diverticula joined to the nasal cavity (as in most other mammals and in archosaurs).
re phoodoo’s comment @ 37,,,
Not that there could even be a world for us to comprehend if atheism were true,,
Comprehensibility of the world
Excerpt: ,,,Bottom line: without an absolute Truth, (there would be) no logic, no mathematics, no beings, no knowledge by beings, no science, no comprehensibility of the world whatsoever.
http://www.uncommondescent.com.....the-world/
,, but it is amazing, as adept as atheists are at using there imagination to conjure up ‘just so stories’ at the drop of a hat, that atheists cannot visualize how absurd the world would be if it were possible for atheism to be true:
What Would The World Look Like If Atheism Were Actually True? – video
http://www.metacafe.com/watch/5486757/
willh @38:
I don’t think any of those changes was sudden. Some degree of skeletal pneumaticity (initially only in the skull) and the presence of airsacks seems to be common to all archosaurs, including crocodilians. In Ornithodira (the group that contains pterosaurs, dinosaurs and their close relatives), and possibly even earlier (see the links below) we find postcranial pneumaticity and “invasive” airsacks and diverticula (accompanying endothermy and a tendency towards bipedal locomotion). Note that two distantly related ornithodiran lineages (pterosaurs and birds) took to the air independently. It took some 90 million years for primitive ornithodirans to evolve into flying dinosaurs. The fossil record is of course imperfect and it’s hard to document every little step, but the process seems to have been slow and gradual rather than dramatic.
http://www.ncbi.nlm.nih.gov/pubmed/22470520
http://www.ncbi.nlm.nih.gov/pubmed/11402840
Bird Evolution vs. The Actual Fossil Evidence – video and notes
http://vimeo.com/30926629
The Unknown Origin of Pterosaurs – video
http://www.youtube.com/watch?v=XP6htc371fM
————
FLIGHT: The Genius of Birds – Flight muscles – video
http://www.youtube.com/watch?v=aFdvkopOmw0
FLIGHT: The Genius of Birds – Skeletal system – video
http://www.youtube.com/watch?v=11fZS_B6UW4
FLIGHT: The Genius of Birds – Embryonic Development – video
http://www.youtube.com/watch?v=-Ah-gT0hTto
Bat Evolution? – No Transitional Fossils! – video (w/notes)
http://www.metacafe.com/watch/6003501/
This is just too much..my sides ache from all the laughing I’ve done reading some of these comments haha, thanks folks.
Piotr, sounds like you’re a true believer, praise Darwin hallelujah. Some healthy skepticism is in order I think. Reading your posts only serves to show how insanely wedded to your belief system you are.
Your faith is hampering your objectivity and is affecting your ability to think critically.
Wow, bornagain77. The whale-bat evolutionary connection is amazing!
I had no idea that their common echolocation ability was so remarkably similar even on a molecular level. So, I’m sure that even Piotr would have difficulty swallowing an evolutionary sequence between bats and toothed whales . . . or is it the other way around?. The MRCA between hippopotamus and Indohyus is precisely the evolutionary age of bats! Coincidence?
In the face of devastating evidence, Darwinists turn it around to say that it’s the “one of the best examples” for convergent evolution! They even dragged hippos into the mix! And what a mess they’d make if they could fly–duck for cover, everyone!!! Or maybe the supposed “wolf-like” ancestor of the whale evolved echolocation in the dark forest biome that it inhabited, and then had the foresight to bring it along to its benthic destination.
So I guess there shouldn’t be any problem if someone claimed the similarity between humans and chimps was an Even Better Example of convergent evolution!
Again, the theory of evolution can explain anything, but successfully predicts nothing.
-Q
Querius:
Convergent evolution, no matter how amazing it looks, is hardly big news when it affects an adaptive trait (the ability to echolocate at high frequencies) and involves similar selective pressures in both lineages. It would be more surprising to see non-adaptive innovations shared by bats and cetaceans, such as orthologous ERVs.
wd400:
Really? So facile an answer.
Here’s QuickWiki on Lamarckism:
I don’t see that they anywhere say that the giraffes “wanted longer necks,” do you?
Would you like to update your post?
Piotr,
That’s odd. The scientists who discovered the biochemical similarity apparently were amazed. I wonder why.
If you think whales and bats had similar selective pressures, than I’d say you could make the same argument for any two animals on the planet. Presumably, the squid eaten by the toothed whales also have had similar selective pressures for millions of years, yet they don’t have biosonar.
No, it wouldn’t. The supposed ERVs would simply not be recognized as such.
The theory of evolution can explain anything, but successfully predicts nothing.
-Q
Querius.
I think you failed to understand what’s going on in these papers. THey are looking specifically and proteins associated with hearing in mammals. Only three groups of mammals do echolocation well, so it can’t be true that “ay you could make the same argument for any two animals on the planet.”
Moreover, Convergent evolution is not being offered as an ad hoc justification for the similarity of these sequences, it’s what was being tested. It is suprising (to me at least) that the convergence is strong enough to make the protein-trees diverge from the true history of the species but not, as you claim “devestating.
In fact, check out his follow up paper in which trees estimate from DNA sequences find the species tree, while protein sequences group echolocaters. How can you explain that pattern if not through convergent amino-acid substitutions in each lineage?
wd400 states:
‘you failed to understand’
,,, The one predictable thing about evolution is that if you point out one of the many evidences that contradict evolution then a Darwinist will eventually come along and say
“you just don’t understand evolution”
for instance:
“Die, Selfish Gene … “ science writer just “doesn’t understand” genetic evolution – Harvard psychologist
http://www.uncommondescent.com.....chologist/
OK, I’ll break a rule and answer one of your posts…
Can you explain (without a torrent of links and quotes…) how the shared amino-acids genes associated with hearing in bats and toothed-whales “contradicts” evolution. Especially given the fact the nucleotide sequence of the genes coding for these proteins matches the species tree?
wd400, but alas a rule is a rule.
In this following recent podcast, Dr. Meyers, at the 15:25 minute mark, talks about how computer algorithms are set up to ‘generate a tree-like pattern’:
“The computer programs that analyze the sequence similarities, or differences, are programmed in advance to generate a tree-like pattern. In other words, the assumption of a common ancestor is built into the way in which the analysis is performed. So there is no way you would get anything other than the conclusion,,, It’s a question begging assumption.”
Stephen Meyer – on the Cambrian Explosion – podcast
http://intelligentdesign.podom.....3_15-07_00
Disagree with him? well,,,
Pattern pluralism and the Tree of Life hypothesis – 2006
Excerpt: Hierarchical structure can always be imposed on or extracted from such data sets by algorithms designed to do so, but at its base the universal TOL rests on an unproven assumption about pattern that, given what we know about process, is unlikely to be broadly true.
http://www.pnas.org/content/104/7/2043.abstract
Moreover, when the data is analyzed in detail, instead of by algorithms ‘designed’ to draw a tree-like out for you, the tree-like pattern disappears:
Why Darwin was wrong about the (genetic) tree of life: – 21 January 2009
Excerpt: Syvanen recently compared 2000 genes that are common to humans, frogs, sea squirts, sea urchins, fruit flies and nematodes. In theory, he should have been able to use the gene sequences to construct an evolutionary tree showing the relationships between the six animals. He failed. The problem was that different genes told contradictory evolutionary stories. This was especially true of sea-squirt genes. Conventionally, sea squirts – also known as tunicates – are lumped together with frogs, humans and other vertebrates in the phylum Chordata, but the genes were sending mixed signals. Some genes did indeed cluster within the chordates, but others indicated that tunicates should be placed with sea urchins, which aren’t chordates. “Roughly 50 per cent of its genes have one evolutionary history and 50 per cent another,” Syvanen says. .”We’ve just annihilated the tree of life. It’s not a tree any more, it’s a different topology entirely,” says Syvanen. “What would Darwin have made of that?”
http://www.newscientist.com/ar.....-life.html
I would like to point out that this, ‘annihilation’ of Darwin’s genetic tree of life, article came out on the very day that Dr. Hillis, a self-proclaimed ‘world leading expert’ on the genetic tree of life, testified before the Texas State Board Of Education that the genetic tree of life overwhelmingly confirmed gradual Darwinian evolution. One could almost argue it was ‘Intelligently Designed’ for him to exposed as a fraud on that particular day of his testimony instead of just any other day of the year.
a primary example of evolutionary assumptions giving a tree-like pattern and detailed analysis evaporating the tree-like pattern is in the 98% genetic similarity myth:
The Myth of 98% Genetic Similarity between Humans and Chimps – Jeffrey Tomkins PhD. – video
https://vimeo.com/95287522
bornagain77 @58
May I remind you that Tomkins’s incompetence was exposed on this very blog?
http://www.uncommondescent.com.....ent-498380
Piotr, Dr. Tomkins, further down from the very comment you cited, was kind enough to respond to the ‘hatchet job’ against the integrity of his work:
The BLASTN analyses done in this paper were performed after stripping all N’s from the data set and sequence slicing the large contiguous sequence into optimized slice sizes – all done on a local server using optimized algorithm parameters. My data not only takes into account gaps, but sequences present in human and absent in chimp, and vice versa. Doing an amateur armchair analysis on the BLAST web server with default parameters never designed for a one-on-one large scale genomic regional comparison as noted in the comment above by aceofspades25 is bogus. Of course, if the paper was actually read in it’s entirety in regards to the above comments this would have been obvious.
Also, as noted in several evolutionary papers, which I cited in my paper, the large scale comparison and major differences in structural variability surrounding the GULO regions between humans and great apes in the intronic areas has been noted before. Interesting that the misleading post by aceofspades25 did not make note of that. My paper was in fact accurate in all respects and true to previous findings published by evolutionist themselves. My work just hashed out and exposed what was already known, but never previously elaborated upon because it shows just another aspect of what a complete fraud the human evolution paradigm truly is.
http://www.uncommondescent.com.....ent-500813
Moreover Piotr, aside from the detailed genetic analysis which overturned evolutionary assumptions, I note that you, nor any other atheistic neo-Darwinist, has any empirical evidence that supposed beneficial mutations can fix in a genome:
The Real Barrier to Unguided Human Evolution – Ann Gauger – April 25, 2012
Excerpt: Their results? They calculated it would take six million years for a single base change to match the target and spread throughout the population, and 216 million years to get both base changes necessary to complete the eight base binding site. Note that the entire time span for our evolution from the last common ancestor with chimps is estimated to be about six million years. Time enough for one mutation to occur and be fixed, by their account.
http://www.evolutionnews.org/2.....58951.html
Experimental Evolution in Fruit Flies (35 years of trying to force fruit flies to evolve in the laboratory fails,,, spectacularly) – October 2010
Excerpt: “Despite decades of sustained selection in relatively small, sexually reproducing laboratory populations, selection did not lead to the fixation of newly arising unconditionally advantageous alleles.,,, “This research really upends the dominant paradigm about how species evolve,” said ecology and evolutionary biology professor Anthony Long, the primary investigator.
http://eebweb.arizona.edu/nach.....l_2010.pdf
supplemental note:
Fruit fly with the wings of beauty – July 2012
Excerpt: But a closer examination of the transparent wings of Goniurellia tridens reveals a piece of evolutionary(?) art. Each wing carries a precisely detailed image of an ant-like insect, complete with six legs, two antennae, a head, thorax and tapered abdomen.
http://www.thenational.ae/news.....-of-beauty
Querius:
Were they really amazed?
http://tinyurl.com/qdavzqm
They only comment upon the fact that such a degree of molecular convergence is exceptionally rare (which it probably is). My impression is that they were pleased rather than disturbed by their discovery.
Do try to understand what wd400 says about the match between nucleotide substitutions and the species family tree. It’s an important point.
ba77:
AoS did a very careful analytic job and wrote a detailed review exposing all the weaknesses of Tomkins’s methodology. Tomkins did not really address any of his points. He only waved away the criticism, accusing AoS of general amateurishness and sloppy reading, and wound the post up with an assurance that his paper was accurate in all respects. This is not an acceptable reply to a devastating review. But then, how would you know?
Piotr, I disagree wholeheartedly. and hold AoS to be flawed in his analysis. The one thing that my years of dealing with neo-Darwinists has taught me is to never trust anything they say. And you, true to your Darwinian roots, ignore the fact, as I have shown, that you have no empirical basis for Darwinism in which to justify making extrapolations of genetic similarity/dissimilarity in the first place. But regardless of ‘having both feet planted firmly in mid-air’ empirically speaking, you feel qualified to pronounce on what Darwinism did and did not produce…. It would be hilarious if not for the fact that you think you are actually being rational in all this!
ba77:
LOL, anyone who criticises Tomkins must be a “neo-Darwinist”, and so can’t be trusted (whatever the argument). That makes Tomkins invincible — but of course only in your eyes, which is a lame consolation.
Piotr, I assume your position is Darwinian since you do indeed defend Darwinian claims so dogmatically, (if you are more of a Shapiro or Kaufman type evolutionist please clarify, i.e. natural genetic engineering, and self organization respectfully) ,,, but to clearly illustrate just how far removed from empirical science the ‘Darwinian’ position actually is, there is not one iota of empirical evidence that Darwinian processes can generate any non-trivial levels of functional information/complexity above that which is already present in life:
Now Piotr, it is not a matter of Darwinism having some empirical basis and Darwinists working from that established basis, but it is a matter of Darwinism having no empirical basis whatsoever in which to work from, and yet having Darwinists pretend as if they have a empirical basis in which to make their sweeping assumptions for how all life on earth arose.,,, Thus my quip of Darwinists ‘having both feet planted firmly in mid-air’ empirically speaking. In other words, It is not me that undermines any integrity Darwinists may have had in making their sweeping claims for how all life arose but it is the empirical evidence itself which undermines any intgity they might have had in their claims. As Berlinski says of Darwinists, ‘you guys simply are not credible’.
Dogs stay dogs- Dr. David Berlinski – On Evolution
https://www.youtube.com/watch?v=9Yk9BO9WzIs
wd400 wrote:
Can you explain (without a torrent of links and quotes…) how the shared amino-acids genes associated with hearing in bats and toothed-whales “contradicts” evolution. Especially given the fact the nucleotide sequence of the genes coding for these proteins matches the species tree?
The paper you linked to at your #53 post does confirm the phylogenetic tree’s expected, once the echolocation related genetic changes are dropped. Is there a question that genetic similarities, posited in the phylogenetic tree’s, wouldn’t concur in special creation?
The noted genetic changes that allow both echo locating bats and dolphins this specific ability, coupled with the same singular gene expressions, can also be explained by a directed change. That change can be accomplished by an intelligence and not a natural cause only.
In the linked paper no specific process of natural causes, for this ‘parallel’ evolution in the genes for echolocation, was discussed in detail. Any nod to the powers of selection or the ability of ideal mutations being assumed? Or is there some other mechanism? It really only seemed to me to outline in general, the argument between the content of evolutionary development [convergent, parallel and co evolution].
The maths of it seemed to be used to prove, that indeed a striking convergent / parallel evolutionary process has occurred. But I must admit, these kind of calculations are not my daily fare; any assistance in understanding this aspect is appreciated.
wd400@53 objected, including
(Since we’re into breaking rules) That’s not what I was objecting to. Let me put it another way. Attributing similar “selection pressure” as the cause for the evolution of echolocation in two kinds of bats and toothed whales strains credibility when there are many non-echolocating bats and whales, not to mention nocturnal animals, benthic animals such as squid, etc., that did not develop cochlear enhancements (or the “melon” in toothed whales).
One would expect the opposite. Supposedly, the evolutionary process was independent and “parallel” (as the authors of the paper indicated in their abstract), especially considering the differences in underwater hearing. Or maybe all three animals arrived at the top of Mount Really Improbable at the same time, paraphrasing Dawkins.
According to bornagain77’s link (https://vimeo.com/95287522), considering the revision to about 70% similarity between chimpanzees and humans claimed by Jeffrey Tomkins, along with the evidence against fusion on chromosome 2 of humans, if true, would likewise open the door to parallel human evolution. If not, what else? Did you see the Miller quote?
-Q
I’m just amusing myself with Piotr’s flawed reasoning, bald assertions, and otherwise clairvoyant abilities demonstrated here.
Piotr opens in typical evolutionatry fashion by appealing to majority opinion as unassailable fact:
And now we are into Piotr’s full on psychic divination and faith claims:
Piotr please share your crystal ball with us… honestly do you actually believe these imagineered assertions your tossing out are scientific statements? This is laughable…
Actually the more reasonable assumption is that if we hypothetically imagine the appropriate function-finding incremental mutations occurred at all, the vast majority of them would not produce any significant fitness signal that would even be selected for.
But I know you guys don’t like to think about pesky things like this. You have a magical view of natural selection, Piotr.
lol… Fossils which are interpreted through various rounds of speculation… producing an ambiguous transitional hypothesis that ultimately must win the day by a consensus of subjective opinion as you already demonstrated.
Oh really, and how do you know a “convergent” trait was subject to similar selective pressures? Well because the traits exist of course! And evolution must be true! The circular reasoning of the evolutionist is almost beautiful at times in its simplicity…
Thanks for the amusement, Piotr.
Q:
Different selection pressures, obviously.
I don’t understand the difficulty you’re having with basic biology. If not common ancestry, then common advantage. If not common ancestry nor common advantage, then different environment.
A theory that explains everything and predicts nothing.
What more could you want?
But this paper and (piotr comment specifically) is about proteins invlolved in hearing in echolocators, not about why and how echolocation evolved generally.
Check out the PLOS Genetics paper – the trees derrived from nucleotide sequences correspond to the species tree; those from protein (i.e. the things that actually contriute to listening) group the echolocators. That’s explicable under convergent evolution (the same amino acid changes happening in different ways in each lineage) but hard to explain otherwise.
I didn’t watch the Tompkins video, but I don’t know what “parallel human evolution” would mean, or how his supposed 70% identity could make an argument for it.
willh,
Any observation is compatabile with special creation or “an intelligence”, the claim I was responding to was that shared amino acid changes in these proteins was evidence “against evolution” (and even “devastating” evidence.
You can treat most of the maths of that paper as background – they use it to establish that there has been selection for changing amino acid sequences in echolocating species over time (based on the rate of synonomous and non-syn. substitutions in the different groups), and to attempt to reconstruct ancestral sequences.
having the same proteins show up in widely divergent species is devastating against Darwinian claims because, number one, no one has ever seen unguided processes generate a protein (Axe), and number 2, evolution is shown to be historically contingent, not convergent(Rana).
1. These papers aren’t about “having the same proteins show up in widely divergent species”.
2. actually, I don’t know what this means.
Well, forgive me for paying scant attention to the links, but I thought we were talking about ‘convergence’:
Convergent sequence evolution between echolocating bats and dolphins – Liu et al (2010)
Excerpt: We previously reported that the Prestin gene has undergone sequence convergence among unrelated lineages of echolocating bat [3]. Here we report that this gene has also undergone convergent amino acid substitutions in echolocating dolphins,
http://www.cell.com/current-bi.....%2902073-9
Common Design in Bat and Whale Echolocation Genes? – January 2011
Excerpt: two new studies in the January 26th issue of Current Biology, a Cell Press publication, show that bats’ and whales’ remarkable ability and the high-frequency hearing it depends on are shared at a much deeper level than anyone would have anticipated — all the way down to the molecular level.
http://www.evolutionnews.org/2.....42291.html
Here’s a figure showing bats and dolphins group together on the same tree based on Prestin sequence comparisons.
http://sphotos.xx.fbcdn.net/hp.....7372_n.jpg
Bat and Whale Echolocation Genes Point to Common Design – February 2011 – Podcast
http://intelligentdesign.podom.....9_16-08_00
Moreover, this finding is unexpected from an evolutionary perspective, yet this finding is exactly what we would expect to find from presupposing a Creator to reuse optimal designs:
Convergence Drives Evolution Batty – Fazale Rana – September 2010
Excerpt: convergence make sense if life stems from the work of a Creator.
http://www.reasons.org/converg.....tion-batty
Bothersome Bats and Other Pests Disturb the “Tree of Life” – Casey Luskin – December 5, 2012
Excerpt: But this is hardly the only known example of molecular convergent evolution. In his book The Cell’s Design, chemist and Darwin-skeptic Fazale Rana reviewed the technical literature and documented over 100 reported cases of convergent genetic evolution. Each case shows an example where biological similarity — even at the genetic level — is not the result of inheritance from a common ancestor.
http://www.evolutionnews.org/2.....67121.html
Convergent evolution seen in hundreds of genes – Erika Check Hayden – 04 September 2013
Excerpt: “These results imply that convergent molecular evolution is much more widespread than previously recognized,” says molecular phylogeneticist Frédéric Delsuc at the The National Center for Scientific Research (CNRS) at the University of Montpellier in France, who was not involved in the study. What is more, he adds, the genes involved are not just the few, obvious ones known to be directly involved in a trait but a broader array of genes that are involved in the same regulatory networks.
http://www.nature.com/news/con.....es-1.13679
Simon Conway Morris has a website documenting hundreds, if not thousands, of examples of ‘convergence’:
Map Of Life – Simon Conway Morris
http://www.mapoflife.org/browse/
Simon Conway Morris: “Fossil evidence demands a radical rewriting of evolution.” – March 2012
Excerpt: “The idea is this: that convergence – the tendency of very different organisms to evolve similar solutions to biological problems – is not just part of evolution, but a driving force. To say this is an unconventional view would be something of an understatement.”
http://www.uncommondescent.com.....evolution/
Of note; The bat’s echometer has more accuracy, more efficiency, less power consumption and less size than any artificial sonar constructed by engineers. The echometer cannot be installed into the bat in the afterward as a simple plug-in, rather echometer and brain had to be designed as a whole system from the beginning.
The bionic antinomy of Darwinism
Excerpt: For example, the bats have an echometer emitting 100 kHz supersonic pulses at a frequency of 30 times per second. These waves are reflected and distorted by the surrounding objects and their echoes are intercepted and elaborated by the bat to catch its prey and also just to get around. The signal processing of these echoes is so accurate to allow bats to fly, twisting, looping and zig-zagging through the air, into a completely dark room intersected by tens pianoforte strings without grazing them. The bat’s echometer has more accuracy, more efficiency, less power consumption and less size than any artificial sonar constructed by engineers.
http://www.uncommondescent.com.....darwinism/
A comparison of signal detection between an echolocating dolphin and an optimal receiver – 1989
Excerpt: The results of experiment II indicated that the dolphin required approximately 7.4 dB higherE e /N than an optimal detector to detect the phantom target.
http://profiles.wizfolio.com/l.....260/27414/
A false killer whale adjusts its hearing when it echolocates.- 2008
Excerpt: the animal has an active ‘automatic gain control’ mechanism in her hearing based on both forward masking that balances outgoing pulse intensity and time between pulse and echo, and active hearing control.
http://www.ncbi.nlm.nih.gov/pubmed/18490386
Here is a cool animated video showing a sperm whale using ‘designed’ echolocation to hunt a giant squid:
Sperm Whale Vs Giant Squid – video
http://www.youtube.com/watch?v=_z2Lfxpi710
So please Forgive me for being disengaged from your links excuses as to why this is not devastating to Darwinian evolution, since, basically, it gets a bit boring dealing with just so stories.
BA,
laugh if you will wd400,,,, but, as usual, I still see no real empirical evidence from you, only unsubstantiated declaration that Darwinian processes produced such widespread and ‘optimal’ convergence(s). ,,, But alas I’m sure, despite you NEVER having any real evidence to back up your claims, it will ultimately be because ‘you just don’t understand evolution’.
This all would be funny, but old jokes turn sad quickly, especially when the fate of your soul is tied up in it all. Far more sad than either you or I realize right now.
Mung@70 quipped,
LOL. Exactly. It “musta” been the one, and if not, it “musta” been the other.
It’s the same with “living fossils” that survived millions of years unchanged because they musta been isolated.
-Q
Oh, come on BA, even you you have to see the humour in someone whose entire MO is sending these link-laden posts getting snippy about “paying scant attention to the links”?
Sometimes you have to laugh.
WD400@71,
Remains unanswered.
To an astute observer, it would indicate a reductio ad absurdum argument.
The video that you couldn’t be bothered to watch included the following information:
Which of course leaves only parallel or convergent evolution. You know, like echolocation in bats and whales.
-Q
The BAD (Birds are Dinosaurs) advocates are vehement in their arguments and frequently scathing about those who are not persuaded by their reasoning and rhetoric. That is why I thought the review by Leigh well worth our attention, as it comes from a journal that normally follows the consensus. What we need to do, from time to time, is to stand back from the details and see the landscape. That is what I think Leigh has achieved in his review. If we can appreciate the points he makes, it might help us move towards a more evidence-based (and less theory-laden) approach to origins issues in general, not just the BAD/BAND issue in particular.
wd400:
That’s ignorance talking.
Querius
Again, no one has claimed “because selection pressures” explains the evolution of echolocation in bats ant dolphins and their kin. These papers (and Piotr’s comment about convergence) are about the particular molecules associated with hearing. There is an obvious advantage to good high-frequency hearing in a species that echolocates, so it’s not suprising the same pressures on the gene encoding the molecule generated many of the same amino acid changes.
It wouldn’t be right to say “the repeated evolution of echolocation is not surprising because selection pressures”, there’s much more to it than that (and in fact, bat and dolphin echolocation are quite different).
Lol at the ‘subtle’ dig. I guess you meant you’d have to conclude many similarities between humans and chimps where the result of convergent evolution if Tomkins was right?
Well, first he’s not. The 98% identity of alignable sequences is just true and you are welcome to test it yourself – here’s a databse full of sequences directly form sequencing projects.
Presumably whatever Tomkins does to DNA to get the 70% number would do the same to Gorilla and Orang data, so I dont’ think you’d get anything other than (human-(chimp-bonobo) as the relationship between species.
Now, here’s a real unanswered question.
Can you explain the discordance between DNA trees and protein trees in the PLOS Genetics paper via some mechanism other than convergent evolution? Do you at least admit this is a strong signal of evolutionary convergence?
Joe,
Tell what observation (not conclusion) is incompatible with special creation.
wd400- If someone demonstrates that living organisms can arise from matter and energy via purely materialistic processes, that would be incompatible with special creation.
That would make special creation superfluous, but it wouldn’t be incompatible with the finding.
Special Creation says that only God can Create Life. Also an eternal universe would be incompatible with Special Creation.
So in your mind making something superfluous isn’t the same as being incompatible? Really?
Showing that mother nature can produce Stonehenge’s, ie making the designer superfluous for Stonehenge, is incompatible with the current understanding of Stonehenge’s existence.
Showing that a death can be accounted for via natural causes is incompatible with a murder.
Special creation, as most people understand the term at least, mean god did create life. Showing only life could only arise via a creating god would be proof of special creation, but not its definition.
Finding henges could arise by erosion and other natural forces would provide an alternative explanation for stone henge. But that finding wouldn’t be incompatible with the idea stone henge was designed and built (it would just make it less probable)
Silly arguments, wd400. What observations would disprove materialistic origins? By the same token you may infer that there is an as-of-yet unknown materialistic cause behind a phenomena that appears to lend itself to special creation. No matter how superfluous that materialistic inference might be, you could still make it.
What arguments? I was replying to questions asked of me.
as to wd400 sniffing,,,
“whatever Tomkins does to DNA to get the 70% number”
HMMM what could he be doing? like, for instance, including data that Darwinists excluded because it did not fit their evolutionary bias? How could someone be so biased as to manipulate the genetic data to a desired conclusion!?! (snark off)
Comprehensive Analysis of Chimpanzee and Human Chromosomes Reveals Average DNA Similarity of 70% by Jeffrey Tomkins on February 20, 2013
Excerpt: It is now clear that the genetic differences between humans and chimpanzees are far more extensive than previously thought; their genomes are not 98% or 99% identical (Preuss 2012, p. 10709).
One of the major problems with past research in comparative DNA analysis between chimps and humans was recently reviewed in several reports (Bergman and Tomkins 2012; Tomkins and Bergman, 2012). They found that there is a great deal of preferential and selective treatment of the data being analyzed. In many cases, only the most promising data such as gene-rich sequences that exist in both species (homologs) is utilized from a much larger data pool. This pre-selected data is often further subjected to more filtering before being analyzed and discussed. Non-alignable regions and large gaps in DNA sequence alignments are also typically omitted, thus increasing the levels of reported similarity.
https://answersingenesis.org/answers/research-journal/v6/comprehensive-analysis-of-chimpanzee-and-human-chromosomes/
also of note:
Contradictory Trees: Evolution Goes 0 For 1,070 – Whif
Excerpt: One of evolution’s trade secrets is its prefiltering of data to make it look good, but now evolutionists are resorting to postfiltering of the data as well.,,,
There are profound contradictions between the different traits, and in a new attempt evolutionists just set a new record for failure: out of 1,070 genes, every single one contradicted the hoped for evolutionary tree, as well as each other. 1,070 different genes and 1,070 different evolutionary trees. Consequently evolutionists are now manipulating the data even more than before to obtain the desired results.,,,
the typical strategy in such cases is simply to drop that particular gene from the data set. That big difference is, in a stroke, eliminated from the analysis. This is one type of prefiltering evolutionists use.
Prefiltering is often thought of merely as cleaning up the data. But prefiltering is more than that, for built-in to the prefiltering steps is the theory of evolution. Prefiltering massages the data to favor the theory. The data are, as philosophers explain, theory-laden.
But even prefiltering cannot always help the theory. For even cleansed data routinely lead to evolutionary trees that are incongruent (the opposite of consilience). As one study explained, the problem is so confusing that results “can lead to high confidence in incorrect hypotheses.” And although evolutionists thought that more data would solve their problems, the opposite has occurred. With the ever increasing volumes of data (particularly molecular data), incongruence between trees “has become pervasive.”
This problem became all the more obvious in a new study that examined 1,070 different genes found in a couple dozen yeast species (yes, the data were prefiltered). All those genes taken together produced one evolutionary tree, but each of the 1,070 different genes produced a different tree—1,070 plus 1 different trees. It was, as one evolutionist admitted “a bit shocking.”
Or as another evolutionist put it, “We are trying to figure out the phylogenetic relationships of 1.8 million species and can’t even sort out 20 [types of] yeast.”
http://darwins-god.blogspot.co.....oes-0.html
There’s a whole database of raw sequencing data available to anyone who wants to play with it. If ~70% is the right number it should be easily reproducible…
http://www.ncbi.nlm.nih.gov/sra
As I’m not qualified in the least to analyze the raw data, I have to look at whose work I trust the most. And given that Darwinists have had a bit of an issue with honesty in the past (understatement), then I will trust Dr. Tomkins work as to having more integrity.
here are a few examples of the ‘honesty issue’ Darwinist have trouble with:
With such shenanigans in the past, and good reason to believe their bias continues to heavily influence their handling of the data, it is hard for to see how anybody in their right mind could put their unquestioned trust in anything a Darwinists says about the evidence.
Well, that’s a shield your beliefs from conflicting data while maintaining confirmation bias. But it really means there is no point talking to you, so I’ll return to my older policy on that.
HMMM, interesting, I’m the one accused of ‘confirmation bias’ when Darwinists are the ones who have more than demonstrated their willingness to manipulate data to fit their desired conclusion. ,,,, Even a secular paper admits the data is ripe for abuse:
Guy Walks Into a Bar and Thinks He’s a Chimpanzee: The Unbearable Lightness of Chimp-Human Genome Similarity – Sternberg – 2009
Excerpt: One can seriously call into question the statement that human and chimp genomes are 99% identical. For one thing, it has been noted in the literature that the exact degree of identity between the two genomes is as yet unknown (Cohen, J., 2007. Relative differences: The myth of 1% Science 316: 1836.). ,,, In short, the figure of identity that one wants to use is dependent on various methodological factors.
http://www.evolutionnews.org/2.....think.html
Special Creation, as most people I know understand the term, means only God can Create life from nonliving matter and energy.
I take that back- I don’t know anyone who thinks Special Creation allows for any entity but God to bring about life.
Moreover, as to wd400 letting his assumptions dictate how he is willing to interpret the evidence (confirmation bias), the primary assumption that wd400 has (neo-Darwinism) is shown to be false:
Peer-Reviewed Paper: Development Needs Ontogenetic Information that Cannot Arise from Neo-Darwinian Mechanisms – Casey Luskin – June 2, 2014
Excerpt: Jonathan Wells has published a new peer-reviewed scientific paper in the journal BIO-Complexity, “Membrane Patterns Carry Ontogenetic Information That Is Specified Independently of DNA.” With over 400 citations to the technical literature, this well-researched and well-documented article shows that embryogenesis depends on crucial sources of information that exist outside of the DNA.
This ontogenetic information guides the development of an organism, but because it is derived from sources outside of the DNA, it cannot be produced by mutations in DNA. Wells concludes that because the neo-Darwinian model of evolution claims that variation is produced by DNA mutations, neo-Darwinism cannot account for the origin of epigenetic and ontogenetic information that exists outside of DNA. (Read more here:)
http://www.evolutionnews.org/2.....86201.html
moreover,,,
“Where (chimps and humans) really differ, and they differ by orders of magnitude, is in the genomic architecture outside the protein coding regions. They are vastly, vastly, different.,, The structural, the organization, the regulatory sequences, the hierarchy for how things are organized and used are vastly different between a chimpanzee and a human being in their genomes.”
Raymond Bohlin (per Richard Sternberg) – 9:29 minute mark of video
http://www.metacafe.com/watch/8593991/
HOW BIOLOGISTS LOST SIGHT OF THE MEANING OF LIFE — AND ARE NOW STARING IT IN THE FACE – Stephen L. Talbott – May 2012
Excerpt: “If you think air traffic controllers have a tough job guiding planes into major airports or across a crowded continental airspace, consider the challenge facing a human cell trying to position its proteins”. A given cell, he notes, may make more than 10,000 different proteins, and typically contains more than a billion protein molecules at any one time. “Somehow a cell must get all its proteins to their correct destinations — and equally important, keep these molecules out of the wrong places”. And further: “It’s almost as if every mRNA [an intermediate between a gene and a corresponding protein] coming out of the nucleus knows where it’s going” (Travis 2011),,,
Further, the billion protein molecules in a cell are virtually all capable of interacting with each other to one degree or another; they are subject to getting misfolded or “all balled up with one another”; they are critically modified through the attachment or detachment of molecular subunits, often in rapid order and with immediate implications for changing function; they can wind up inside large-capacity “transport vehicles” headed in any number of directions; they can be sidetracked by diverse processes of degradation and recycling… and so on without end. Yet the coherence of the whole is maintained.
The question is indeed, then, “How does the organism meaningfully dispose of all its molecules, getting them to the right places and into the right interactions?”
The same sort of question can be asked of cells, for example in the growing embryo, where literal streams of cells are flowing to their appointed places, differentiating themselves into different types as they go, and adjusting themselves to all sorts of unpredictable perturbations — even to the degree of responding appropriately when a lab technician excises a clump of them from one location in a young embryo and puts them in another, where they may proceed to adapt themselves in an entirely different and proper way to the new environment. It is hard to quibble with the immediate impression that form (which is more idea-like than thing-like) is primary, and the material particulars subsidiary.
Two systems biologists, one from the Max Delbrück Center for Molecular Medicine in Germany and one from Harvard Medical School, frame one part of the problem this way:
“The human body is formed by trillions of individual cells. These cells work together with remarkable precision, first forming an adult organism out of a single fertilized egg, and then keeping the organism alive and functional for decades. To achieve this precision, one would assume that each individual cell reacts in a reliable, reproducible way to a given input, faithfully executing the required task. However, a growing number of studies investigating cellular processes on the level of single cells revealed large heterogeneity even among genetically identical cells of the same cell type. (Loewer and Lahav 2011)”,,,
And then we hear that all this meaningful activity is, somehow, meaningless or a product of meaninglessness. This, I believe, is the real issue troubling the majority of the American populace when they are asked about their belief in evolution. They see one thing and then are told, more or less directly, that they are really seeing its denial. Yet no one has ever explained to them how you get meaning from meaninglessness — a difficult enough task once you realize that we cannot articulate any knowledge of the world at all except in the language of meaning.,,,
http://www.netfuture.org/2012/May1012_184.html#2
wd400,
Really? I was responding to Piotr@50. Read it for yourself.
If chromosome 2 actually doesn’t have a fusion site, what does that leave you? Kenneth Miller apparently said it would disprove evolution. I’m not sure I’d go that far, but aside from parallel evolution, what’s left (you make essentially the same point later)? Maybe someone will discover some heretofore unknown DNA transduction path perhaps involving gut flora. Stranger things have happened.
If you’d watched the video, you’d know what he said he’s planning to do next. 😉
No, I don’t. It’s considered “strong” only because it’s the last unlikely option available. It’s like saying that because we can obviously see the answer is 2, the addends must have been 1 and 1 when we don’t know of the existence of decimals and negative numbers.
With closely related species, how can you differentiate between evolutionary progression and evolutionary convergence/parallelism (let alone detect another mechanism)? Would you deny the possibility of parallel evolution in isolated populations?
-Q
I have. THe converstation is about a paper reporting molecular similarities in molecules associated with hearing in bats and dolphins and the and Piotr spoke specifically about high-frequency hearing, which is exactly what the molecues are involved in.
Where would a lack of a fusion site in Chrom 2 leave us? With one less line of evidence that humans are apes. But there is a fusion site.
I’m not sure what this is mean to mean. Can you explain why the nucleotide trees match the species tree?
Phylogeny and population genetics, mainly. The top story on UD right now is about detecting convergent evolution within a species…
BTW, I just read the Tomkins paper. The methods are very hard to follow, but it appears he get’s his “similarity” stats by no allowing gaps in alignments. If that’s the case then all he’s done is shown that there are indels between human and chimp, which is well known.
wd400,
At least you read his paper, but you’re wrong about him not considering indels. See
http://www.uncommondescent.com.....off-stage/
-Q
Nothing in that post says tomkins deals with indels properly.
Now, about those dna trees…
Interesting link Querius,,,
Geneticist Jeff Tomkins vs. Evolutionary Biologist who got laughed off stage – August 12, 2013
Excerpt: Tomkins described the origin of the fallacious comparison as a myth that got started in reassociation kinetic methods of comparison in the mid-1970?s prior to the advent of modern sequencing techniques (like Illumina and Solexa). Reassociation kinetics was a technique where fragments of chimp and human DNA were mixed in the same chemical soup, and the DNAs that were reasonably similar would pair up, hence we got a biased sampling!
If we take genes that are found in both humans and chimps and disregard the indels, we get the 98% figure. When indels are considered, the similarity drops to 80-85%!
When including other sequences, the similarity drops even further, down to 70%. But that 70% figure itself, imho, is too generous. I don’t think Tomkins used ORFans or pseudo genes or many other intergenic sequences, and he explicitly avoided the complication of Synteny….
Tomkins pointed also to reports where lab workers may have contaminated the sequencing labs for Chimps with their own human DNA and thus biasing the figures! Hence re-sequencing has been done, and there is more sequencing pending to clean up these errors. He joked about the coughing and sneezing that may have gone on to cause contamination.
Further he pointed out that it seemed politically incorrect to dispute the 98% figure promoted by the reassociation kinetics work because it accorded with the false evolutionary narrative. He said, the industry is finally having to “fess up”, that some of their conclusions are “bogus”.
Tomkins has been reviewer on peer reviewed papers on genetics, he ran a genome lab at Clemson, and said if he had been the reviewer of some of the evolutionary papers he would have rejected them for publication because of the lack of clarity in their methodology, particularly in the material and methods sections of the paper.
During the answer and question session, a ranting raving evolutionary biologists gets up and whines and says something to the effect, “you’re using such inflammatory language … ‘sneeze and cough and ‘fess up’ and bogus’”. The evolutionary biologist then said, “as I said, what I have problems with is inflammatory your language, I don’t want to get into the technical details.” When he said that, he got laughed off stage. It was obvious Tomkins made an unassailable case and the evolutionary biologist didn’t want to be engage Tomkins technical assertions. Instead the evolutionary biologist grasped at irrelevant straws like Tomkins use of the words “sneeze” and “cough”. Pathetic!
http://www.uncommondescent.com.....off-stage/
So apparently wd400 thinks that for Dr. Tomkins to deal with indels ‘properly’ would be to delete them from the comparison so as to get a more ‘proper’ conclusion, but does wd400 have reason, besides wanting his conclusion to be true, for excluding the sequences from comparison? I certainly think wd400 does not have that warrant:
Of related note to Tomkins ‘methodology’:
When evolutionists talk about creatures sharing the same genes, they are typically referring to very small segments of DNA in the genome. And in most cases, they are only referring to the small pieces of protein-encoding genes called exons—not the whole segment of DNA that is actually responsible for producing the information to make the correct version of the protein at the right time and in the correct amount.
http://www.icr.org/article/8129/
So if you assume evolution and exclude all other sequences in the gene that do not match, you get an evolutionary conclusion (no surprise there), but if you look at the ‘whole segment of DNA that is actually responsible for producing the information to make the correct version of the protein at the right time and in the correct amount’, you get a non-Darwinian conclusion. ,,,, It is easy to see why wd400 says Tomkins did not deal with indels ‘properly’. Tomkins refuses to let evolutionary presuppositions dictate what he considers a ‘gene’, and to discard indels, but let what actually makes a protein dictate how he looks at the data.
As to Darwinists ‘fessing up’ to the 1% myth:
The Chimp-Human 1% Difference: A Useful Lie – 06/29/2007
Excerpt: “For many, many years, the 1% difference served us well because it was underappreciated how similar we were,” says Pascal Gagneux, a zoologist at UC San Diego. “Now it’s totally clear that it’s more a hindrance for understanding than a help.”,,,
This is a very disturbing article. We have basically caught the Darwinists in a bald lie that has hoodwinked the world for over 30 years. Gagneux says, “For many, many years, the 1% difference served us well” – stop right there! Who is “us”? Was it the millions of school children and laymen who were lied to? Was it the majority of people who believe God created mankind, suffering under an onslaught of lies told in the name of science? No! “Us” refers to the members of the Darwin Party,,,
http://creationsafaris.com/cre.....#20070629a
Disturbing indeed. He is totally oblivious to his own ‘confirmation bias’ revealed in his statement. Only in Darwinian ‘science’ is such bias/blindness tolerated as if it is normal for science to operate in such a biased fashion.
Supplemental notes:
In “Science,” 1975, M-C King and A.C. Wilson were the first to publish a paper estimating the degree of similarity between the human and the chimpanzee genome. This documented the degree of genetic similarity between the two! The study, using a limited data set, found that we were far more similar than was thought possible at the time. Hence, we must be one with apes mustn’t we? But…in the second section of their paper King and Wilson honestly describe the deficiencies of such reasoning:
“The molecular similarity between chimpanzees and humans is extraordinary because they differ far more than sibling species in anatomy and way of life. Although humans and chimpanzees are rather similar in the structure of the thorax and arms, they differ substantially not only in brain size but also in the anatomy of the pelvis, foot, and jaws, as well as in relative lengths of limbs and digits (38).
Humans and chimpanzees also differ significantly in many other anatomical respects, to the extent that nearly every bone in the body of a chimpanzee is readily distinguishable in shape or size from its human counterpart (38).
Associated with these anatomical differences there are, of course, major differences in posture (see cover picture), mode of locomotion, methods of procuring food, and means of communication. Because of these major differences in anatomy and way of life, biologists place the two species not just in separate genera but in separate families (39). So it appears that molecular and organismal methods of evaluating the chimpanzee human difference yield quite different conclusions (40).”
King and Wilson went on to suggest that the morphological and behavioral between humans and apes,, must be due to variations in their genomic regulatory systems.
David Berlinski – The Devil’s Delusion – Page 162&163
Evolution at Two Levels in Humans and Chimpanzees Mary-Claire King; A. C. Wilson – 1975
http://academic.reed.edu/biolo.....5(classic).pdf
The Red Ape – Cornelius Hunter – August 2009
Excerpt: “There remains, however, a paradoxical problem lurking within the wealth of DNA data: our morphology and physiology have very little, if anything, uniquely in common with chimpanzees to corroborate a unique common ancestor. Most of the characters we do share with chimpanzees also occur in other primates, and in sexual biology and reproduction we could hardly be more different. It would be an understatement to think of this as an evolutionary puzzle.”
http://darwins-god.blogspot.co.....d-ape.html
Mona Lisa smile: The morphological enigma of human and great ape evolution – 2006
Excerpt: The quality and scope of published documentation and verification of morphological features suggests there is very little in morphology to support a unique common ancestor for humans and chimpanzees.,,,
http://onlinelibrary.wiley.com.....7/abstract
In fact so great are the anatomical differences between humans and chimps that a Darwinist actually proposed that a chimp and pig mated with each other and that is what ultimately gave rise to humans:
A chimp-pig hybrid origin for humans? – July 3, 2013
Excerpt: Dr. Eugene McCarthy,, has amassed an impressive body of evidence suggesting that human origins can be best explained by hybridization between pigs and chimpanzees. Extraordinary theories require extraordinary evidence and McCarthy does not disappoint. Rather than relying on genetic sequence comparisons, he instead offers extensive anatomical comparisons, each of which may be individually assailable, but startling when taken together.,,,
The list of anatomical specializations we may have gained from porcine philandering is too long to detail here. Suffice it to say, similarities in the face, skin and organ microstructure alone is hard to explain away. A short list of differential features, for example, would include, multipyramidal kidney structure, presence of dermal melanocytes, melanoma, absence of a primate baculum (penis bone), surface lipid and carbohydrate composition of cell membranes, vocal cord structure, laryngeal sacs, diverticuli of the fetal stomach, intestinal “valves of Kerkring,” heart chamber symmetry, skin and cranial vasculature and method of cooling, and tooth structure. Other features occasionally seen in humans, like bicornuate uteruses and supernumerary nipples, would also be difficult to incorporate into a purely primate tree.
http://phys.org/news/2013-07-c.....umans.html
Moreover, Physorg published a subsequent article showing that the pig-chimp hybrid theory for human origins is much harder to shoot down than Darwinists had first supposed it would be:
Human hybrids: a closer look at the theory and evidence – July 25, 2013
Excerpt: There was considerable fallout, both positive and negative, from our first story covering the radical pig-chimp hybrid theory put forth by Dr. Eugene McCarthy,,,By and large, those coming out against the theory had surprisingly little science to offer in their sometimes personal attacks against McCarthy.
,,,Under the alternative hypothesis (humans are not pig-chimp hybrids), the assumption is that humans and chimpanzees are equally distant from pigs. You would therefore expect chimp traits not seen in humans to be present in pigs at about the same rate as are human traits not found in chimps. However, when he searched the literature for traits that distinguish humans and chimps, and compiled a lengthy list of such traits, he found that it was always humans who were similar to pigs with respect to these traits. This finding is inconsistent with the possibility that humans are not pig-chimp hybrids, that is, it rejects that hypothesis.,,,
http://phys.org/news/2013-07-h.....dence.html
The obvious question for me is, of course, since Darwinists are having such a hard time proving that we did not come from pig-chimp hybrids, what makes Darwinists so sure that we evolved from apes or anything else in the first place? Any reasonable person would realize that if such a dubious theory as the pig-chimp hybrid theory can cause such havoc, for what was suppose to be such well established science, then perhaps the Darwinian theory for human origins is not nearly as strong as Darwinists have dogmatically held it to be in the first place. Some might even hold that such ‘flimsiness’ would clearly indicate the original theory was rubbish as to being hard science.
podcast – “Jonathan Wells: Is There Biological Information Outside of the DNA?”
http://intelligentdesign.podom.....0_49-07_00
i.e. wd400’s primary assumption of neo-Darwinism is false!
This is very interesting (at least for me) as to undermining neo-Darwinism:
I went to Dr. Wells’s paper and found on page 11:
So, reading closely over Tomkins papers it really seems like he would count and alignment between these two sequences:
ATAGTCGATCGATCGATCGTACGAGGGGGGGTACGTACGTAGCATCGTAGTCAGACTG
ATAGTCGATCGATCGATCGTACGAGGGGGGGTACGACGTAGCATCGTAGTCAGACTG
as being ~60% similar, as he doesn’t allow gaps in alignment and counts one alignment per query sequence:
Does anyone thing those two sequences are 60% similar? Does anyone want to back down from their support of the 70% claim?
wd400, since you are personally having trouble with Dr. Tomkins methodology, and you are trained in the field, why don’t you write him and ask him? He was kind enough to visit this blog once to set Ace’s criticisms straight,,, and I’m sure if you write him a nice e-mail, you two can have a amicable discussion as to where you two disagree. Who knows perhaps you can make him finally see that he ‘just doesn’t understand evolution’. 🙂
BA77
I would be interested in reading Tomkins reply to AoS criticisms. Can you point to where he responded to them on UD? I was unaware that he did so.
The BLASTN analyses done in this paper were performed after stripping all N’s from the data set and sequence slicing the large contiguous sequence into optimized slice sizes – all done on a local server using optimized algorithm parameters. My data not only takes into account gaps, but sequences present in human and absent in chimp, and vice versa. Doing an amateur armchair analysis on the BLAST web server with default parameters never designed for a one-on-one large scale genomic regional comparison as noted in the comment above by aceofspades25 is bogus. Of course, if the paper was actually read in it’s entirety in regards to the above comments this would have been obvious.
Also, as noted in several evolutionary papers, which I cited in my paper, the large scale comparison and major differences in structural variability surrounding the GULO regions between humans and great apes in the intronic areas has been noted before. Interesting that the misleading post by aceofspades25 did not make note of that. My paper was in fact accurate in all respects and true to previous findings published by evolutionist themselves. My work just hashed out and exposed what was already known, but never previously elaborated upon because it shows just another aspect of what a complete fraud the human evolution paradigm truly is.
http://www.uncommondescent.com.....ent-500813
Mung:
Quoting Darwin from the Origins:
I never noticed this before, but Darwin’s logic here seems to almost perfectly parallel Hume’s view on ‘causality.’ When you look at things real close, Hume would say, you can’t “see” causality, you only “see” one thing happening after another thing.
Yes, the errors of “empiricism”!
Hey PaV,
Actually that quote is from his correspondence.
http://www.darwinproject.ac.uk/letter/entry-3154
wd400 wrote @ 110:
ATAGTCGATCGATCGATCGTACGAGGGGGGGTACGTACGTAGCATCGTAGTCAGACTG
ATAGTCGATCGATCGATCGTACGAGGGGGGGTACGACGTAGCATCGTAGTCAGACTG
Ok I’ll bight. What is the effect of the possible extra ‘T’ nucleotide in the first string? Does it cause no change to the reading of the base triplets (I count 19 base triplets in the lower sequence and 19 base triplets +1 single nucleotide base in the upper sequence … err I think), is it an ‘indel’ and will be ignored, or are all the following base triplets now totally different due to a ‘shifting’ by one location in the code read?
Dang your right wd400, it turns out that even Harvard trained biologists ‘Don’t Really Get Evolution”
A New Hire at the National Center for Science Education Admits “Many of Us Don’t Really Get Evolution” – Donald McLaughlin June 3, 2014
http://www.evolutionnews.org/2.....86351.html
Professor Jerry Fodor confessed, ‘I don’t think anybody knows how evolution works.’
http://creation.com/creation-religious-education
wd400, if you threw out everything that did not match, how close do you think kangaroos would be to humans?
Kangaroo genes close to humans
Excerpt: Australia’s kangaroos are genetically similar to humans,,, “There are a few differences, we have a few more of this, a few less of that, but they are the same genes and a lot of them are in the same order,” ,,,”We thought they’d be completely scrambled, but they’re not. There is great chunks of the human genome which is sitting right there in the kangaroo genome,”
http://www.reuters.com/article.....P020081118
willh,
This isn’t a real gene – it’s just illustrative of what Tomkins method does.
Those two sequences differ by one indel (there’s one base present in the first that’s not present in the second) so it seems to me like they are 57/58 ~ 98% identical.
The way Tomkins runs his analyses the sequences would score ~60% as he counts only the largest alignable and does not allow gaps in the alignment.
A small nucleotide difference can certainly make a large practical difference (though I should point out almost none of the genome codes for proteins), but that’s not the point Tomkins makes.
It seems a very stange way to compare genomes to me….
wd400,
Ok now I see a bit better what your getting at. My change in function question, though I’m sure a bit naive, was only to make some sense of any ‘real’ (even though your example is a hypothetical gene) effect causing the 98% difference to drop to a 60ish%. But now it’s one of a view of expression and not function perhaps? Begging pardons all round.
I think though that an argument as to why the differences, beyond what differences should be included, exists … but that is perhaps another topic or the next one maybe?
Willh,
It’s not really expressoin (in the biological sense) or function, but a purely methodological question. Given those examplar sequences
ATAGTCGATCGATCGATCGTACGAGGGGGGGTACGTACGTAGCATCGTAGTCAGACTG
ATAGTCGATCGATCGATCGTACGAGGGGGGGTACGACGTAGCATCGTAGTCAGACTG
it seems to be the sensible alignment is
ATAGTCGATCGATCGATCGTACGAGGGGGGGTACGTACGTAGCATCGTAGTCAGACTG
ATAGTCGATCGATCGATCGTACGAGGGGGGGTAC-GACGTAGCATCGTAGTCAGACTG
where ~98 of bases are shared. Tomkins, as far as I can tell, explicitly prevents gaps so his method would say this is the best alignment possible
ATAGTCGATCGATCGATCGTACGAGGGGGGGTAC
ATAGTCGATCGATCGATCGTACGAGGGGGGGTAC
The way he counts similarity he’d say only 35 of the 58 bases align so these sequences are about ~60% percent similar.
That doesn’t seem like a reasonable way of comparing these sequences to me
Hmm, the WordPress html parser doesn’t like tags it seems. The middle alignment should be:
ATAGTCGATCGATCGATCGTACGAGGGGGGGTACGTACGTAGCATCGTAGTCAGACTG
ATAGTCGATCGATCGATCGTACGAGGGGGGGTAC-GACGTAGCATCGTAGTCAGACTG
“That doesn’t seem like a reasonable way of comparing these sequences to me”
Thus once again I ask,,
wd400, if you threw out everything that did not match, how close do you think kangaroos would be to humans?
Kangaroo genes close to humans
Excerpt: Australia’s kangaroos are genetically similar to humans,,, “There are a few differences, we have a few more of this, a few less of that, but they are the same genes and a lot of them are in the same order,” ,,,”We thought they’d be completely scrambled, but they’re not. There is great chunks of the human genome which is sitting right there in the kangaroo genome,”
bornagain77 excerpted,
According to some, this is even Greater Proof of Convergent Evolution! To me it indicates something really interesting is going on.
-Q
OT: podcast – “Jonathan Wells: Is There Biological Information Outside of the DNA?, pt. 2”
http://intelligentdesign.podom.....1_53-07_00
Stephen Meyer – Advancing the Scientific Debate – video
https://www.youtube.com/watch?v=kNCpBYus7ds
According to some, this is even Greater Proof of Convergent Evolution!
Nope. There’s no suggestion of convergent evolution between human and kanagaroo genomes. This result is about shared genes, and that the order in which some those shared genes line up on chromosomes is conserved (the exact opposite of convergence actually).
Since you’ve tried to make something out of Tomkins results, do you agree with him that the sequences I posted about are ~60 similar? If you don’t, what do you make of his human chimp studies now?
So the people who did the analysis state
“,,,”We thought they’d be completely scrambled, but they’re not.”
and yet wd400 states it is not really that surprising at all. They are merely ‘conserved’. i.e. WA LA wave the magic Darwin wand and all problems disappear.,,, And remember don’t ever, ever, ask to peek up his sleeve for actual empirical evidence! 🙂 Just sit back and enjoy the show!
For instance, questions like this are forbidden:
But wd400, if you threw out everything that did not match, how close do you think kangaroos would be to humans?
No questions are forebidden – you’ve just shown yourself to not be worth my time.
FWIW, I gather human and marsupial genes show about 70% identity using normal genetic measures. How knows what you’d get if your threw Tomkins method at it.
wd400, so if you threw out everything that did not match as atheists do with their biased analysis of human chimp comparison you would get 70%??? Funny that is the figure that Tomkins reached. 🙂
You see wd400, (although you think you already know everything and nobody understands evolution save you and a few other elites) it might interest you to know that if you threw out everything that did not match, as atheists do in their biased comparisons of chimps and humans (even neglecting ORFans in many studies), you would approach 100% similarity for kangaroos and humans as atheists did. But if you compare genomes as you say ‘normally’ then you will get a gene count number that is rather stable across genomes:
Evolution by Splicing – Comparing gene transcripts from different species reveals surprising splicing diversity. – Ruth Williams – December 20, 2012
Excerpt: A major question in vertebrate evolutionary biology is “how do physical and behavioral differences arise if we have a very similar set of genes to that of the mouse, chicken, or frog?”,,,
A commonly discussed mechanism was variable levels of gene expression, but both Blencowe and Chris Burge,,, found that gene expression is relatively conserved among species.
On the other hand, the papers show that most alternative splicing events differ widely between even closely related species. “The alternative splicing patterns are very different even between humans and chimpanzees,” said Blencowe.,,,
http://www.the-scientist.com/?.....plicing%2F
“Where (chimps and humans) really differ, and they differ by orders of magnitude, is in the genomic architecture outside the protein coding regions. They are vastly, vastly, different.,, The structural, the organization, the regulatory sequences, the hierarchy for how things are organized and used are vastly different between a chimpanzee and a human being in their genomes.”
Raymond Bohlin (per Richard Sternberg) – 9:29 minute mark of video
http://www.metacafe.com/watch/8593991/
Moreover, where the difference is greatest is where the genome is found to be least likely to tolerate changes, thus undermining Darwinian claims for plasticity:
A Listener’s Guide to the Meyer-Marshall Debate: Focus on the Origin of Information Question -Casey Luskin – December 4, 2013
Excerpt: “There is always an observable consequence if a dGRN (developmental gene regulatory network) subcircuit is interrupted. Since these consequences are always catastrophically bad, flexibility is minimal, and since the subcircuits are all interconnected, the whole network partakes of the quality that there is only one way for things to work. And indeed the embryos of each species develop in only one way.” –
Eric Davidson
http://www.evolutionnews.org/2.....79811.html
Darwin or Design? – Paul Nelson at Saddleback Church – Nov. 2012 – ontogenetic depth (excellent update) – video
Text from one of the Saddleback slides:
1. Animal body plans are built in each generation by a stepwise process, from the fertilized egg to the many cells of the adult. The earliest stages in this process determine what follows.
2. Thus, to change — that is, to evolve — any body plan, mutations expressed early in development must occur, be viable, and be stably transmitted to offspring.
3. But such early-acting mutations of global effect are those least likely to be tolerated by the embryo.
Losses of structures are the only exception to this otherwise universal generalization about animal development and evolution. Many species will tolerate phenotypic losses if their local (environmental) circumstances are favorable. Hence island or cave fauna often lose (for instance) wings or eyes.
http://www.saddleback.com/mc/m/7ece8/
bonagain77,
Thanks for posting the Bohlin video—provocative and fascinating!
Seems like there’s a parallel between evolutionists’ wanting to obscure the significance of junk . . . er, I mean non-coding DNA, and the Wizard of Oz not wanting Dorothy to look behind the curtain.
-Q
Yes, that is a good video. I hope Sternberg publishes a paper on his work soon. Better yet, I hope that Sternberg and Tomkins collaborate on a paper. Now that would be a paper worth reading! 🙂
wd400:
I think ‘willh’ was trying to ask this question, so I’ll just go ahead and ask it:
If the sequence you give is off only by 2%, does this mean that it is off by 2% when it comes to ‘translation’? IOW, what would the a.a. sequence look like vis-a-vis the nucleotide sequence?
Why would mRNA, or tRNA, go along this sequence and then say: “Well, obviously these two sequences are meant to be the same, so I’ll just delete the one nucleotide, and then code for the rest.”
But, of course, there is nothing to compare to, since the sequence is either the one, or the other. Hence, I don’t see how the translational apparatus of the cell is going to do anything other than to translate the latter part of the sequence in terms of very different a.a.s.
If this sequence was in the tiny minority that are exonic then you’d have a broken gene. If Tomkins wanted to say small nucleotide differences can make large practical difference then he could have. But that’s not what he’s saying.
He’s saying those two sequences are 60% similar. I invite anyone who wants to defend that claim to do so….
(I’m almost beginning to suspect the anti-evolutionists “skepticism” is very selectively applied…)
wd400:
What’s the difference between these two statements:
1.) “Small nucleotide differences can make large practical difference[s].”
and,
2.) “Small nucleotide differences [can make] ‘two sequences’ [only] 60% similar.”
Isn’t this a distinction without a difference?
Nah, the skepticism is general and broad-based. It’s the hyper-skepticism that’s selective. 🙂
Are those two sequences 60% similar?
Yes, they’re 60% similar if, when translated, they share only 60% of the a.a.s.
…But the sequences are not 60% similar… and the same rules will apply to the 98% of the genome that never get made into proteins. So…
wd400,
A student takes a midterm exam in your class. Unfortunately, she skips a question and she shows you that the multiple choice answers in the second half of the test are all shifted by one.
If the student’s answers would otherwise have been all correct, what grade would you give her, 60% or 98%?
Now, if her answers are not otherwise all correct, but merely better, would you give her the better score? (Attention students, this would make a great app!)
And what if she’s really pretty? 😉
-Q
98%, as I think any reasonable person would…
I should add, if you compare actual amino acid sequences between humans and chimps are > 99% identical so I don’t the amino acid sequences are gong to save Tomkins
I didn’t ask you about amino acid sequences.
-Q
And what about more than one shift?
-Q
PaV asked about the a/a sequences. I’m not going to play a thousand questions with you, especially if you can’t answer one simple one.
Are those sequences 60% similar?
BA77 @73 “having the same proteins show up in widely divergent species is devastating against Darwinian claims because, number one, no one has ever seen unguided processes generate a protein..”
And nobody has ever seen a protein (or anything) generated by a non-human intelligence either. So what’s your point?
wd400:
Which are not? The nucleotide or the a.a. sequence?
Well, if it’s the 98% that doesn’t code, then it might be just as bad, or even worse. Let’s remember, the cellular chemistry that’s involved here does not ‘know’ that the last part of the nucleotide sequence is ‘off by one nucleotide.’
If the function of the ncRNA is to ‘bind’ to some molecular machine of one sort or another, then being one position off—but now ‘one position off’ along the entire length of the sequence which is off by one—would likely cause considerable problems.
Are those sequences, as typed above, 60% similar? Is it so hard for someone to for at least one anti-evolutionist to go against one of their fellow travellers?
They are 60% similar.
Lol.
Take the top line of your sequence string, then reverse it completely. Per your logic, they are 100% identical. Why? Because you’re making the location along the string immaterial.
The difference of opinion seems to be a matter of perspective (or preference) of how the alignment is interpreted.
In order to attain 98% alignment, the insert must be deleted, and the deletion is justified if we assume the sequences have a common ancestor.
However, in the absence of any assumptions regarding the origin of the sequences (and the subsequent deletion), the alignment is only 60% similar.
littlejohn:
I don’t think that it’s only a matter of accepting or rejecting some kind of common ancestry; rather, it’s about the importance of not only the ‘kind’ of nucleotide at a particular location, but the location itself: both are important.
wd400:
Let’s remember that Tomkins’ study has to do with exon areas in the GULO region; so, it’s not non-coding DNA. Nonetheless, as I’ve pointed out, even if it’s ‘nc’ the locations become important.
It’s not about assumptions, it’s about those two sequences. I find it really hard to imagine anyone can really think they are 60% similar. But even if you grant that they are, it shows how little Tomkins 70% numbers mean, and that they don’t contradict the 98% number everyone else who looks at these sequences arrives at.
PAV, I wasn’t talking about his GULO paper, which is apparently contaminated by the same method. But GULO is a psedeudogene full of in-frame stops so not coding. And most of the non-coding portion of the genome is not conserved within- or between species, so sequence changes evidently make little or no difference.
In the case of a psuedogene, my analysis would be along these lines: there is an ‘insertion’ that takes place along the length of the sequence which has the effect of disrupting slightly, or more likely, more than slightly the ‘binding’ of the resulting RNA sequence, which is likely part of the regulatory function of pseudogenes. In this case, I would then accept the 98% figure.
Just for fun – blasting all of chromosome 22 against all of chimp chrom. 22. The longest Tomkins hit is 7910bp out of 51304566. The human and chimp genomes are only ~0.00154% similar by this measure!
wd400, what more proof do you need that they do not share a common ancestor?
Dr. Tomkins, states this in regards to ‘amateur armchair analysis’:
“The BLASTN analyses done in this paper were performed after stripping all N’s from the data set and sequence slicing the large contiguous sequence into optimized slice sizes – all done on a local server using optimized algorithm parameters. My data not only takes into account gaps, but sequences present in human and absent in chimp, and vice versa. Doing an amateur armchair analysis on the BLAST web server with default parameters never designed for a one-on-one large scale genomic regional comparison as noted in the comment above by aceofspades25 is bogus. Of course, if the paper was actually read in it’s entirety in regards to the above comments this would have been obvious.
Also, as noted in several evolutionary papers, which I cited in my paper, the large scale comparison and major differences in structural variability surrounding the GULO regions between humans and great apes in the intronic areas has been noted before. Interesting that the misleading post by aceofspades25 did not make note of that. My paper was in fact accurate in all respects and true to previous findings published by evolutionist themselves. My work just hashed out and exposed what was already known, but never previously elaborated upon because it shows just another aspect of what a complete fraud the human evolution paradigm truly is.”
http://www.uncommondescent.com.....ent-500813
Moreover, in regards to calling into question wd400’s assertion of 98% similarity, number 1, it is interesting to note how extremely complex the gene actually is now compared to just a decade ago:
Also of note at the end of the video Dr. Bohlen states:
and number 2, the genomes are not 98% similar:
Humans and chimps have 95 percent DNA compatibility, not 98.5 percent, research shows – 2002
Excerpt: Genetic studies for decades have estimated that humans and chimpanzees possess genomes that are about 98.5 percent similar. In other words, of the three billion base pairs along the DNA helix, nearly 99 of every 100 would be exactly identical.
However, new work by one of the co-developers of the method used to analyze genetic similarities between species says the figure should be revised downward to 95 percent.
http://www.caltech.edu/content.....arch-shows
Guy Walks Into a Bar and Thinks He’s a Chimpanzee: The Unbearable Lightness of Chimp-Human Genome Similarity – 2009
Excerpt: One can seriously call into question the statement that human and chimp genomes are 99% identical. For one thing, it has been noted in the literature that the exact degree of identity between the two genomes is as yet unknown (Cohen, J., 2007. Relative differences: The myth of 1% Science 316: 1836.). ,,, In short, the figure of identity that one wants to use is dependent on various methodological factors.
http://www.evolutionnews.org/2.....think.html
as to biased methodological factors of Darwinists:
Genome-Wide DNA Alignment Similarity (Identity) for 40,000 Chimpanzee DNA Sequences Queried against the Human Genome is 86–89% – Jeffrey P. Tomkins – December 28, 2011
Excerpt: A common claim that is propagated through obfuscated research publications and popular evolutionary science authors is that the DNA of chimpanzees or chimps (Pan troglodytes) and humans (Homo sapiens) is about 98–99% similar. A major problem with nearly all past human-chimp comparative DNA studies is that data often goes through several levels of pre-screening, filtering and selection before being aligned, summarized, and discussed. Non-alignable regions are typically omitted and gaps in alignments are often discarded or obfuscated.
In an upcoming paper, Tomkins and Bergman (2012) discuss most of the key human-chimp DNA similarity research papers on a case-by-case basis and show that the inclusion of discarded data (when provided) actually suggests a DNA similarity for humans and chimps not greater than 80–87% and quite possibly even less (70%).
http://www.answersingenesis.or.....n1/blastin
And that is not even taking into consideration the over 1000 completely unique ORFan genes. Thus, why is it so important for wd400 to continue to propagate the myth that chimps and humans are 98% identical. Well although I have no clue as to what motivates wd400 to be so unfair in his treatment of the evidence, my first hunch is that the 98% similarity myth is the only game in town for wd400. Empirically speaking, He simply has nothing else to appeal to. Empirically, He cannot even account for the fixation of two coordinated ‘beneficial’ mutations much less a massive overhaul of the genomic architecture and structure.
A False Trichotomy
Excerpt: The common chimp (Pan troglodytes) and human Y chromosomes are “horrendously different from each other”, says David Page,,, “It looks like there’s been a dramatic renovation or reinvention of the Y chromosome in the chimpanzee and human lineages.”
http://www.uncommondescent.com.....richotomy/
Of related interest, in post 129 wd400 states:
Which is interesting since that 70% figure, besides turning up in Dr. Tomkins analysis of chimp and human genomes, also turned up here:
If that was not bad enough, a few months ago it was found:
Of course wd400 will throw out words such as ‘conserved’ and ‘convergent’ and wax poetic as to how the changes did and did not occur, with NEVER an empirical demonstration of what he claims, but the plain fact of the matter is that findings such as these (of which there are many more examples which could be cited) are not expected from basic Darwinian presuppositions. ,,, contradictory findings All of which goes deeper into the issue of the non-falsifiability of the Darwinian hypothesis. i.e. no matter what finding, Darwinists, since Darwinism has no demarcation criteria so as to separate it as a true science instead of a pseudo-science, are always able to make up a ‘just so’ story as to why it is not a problem for their beloved theory.
wd400:
It’s a good thing Tomkins doesn’t write plagiarism detection software. If someone copied a whole book (say, 200 pages of text) and then omitted a letter or inserted a comma once per page, Tomkins’s method would demonstrate that the original and the copy ale less than 1% similar.
Pav wrote:
I think ‘willh’ was trying to ask this question, so I’ll just go ahead and ask it:
If the sequence you give is off only by 2%, does this mean that it is off by 2% when it comes to ‘translation’? IOW, what would the a.a. sequence look like vis-a-vis the nucleotide sequence?
Yes something like that thanks. I think though upon reflection, that the example given wouldn’t perhaps read different as to its triplet translation, or should I say that no one including Dr Tomkins is saying it will. How the deletions and indels are identified and not confused in translation beats me, please if anyone can and wants to explain I’m all ears.
I think that if Dr Tomkins did deign to take a look at the ‘gene’ wd400 proposed, he would agree on the 98% similarity. But what Dr Tomkins seems to be saying to me (I will have to re-read some stuff to be sure), is that the deletions and indels actually add up to cause an 85% similarity only; this when only comparing protein coding regions, as was claimed of the original human / chimp analysis.
But Dr Tomkins compares other factors of the genomes as well, which then further reduces the similarity to the average of 70%. Are these other regions or are they other differences within the protein coding area of the genome? What do you think people?
Whatever view is taken as to the strong similarities, the differences must be explained by some mechanism though.
Piotr, since wd400 refuses to address the evidence on its merits, perhaps you can give me a clue. Why is it so important for you to believe that neo-Darwinian processes generated humans in spite of the fact that neo-Darwinian processes are shown to be grossly inadequate of accomplishing such a transformation in form?
The empirical evidence simply refuses to cooperate with Darwinists. Thus Piotr, since you have no evidence to support you belief that such a transformation is possible by unguided Darwinian processes, why is it so important for to believe that it did happen by unguided Darwinian processes?
Sorry, here is the Meyer video:
Stephen Meyer – Functional Proteins And Information For Body Plans – video
https://vimeo.com/91322260
bornagain77@159 posted
After which Piotr@162 chortled to wd400:
Apparently, Piotr’s mind is made up, regardless of any information to the contrary. In his last sentence, I believe that “ale” should be “are.”
What is it about Tomkin’s statement, “My data not only takes into account gaps, but sequences present in human and absent in chimp, and vice versa,” that Piotr and wd400 cannot bring themselves to accept?
Note, I’m not saying that they should accept Tomkin’s conclusions, but simply to admit that Tomkins asserts that he did indeed take into account gaps.
-Q
Querius:
This is what Tomkins says in his article, in the section “Genome Comparison Philosophy and Approach” (emphasis added):
This means that (1) if there were two or more alignments per database hit, only one was taken into account; (2) indels weren’t included (only non-gapped alignments counted). In his statement, Tomkins “says a thing which is not”, as the Hounyhnhnms would put it. Can’t you see through these tricks? What’s wrong your reading comprehension skill, folks?
Of course “Tomkins asserts that he did indeed take into account gaps”.
The method he described in his papers works exactly as I have illustrated. I guess it’s left as an exercise to the reader to decide what Tomkins means by “accounts for”. The most charitable interpretation is that he means gaps are counted as differences — which is definitely true!
Piotr asks:
Which I find to be a VERY ironic thing for a Darwinist to say. The whole theory is based on smoke and mirrors, where, as Dr. Hunter has pointed out numerous times, all contradictory evidence is magically turned into evidence supporting Darwinism. Well contrary to what Piotr and wd400 would prefer to believe, There are many people, including one of the co-developers of the method used to analyze genetic similarities between species, and even he said, in 2002, that the 98.5% figure should be revised downward to 95 percent. The situation has only gotten worse since 2002. Even Jerry Coyne, certainly no friend to ID, admitted that over 1400 hundred genes (6%) have no counterpart in chimps and are ‘ORFans’. Thus, subtracting 6% from 95%, the 89% figure is reached using numbers that Darwinists themselves have supplied! Moreover, there are good reasons for doubting Darwinian presuppositions of non-functionality are true.,,, For instance, synonymous mutations which spelled for the same amino acid within the genetic code were thought by Darwinists to be of no effect, but, as would be presupposed from a design perspective, it was found that even synonymous mutations can have a pronounced effect:
Thus, even for a supposed minor variation, Darwinian presuppositions about functionality were, to put it mildly, misleading as to what was actually found. This is not an anomaly at the edges either that I’m picking on. Darwinian presuppositions about non-functionality have been a major hindrance throughout its history. From vestigial organs to the current fiasco with ‘Junk’ DNA, Darwinian presuppositions about non-functionality have been a hindrance to research. After decades and decades of such tripe from the pseudo-science that is Darwinian evolution, we can turn Piotr’s question around to himself and ask of him ‘Can’t you see through these tricks?’
P.S. Many different similarity metrics are possible, and they may yield different percentages (nothing wrong about that as long as the author is clear about what exactly is being measured). If you use the same metric for, say, human vs. chimp, human vs. macaque, and chimp vs. macaque genomes, it’s a safe bet that Homo and the chimpanzee will consistently turn out to be more similar to each other than either is to macaques. What really counts, however, is not how close a given similarity metric is to 100%, but whether similarities and differences are structured hierarchically (reflecting phylogenetic relationships). And yes, they are.
Bornagain 77, you know where you can stuff your red herrings.
Red Herrings??? Stuffing Herrings in your empty head??? Why would you suggest such things??? 🙂 Excuse me, but you guys are the ones arguing for 98.5% similarity and yet, contrary to the fictitious sequence wd400 pulled out of his, errr, imagination, ,,,
Moreover,
All in all, Dr. Tomkins sober criticisms against the ‘defend until death’ 98.5% myth of Darwinists are very well warranted:
Call it a Red Herring and stuff it in your empty head if you want, but I simply see no reason why I, nor anybody else, should put any confidence in what you guys are saying.
PS, perhaps one of these days you guys will actually get to dealing with the quantum falsification of the materialistic underpinnings of Darwinian thought?
wd400 I agree that the example you give is not 60% but I do not know how closely this relates to how Tomkins did it and seems to me a simplistic way of looking at it.
The converse problem is when you get things like this:
ATCGGCTCGCCATAATCAT
ATCGG——ATATTCAT
Where historically those would give only 1 mis alignment base as the analysis refuses to take into account indels when making comparisons. So instead of 1/12 non-identity to me this would be 7/18 non-identity. It seemed to me that Thomkins was taking these, and non-alignable genes into context, as opposed to the example you give above. But I may be wrong there, Tomkins would be best to answer that. However, the point still remains about indels as often they are not simply 1 base indel. Additionally, to ignore genes present in one organism but not another and not include those in the comparison you must accept is a biased view, especially as those genes are likely to contribute to how/why we are different, which is the whole point of genomic comparisons.
You would expect 2 different models of a car to have many similar components, but the extra/different ones are what make them the unique car. To ignore indels (which have been shown to have function often) and novel genes/orphans etc, seems silly in a true “comparison”.
Furthermore, in the example you show above if in an exonic region that 1 insertion would cause a complete frameshift changing that protein. Often this is OK if near the end of the sequence/domain however would likely be detrimental to its function if elsewhere, meaning even if it had function it would likely be very different to the one you are comparing it to, if it actually was a working gene.
Finally, it is well established among non-creationists that the Chimp and human Y-chromosome are quite remarkably different. I do not know how much indepth similar analysis has been done for other chromosomes though:
http://www.ncbi.nlm.nih.gov/pubmed/20072128
Sure – there is no One True Similarity measure. If you want to include all the bases missing in one species in present in other as dissimilarity that’s perfectly reasonable, and that’s how you end up with ~95%. But then you’d have to realise that far fewer mutatoins are required to explain the indel differences than the single nucleotide differences, so 95% is not such a great gap.
I do understand what a reading frame is. I’ll repeat myself one last time — almost none of the genome is protein coding and if Tomkins had wanted to say that small nucleotide differences can make large partical differences that’s what he should have said instead of claiming large nucleotide differences.
You mention the Y-chromosome, without poingting out this stufdy is on the non-recombining portion of the Y which is subject to very different evolutionary pressures that the rest of the genome as it can’t recombine (so the effects of selection are global) and it’s full of male-specific genes
Of related interest to the 98.5% similarity myth, is the biased methodology, in 1970’s, used in deriving the original 98.5% figure:
But what is really interesting about this ‘biased sampling’ is what Wilson and King themselves said about it
And indeed it is found that if you want to generate a fundamentally new body plan then you have to make changes to genomic regulatory regions:
Moreover these regulatory regions are found to be very different:
Thus, where the differences are greatest is exactly where changes are least like to be tolerated, yet it is exactly in these drastically different regions that Darwinism needs flexibility the most. Thus, like the old joke, Darwinists are like the drunk looking for his keys under the streetlamp because the light is better there even though that is not where he lost them.
Of note to Wilson and King’s observation of many anatomical differences between humans and chimps,, it is interesting to note that so great are the anatomical differences between humans and chimps that a Darwinist actually proposed that a chimp and pig mated with each other and that is what ultimately gave rise to humans:
Moreover, Physorg published a subsequent article showing that the pig-chimp hybrid theory for human origins is much harder to shoot down than Darwinists had first supposed it would be:
The obvious question for me is, of course, since Darwinists are having such a hard time proving that we did not come from pig-chimp hybrids, what makes Darwinists so sure that we evolved from apes or anything else in the first place? Any reasonable person would realize that if such a dubious theory as the pig-chimp hybrid theory can cause such havoc, for what was suppose to be such well established science, then perhaps the Darwinian theory for human origins is not nearly as strong as Darwinists have dogmatically held it to be in the first place. Some might even hold that such ‘flimsiness’ would clearly indicate the original theory was rubbish as to being hard science.
Verse and Music:
A Listener’s Guide to the Meyer-Marshall Debate: Focus on the Origin of Information Question -Casey Luskin – December 4, 2013
Excerpt: “There is always an observable consequence if a dGRN (developmental gene regulatory network) subcircuit is interrupted. Since these consequences are always catastrophically bad, flexibility is minimal, and since the subcircuits are all interconnected, the whole network partakes of the quality that there is only one way for things to work. And indeed the embryos of each species develop in only one way.” –
Eric Davidson
http://www.evolutionnews.org/2.....79811.html
Dr JDD,
According the article, “Comparing the human and chimpanzee genomes: Searching for needles in a haystack” (Ajit Varki1 and Tasha K. Altheide):
However, the chimpanzee genome has about 3.0 Bb (about 18.8k coding genes), while the human genome has about 3.3 Bb (about 21.0k coding genes). Thus, the human genome is about 10-12% larger than the chimpanzee genome.
This is admittedly simplistic, but even assuming that the chimpanzee’s genome is 100% identical with that of the human genome, which of course it’s not, the 10-12% size increase in humans would not result in a 98% agreement.
So is the larger size of the human genome simply ignored?
-Q
Hi Querius,
Thanks for your comments. I believe the original 98.5% figure came from aligning very small sections of some gene-coding DNA from humans and chimps and extrapolating up the similarity. I may be wrong, but that has always been my impression of the original work to come up with that figure. As you say, quite clearly this is obviously wrong given that simple fact you state, that the differing sizes in the genome exclude the possibility of true overall similarity of 98.5%.
You could argue that additional information would be the result that could be expected after divergence from a common ancestor, but again the point is 98.5% is mis-leading and based on the assumption that a lot of apparent non-coding DNA information at the time is now known to have function and not be functionless. Furthermore, I wonder about the implications of the number of true differences between chimp and human DNA and how this fits in with the theory of neutral evolution.
As for wd400’s objections, I have finally had a chance to read through the Tomkins original paper in detail and I do not agree with his assessment of how Tomkins has done this work, nor do I know why he is assuming what Tomkins has done equates to his example. Here are some pertinent quotes from the publication:
So first you can see Tomkins went to great length to determine the optimal slice size to analyse to ensure the highest percentage alignment (most conservative estimate, where being conservative means they are very similar). He found with some chromosomes, longer stretches and shorter stretches analysed gave lower similarity percentages, so he optimised the slice length for each chromosome’s DNA, whilst not going too small to skew a result.
Further:
First thing to note, he uses “optimally aligned” analysis. Therefore, I do not understand how wd400 comes to his conclusion because by definition, the example he gives is clearly not “optimally aligned.” Again, Tomkins was trying to be as conservative as possible here. Further, he stripped N’s from the analysis and this is the correct thing to do as these have no definition of base therefore cannot be said to align. These are removed, so he is not taking that position into account which is the correct and fair way to analyse. Finally, he also did not include stretches of chimp/human DNA that could not be aligned and anchored to its respective comparative genome so again, the percentage given is conservative.
There are some important points in the text quoted above.
Wd400 – could you point me to the methodology or statements in this publication that justify your example as one like what Tomkins used? What is your definition of “optimal alignment” that Tomkins has used that leads you to choose the example you give as an accurate representation of how he performed this analysis? I am genuinely interested how you arrived at this conclusion as I cannot see it myself, although I may be wrong as I may be missing something here.
Thanks,
JD
Thanks Dr JDD:
I was going to read through the paper myself to find out exactly what Tomkins did. I have it printed out and next to me. The fact that you’ve read the paper and analyzed it spares me the labor of doing so.
You see, at this point in the Darwinian debates, I have very little interest in doing things like this. Once I had plenty of energy and motivation to do so; but now, with study after study coming out each day that flies in the face of strict Darwinian thought, I don’t see the purpose anymore. It’s just a matter of time before Darwinism is forced to topple over.
ID as a project to “prove” the existence of God, or a Designer, is a non-starter. Science cannot do this; only philosophy and metaphysics can.
But, ID as a project pointing to a designing influence on the contents of cells and life in general, this, to some degree, will succeed. Just a matter of time, as I say.
The thing you are missing is that tomkins explicitly prevents alignments from including a gap. That combined with the fact only one alignment is kept means he is basically estimating the average gap between indels and rearrangements, not similarly in any normal sense
Thanks for the reply wd400 but as above, please can you point to where in the publication this is stated or explained.
If what you are saying is true I would expect 3 things:
1) the percentage to actually be much lower than stated (as per your example above)
2) the larger the slice, the lower the similarity should be (but this does not seem to hold true as per slice size optimisation results?)
3) the results to show disparity to previous published intense results (it seemed to corroborate the MSY alignments published in 2010)
If you can show us in that publication where it shows he takes this approach it would be helpful.
Thank you Dr JDD for reading through Tomkins’ original paper in detail and drawing out just how conservative he was in his approach. If I read what you excerpted from his paper correctly, he did not even include ORFan genes in the count. Thus when he presents his upcoming paper, if he includes ORFans (as well as dGRNs), the percentage should drop even further than the 70% figure that wd400 is currently having such a hard time accepting,
In congruence with all this I would like to draw out two things. First, I would like to reiterate that the anatomical differences, as Wilson and King themselves pointed out in the original 1975 paper, are far more drastic than the mythical 98.5% gene similarity number indicates. This disparity is also backed up by the fact that, anatomically speaking, humans are closer to pigs than chimps. Thus, other than rhetorical purposes for Darwinists, the mythical 98.5% figure is useless for trying to figure out what makes humans and chimps unique from each other. This was all pointed out in post 175 of the current thread:
The second point that I would like to draw out is something I pointed out on another thread the other day. Although Darwinists are notorious in their hubris for claiming they know for a fact how all life on earth originated, the truth is far more humbling. We are far from understanding how a organism operates in any sufficient detail, much less understanding how any organism on earth originated. Even the cellular complexity of the ‘simplest’ life on Earth has turned out to be nearly unbelievable:
Thus researchers have not even ‘realistically’ modeled even the simplest life on Earth to the molecular level. And our ignorance at how organisms actually operate at the molecular level is orders of magnitude more acute for higher organisms than it is for the ‘simplest’ life. In fact, it is almost a guaranteed certainty that mortal man will NEVER understand how multicellular organisms operate in any meaningful detail at the molecular level:
And that is the monumental brick wall facing researchers in just trying to understand how an existing organism operates on a day by day, moment by moment, fashion at the molecular level. As to how a single cell on millions of protein molecules transforms itself through embryogenesis into a coherent single living organism containing 100 trillion cells, at a billion trillion protein molecules total, without falling into complete disarray is a miracle upon the miracle of merely existing that is even more astonishing.
And yet Darwinists, apparently completely oblivious to the miracle that is a billion trillion protein molecules all operating in a cohesive fashion to keep their bodies alive, and oblivious to the fact that NO ONE has a clue how that miracle all ‘comes together’ into a cohesive whole, dogmatically pretend as if they know for a fact how all life on Earth originated. In fact wd400 is notorious for proclaiming that ‘we just don’t understand evolution’ like he does.,, Unbounded pride in towering ignorance is a fair assessment of the Darwinian mindset!
Verse and Music:
I refer you to my comment #110, which quotes Tomkins
BLASTN algorithm parameters for the main study were as follows: -word_size 11, -evalue 10, -max_target_seqs 1, -dust no, -soft_masking false, -ungapped.
-ungapped.
wd400, does it not bother you in the least that you have no real empirical evidence supporting the feasibility of transformation of body plans, as is required in Darwinian evolution, but that you are reduced to squabbling over subjective interpretations of a misleading percentage figure??? A percentage figure that is, as Wilson and King admitted, moot to the point of explaining such radical body plan transformations as the chimp to a human in the first place??? It seems that if you were genuinely concerned with the truth of the matter, instead of just defending your preferred Darwinian worldview, then you would concede that your argument is an exercise in futility as far as true science is concerned.
etc.. etc.. etc..
BA77, again, less is more. You wouldn’t accept empirical evidence (and there is a lot) even if it is presented. Frankly, it is a waste of breath talking to you. Yes, I know that you will characterize it as refusing to answer the questions, but allow be to flip it back on you.
What empirical evidence do you have for an intelligent designer? And I mean real evidence. Observations of an intelligent designer creating a flagellum, a water vacuole, a consciousness, a fart. I want witnesses, fossils, biochemistry. In short, the same evidence that you repeatedly demand of evolution.
And see if you can do it without numerous meaningless references to creationist literature. All I am asking for is an eye witness. Because, apparently, that is all you will accept as evidence for the other side of the debate.
Acartia_bogart, remember this:
http://www.uncommondescent.com.....ent-502351
You said such and such would falsify Darwinism. When I showed that, using your own criteria, Darwinism was falsified, you refused to acknowledge it! Yet despite this cowardly act on your part, you go on to hypocritically state this:
“You wouldn’t accept empirical evidence (and there is a lot) even if it is presented.”
To which I say,
Yes I would. No there isn’t any. It has never been presented.,,, One molecular machine, such as the Bacterial Flagellum, arising by unguided processes would fit the bill quite well.
As to eyewitness evidence for God creating, what do you think of the whole Cosmic Background radiation thing? Two Nobel Laureates who discovered it consider it quite convincing:
The best data we have [concerning the Big Bang] are exactly what I would have predicted, had I nothing to go on but the five books of Moses, the Psalms, the bible as a whole.
Dr. Arno Penzias, Nobel Laureate in Physics – co-discoverer of the Cosmic Background Radiation – as stated to the New York Times on March 12, 1978
“Certainly there was something that set it all off,,, I can’t think of a better theory of the origin of the universe to match Genesis”
Robert Wilson – Nobel laureate – co-discover Cosmic Background Radiation
As well:
“There is no doubt that a parallel exists between the big bang as an event and the Christian notion of creation from nothing.”
George Smoot – Nobel laureate in 2006 for his work on COBE
“Now we see how the astronomical evidence supports the biblical view of the origin of the world. The details differ, but the essential elements in the astronomical and biblical accounts of Genesis are the same: the chain of events leading to man commenced suddenly and sharply at a definite moment in time, in a flash of light and energy.”
Robert Jastrow – Founder of NASA’s Goddard Institute – Pg.15 ‘God and the Astronomers’
If you do not consider that positive evidence for God, there is really little I can do save to expose you for the dogmatist, instead of true seeker, that you are.
Dr JDD,
Thanks so much for taking the time to explain Dr Thomkins’ conservative methodology! And also for confirming that the 98.5% figure is cherry-picked, and the larger genome in humans seems to be either ignored, or explained away as evolutionary divergence without even the slightest twinge of concern that the chimpanzee genome should also have been similarly diverging during that time, perhaps keeping pace with the human genome. But as has become ever clearer,
The theory of evolution can explain anything, but successfully predicts nothing.
In other words, if the chimpanzee genome were discovered to be 10-12% larger than the human genome, this would also be effortlessly “explained” somehow.
As it’s becoming increasingly apparent to all but the most ideologically contaminated, a theory that’s infinitely malleable is utterly useless.
-Q
Hi wd400,
I suspected that this is where you were getting the “not taking into account gaps” from: the use of “-ungapped” in that materials in methods. However, the reason I probed is because I am honestly unsure of what this refers to and cannot make the inference that it simply does not take into account gaps at all. That is one scenario, but based on the language throughout the publication about the most optimal sequence alignment, that is the most conservative, I find it odd if this was the case.
However I am not a programmer, although I regularly use the BLAST programs (but rarely BLASTN, usually BLASTP) and always use the GUI selections provided with the online query forms. However, I did come across this:
http://biopython.org/DIST/docs.....html#ungap
Perhaps someone with more computer knowledge than me can try to interpret what this means. To my simple mind, it appears that the “ungap” could refer to removing any gaps in the original sequence (i.e. any unannotated sequence, such as “-“ as opposed to not allowing gaps in the alignment). It would be most useful if someone like Tomkins who regularly uses the scripts for performing BLAST analyses could in fact confirm what “-ungapped” actually does in this context. I.e. if it does not take into account gaps in an alignment (so just performs a very rigid best fit alignment), or removes annotated gaps prior to any alignment, or, something else I have not considered here. I cannot make the assumption one way or another that “-ungapped” refers to a very specific alignment tool as it would be purely an assumption of speculation.
As per the points above, I would expect the alignments to be even lower if the analysis was done as per your original suggestion, and, in particular the fact that this seems to agree with other published work for example the detailed look at the MSY chromosome.
JDD, don’t take it from me. Download the BLAST executables and compare the two sequences I posted with and without the ungapped flag. You will see I am right.
I don’t why you keep on going on about the Y chromosome. As I have said it behaves different from the others, including in Tomkins analysis which does not find 70% similarity for the Y. Tomkins numbers don’t agree with any published results in real journals.
I really find it bizare that you and other evolution “skeptics” would go to such lengths to protect a study with a conclusion you’d like to be true.
“Doing an amateur armchair analysis on the BLAST web server with default parameters never designed for a one-on-one large scale genomic regional comparison as noted in the comment above by aceofspades25 is bogus”
– Tomkins
Moreover, there is good reason to believe that hidden, and unproven, assumptions lie at the base of many of the algorithms making genetic comparisons:
As well, contrary to what wd400 would prefer to believe, and in spite of these biased algorithms, the overall genetic tree of life is turning out to be as much, if not more, of a problem for Darwinists as the fossil record has turned out to be:
Thus wd400’s reliance on genetic similarity in order to make his case for Darwinian evolution is not nearly as robust as he imagines it to be. Moreover, the trend in evidence with RNA’s is even worse than the DNA comparisons were for Darwinists:
Thus, when taking the whole body of knowledge into consideration, there is very good reason to doubt that wd400 is being forthright with us with Tomkins current 70% study.,,, Hopefully this inability for wd400 to face the overall evidence soberly and honestly, and admit that his case is weak because of that overall body of evidence, to put it kindly, will change. But, I hold little hope that he will change. Sad!
@WD400: “I really find it bizare that you and other evolution “skeptics” would go to such lengths to protect a study with a conclusion you’d like to be true.
Do you really have to ask? Do “straws” and “clutching” come to mind?
Wd400:
I will when I have had time to download the program and try to replicate this but I am not an expert in that area and using that, thus do not want to wholly rely on my own inabilities to give the answer to the question I am asking. It would be easiest if Tomkins could directly address the question simply – if there is an indel, does that throw the alignment off giving a lower similarity than actually is there, like your example above.
I think your final paragraph is a bit unfair and assumptive. I am trying to establish what the exact methodology was around this issues with a shifting of the code due to indel and how that alters (if it does) the alignment. This is a scientific publication. Initially from what was said, it seemed like Tomkins went about a very conservative approach and also claimed to take into account gaps, thus I could not easily decipher from his publication any reason to assume that your example would in fact be counted the way you claim. This was compounded by the fact that when I tried to determine exactly what “-ungapped” codes for (as linked above) it appeared to me to remove pre-annotated “-“ gaps, but as I conceded, I may be wrong. I would like to take most scientific publications at face value, with regards to scientific methodology although it is worth questioning the method. Where I know little about some method though, I am at the mercy of the person who is meant to be the expert in that method. Where I usually disagree is in the interpretation of results and I believe many IDers are the same with evolutionary publications.
So where am I going to such lengths to protect this study? I think I have shown a clear desire to interpret the data correctly, and initially err on the side that the expert (Tomkins is an established geneticist who published many papers in the “secular” research world) knows what they are doing in terms of methodology. I have tried to interrogate the paper on those grounds. I am not going out of my way to try and protect anything.
I personally will happily concede that the findings are flawed if indeed it can be shown that Tomkins used the approach you state he has used, i.e. an insertion of a base 2/3 of the way down a stretch of DNA would take the alignment to 66% similar, a conclusion I disagree with. IF that is how this study was done, then yes I would personally not defend it nor use it as “proof” that chimps and humans are really only 70% similar at best.
And the reason I am apparently “obsessed” with the Y chromosome is that it is the only recent paper with a decent copy of the chimp Y chromosome that has gone to such depths to compare with the human one – that is the only reason I regularly quote it. That is not an agenda of mine, it is simply because I cannot find other recent publications that compare in that detail individual chromosomes beyond the gene-coding regions, as we now know that a fair amount of the genome is active and potentially has function, I am interested in the differences between all of the DNA, not just protein coding. I am interested in pseudogenes, in ORFans, in indels (many have function), in other non-coding areas of the genome. Clearly humans and chimps are very different so I am interested in where this comes from. If something is shown to be a bad study I will not personally use it as proof for my worldview. So please do not assume that, as nowhere have I gone to extraordinary lengths to defend something that is “obviously” wrong – my point is this is NOT obviously wrong. It may be wrong and you have provided an argument for that, which I am certainly trying to confirm and understand better. For now though, this [70% homology] is not something I would personally use in my defence of an ID view.
However the point remains – I (or anyone) don’t need this paper to be true to defend ID. If it was true, it would be quite strong evidence against common descent 6-7mya from chimps. However, that does not hinge on whether this is true or not. Much like what PaV alludes to above, there are numerous other studies not to mention mathematical models that point to the flaws of UCD and naturalistic evolution in the time-frame given to generate such believable attribution to the proposed theory and mechanisms. The emergence of epigenetics, the ENCODE data, the day-by-day increase in the apparent complexity of the genome especially with non-coding regions playing important functional roles, all of these things (to just name a mere handful) remain and they certainly are not “clutching at straws” – they are genuine issues that evolution fails to address, explain, or accommodate.
wd400:
I recommend that you look at Tables 1 and 2 in Tomkins’ 2011c paper:
From that paper:
wd400 and ABogart:
From Tomkins’ 2011c paper’s introduction:
This is the ‘other side’ of what’s going on. Are you willing to accept that perhaps evolutionists have ‘fudged’ the data?
@PaV: “This is the ‘other side’ of what’s going on. Are you willing to accept that perhaps evolutionists have ‘fudged’ the data?”
I have not read these papers so I am not qualified to comment on their veracity. I will leave that to WD400 as he is obviously well versed on the subject. However, if, in the papers, they describe how they screen/filter the data then they are not fudging anything. People reading the papers, including the peer reviewers, are free to question the methodology and rebut the work in subsequent papers.
So we have an AIG author that developed a method using “optimized sequence slices” that comes up with absolute values of human chimp identity lower than a standard sequence alignment. I think, given what the technique does, it is pretty clear why, and also that this is a bit silly.
But what does this few percent he fights for with this odd tactic buy you? What I’d like to see is you, or the author, apply this method to other genomes, and list the distances. Bet it looks like a pretty standard phylogeny. Please. Go right ahead. You have the resources. Also, apply it to human genomes as a reference point. How identical to each other are we with the metric?
Evolutionary biology doesn’t rely on cats and dogs or worms and us being a certain predicted % identical to establish phylogeny. You can toss in additional criteria (remember the hilarious 30bp search window promoted here!), and skew the numbers down, but the trend will persist. Other than making some AIG “we aren’t THAT related” talking point, who cares?
Even for humans and chimps, in a rapidly evolving region like the Y, we see less conservations with chimps. But we’d predict more conservation than in gorillas, monkeys, mice, etc.
“BLASTN algorithm parameters for the main study were as follows: -word_size 11, -evalue 10, -max_target_seqs 1, -dust no, -soft_masking false, -ungapped.”
Ok, from someone who hasn’t ever seen the BLASTN search tool or the inside of a lab even, I’ll throw this in at any rate. When I do a ‘search’ for BLASTN terminology definitions, I get a description of gapped and ungapped as settings that count, or don’t count, toward a certain score.
An example comparing two sequences, a matching nucleotide pair score a +1, a miss match -2. Gap scoring it seems can be arbitrarily set for a value at each occurrence and for length, or set to not score at all … err as I say it would seem. The score is a number that doesn’t appear to relate to a percentage in the illustrations used.
And as a by the way comment I ran across this statement:
“there is no widely accepted theory for selecting gap costs.
Whatever is going on, the setting of ‘ungapped’ may not be causing the effect we are debating over; it may not be causing the dramatic percentage interpretations we seem to fear.
Edit:
Found another example where the gap score was tallied separately from the match / mismatch score … again I stress: I think?!
REC claims,
“rapidly evolving region like the Y (chromosome)”
yet,
CHROMOSOME STUDY STUNS EVOLUTIONISTS
Excerpt: To their great surprise, Dorit and his associates found no nucleotide differences at all in the non-recombinant part of the Y chromosomes of the 38 men. This non-variation suggests no evolution has occurred in male ancestry.
http://www.reasons.org/interpr.....lutionists
Theory of the ‘Rotting’ Y Chromosome Dealt a Fatal Blow – February 2012
Excerpt: “the sequence of the rhesus Y, shows the chromosome hasn’t lost a single ancestral gene in the past 25 million years. By comparison, the human Y has lost just one ancestral gene in that period, and that loss occurred in a segment that comprises just 3% of the entire chromosome”, “,,,earlier work comparing the human and chimpanzee Ys revealed a stable human Y for at least six million years. “Now our empirical data fly in the face of the other theories out there. With no loss of genes on the rhesus Y and one gene lost on the human Y, it’s clear the Y isn’t going anywhere.”
http://www.sciencedaily.com/re.....154359.htm
HMMM???
bornagain77 quoted
Not a problem for the TOE! It simply shows that there obviously “musta” been little or no selection pressure on the rhesus Y chromosome in the past 25 million years. LOL
The theory of evolution can explain anything, but successfully predicts nothing.
-Q
JDD,
Here’s the situation.
We are talking about a topic you admit to having no expert knowledge in. There is a paper in a YEC pseudo-journal claiming 70% identity between human and chimps. Every other paper (including the chimp genome paper) finds ~98% in SNPs, a bit less including indels. The Y-chrom papers can’t be support for the 70% finding because the paper in the YEC-pseudo journal does not find 70% identity between Y chromosomes. The YEC pseudo-journal paper uses a setting that someone who does know the first thing about sequence analysis has told you will behave very strangely, and I’ve asked you to check that yourself.
In the fact of all of that you are leaning over backwards to finding a reading of the paper that supports Tomkins result. Why are you so credulous about the Tomkins result but so skeptical about the findings of mainstream science?
Willh,
ungapped means what I’ve said it means. You are welcome to download the BLAST executables and test it for yourself.
Pav,
That reference doesn’t refer to the same methods (or data) as the one under discussion, so it’s not possible to compare the result of gapped and ungapped alignments.
Of course, it would be very easy to do that. I wonder why Tomkins didn’t?
wd400, I find it interesting that you, a Neo-Darwinist, would have the audacity to call anything ‘pseudo’, since the plain fact of the matter is that Darwinism itself is the reigning king of pseudo-sciences. In fact it is anti-science! Even now, you offer no empirical proof that transformation of form is possible, you simply assume it to be true and never shoulder any real burden of proof!
“nobody to date has yet found a demarcation criterion according to which Darwin(ism) can be described as scientific” – Imre Lakatos (November 9, 1922 – February 2, 1974) a philosopher of mathematics and science, quote was as stated in 1973 LSE Scientific Method Lecture
Is evolution pseudoscience?
Excerpt:,,, Thus, of the ten characteristics of pseudoscience listed in the Skeptic’s Dictionary, evolution meets nine. Few other pseudosciences – astrology, astral projection, alien abduction, crystal power, or whatever — would meet so many.
http://creation.com/is-evolution-pseudoscience
Darwinian Evolution is a Pseudo-Science – Part II
https://docs.google.com/document/d/1oaPcK-KCppBztIJmXUBXTvZTZ5lHV4Qg_pnzmvVL2Qw/edit
BA and Querius
Do you even read these things? The paper from 1995 (!) found k no variants in one 700 bp intron the other paper is about turnover in gene number not divergence homologous sequences. They don’t establish that the Y is evolving anything other than quickly.
That’s not the way I read it at all. Moreover, You claim DNA can ‘evolve’ quickly? Really? Where is your proof?
The Paradox of the “Ancient” (250 Million Year Old) Bacterium Which Contains “Modern” Protein-Coding Genes:
“Almost without exception, bacteria isolated from ancient material have proven to closely resemble modern bacteria at both morphological and molecular levels.” Heather Maughan*, C. William Birky Jr., Wayne L. Nicholson, William D. Rosenzweig§ and Russell H. Vreeland ;
http://mbe.oxfordjournals.org/...../19/9/1637
Geobiologist Noffke Reports Signs of Life that Are 3.48 Billion Years Old – 11/11/13
Excerpt: the mats woven of tiny microbes we see today covering tidal flats were also present as life was beginning on Earth. The mats, which are colonies of cyanobacteria, can cause unusual textures and formations in the sand beneath them. Noffke has identified 17 main groups of such textures caused by present-day microbial mats, and has found corresponding structures in geological formations dating back through the ages.
http://www.odu.edu/about/odu-p...../topstory1
Scientists find signs of life in Australia dating back 3.48 billion years – Thu November 14, 2013
Excerpt: “We conclude that the MISS in the Dresser Formation record a complex microbial ecosystem, hitherto unknown, and represent one of the most ancient signs of life on Earth.”… “this MISS displays the same associations that are known from modern as well as fossil” finds. The MISS also shows microbes that act like “modern cyanobacteria,”
http://www.cnn.com/2013/11/13/.....ient-life/
Static evolution: is pond scum the same now as billions of years ago?
Excerpt: But what intrigues (paleo-biologist) J. William Schopf most is lack of change. Schopf was struck 30 years ago by the apparent similarities between some 1-billion-year-old fossils of blue-green bacteria and their modern microbial counterparts. “They surprisingly looked exactly like modern species,” Schopf recalls. Now, after comparing data from throughout the world, Schopf and others have concluded that modern pond scum differs little from the ancient blue-greens. “This similarity in morphology is widespread among fossils of [varying] times,” says Schopf. As evidence, he cites the 3,000 such fossils found;
http://www.thefreelibrary.com/.....a014909330
Some theory you got there wd400, it explain both billions of years of stasis and 6 million years of wholesale remodeling of the Y chromosome. Shoot, your theory is so great News referenced a story where they are now trying to explain the origin of the universe with it.
I’m thinking of hiring Darwinism to build me a house. There is simply nothing it can’t do! 🙂
Question, How many incongruences in data and theory can you find in these two papers?
Recent Genetic Research Shows Chimps More Distant From Humans,,, – Jan. 2010
Excerpt: A Nature paper from January, 2010 titled, “Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content,” found that Y chromosomes in humans and chimps “differ radically in sequence structure and gene content,” showing “extraordinary divergence” where “wholesale renovation is the paramount theme.”,,, “Even more striking than the gene loss is the rearrangement of large portions of the chromosome. More than 30% of the chimp Y chromosome lacks an alignable counterpart on the human Y chromosome, and vice versa,,,”
http://www.evolutionnews.org/2.....shows.html
The chimpanzee MSY contains twice as many massive palindromes as the human MSY, yet it has lost large fractions of the MSY protein-coding genes and gene families present in the last common ancestor.
http://www.nature.com/nature/j.....08700.html
Theory of the ‘Rotting’ Y Chromosome Dealt a Fatal Blow – February 2012
Excerpt: “the sequence of the rhesus Y, shows the chromosome hasn’t lost a single ancestral gene in the past 25 million years. By comparison, the human Y has lost just one ancestral gene in that period, and that loss occurred in a segment that comprises just 3% of the entire chromosome”, “,,,earlier work comparing the human and chimpanzee Ys revealed a stable human Y for at least six million years. “Now our empirical data fly in the face of the other theories out there. With no loss of genes on the rhesus Y and one gene lost on the human Y, it’s clear the Y isn’t going anywhere.”
http://www.sciencedaily.com/re.....154359.htm
wd400 @202
I am not bending over backwards. Who is selectively reading now? I said I would not use this paper in arguments to support ID etc, as it is not clear to me the results are valid. I think that is being quite scientific and fair.
I claimed to not be an expert in BLASTN algorithm parameters. I am a cell biologist and I claim to have a level of education (from one of the top universities in my country, with one of the top graduating grades for undergrad and multiple first author publications from my PhD and post-docs, thus not just someone who has “done a degree”) that allows me to understand data. I am not an expert, but I have a decent chance of being able to grasp scientific data due to my background. However I admit I am not an expert in that field and in particular, in that methodology.
If you have never done mass spec analysis you cannot claim to be an expert in that method but if someone reports a finding you can use your scientific knowledge to make judgements on their interpretation as long as it does not require extensive knowledge about the technique. We all as scientists must do that otherwise we are 100% at the mercy of an “expert”. We have to rely on methodology done in a proper manner, as reported, to an appropriate level as you would expect an expert to do.
I do not/did not know you are an “expert” in BLAST alignments and algorithm codes for these alignments. I also was trying to understand what -ungapped actually meant. You are just a person on the internet, not a name whom I can check qualifications. Therefore a good scientist would try to establish what the method truly means based on what is reported, which is what I have said I am trying to do. I have also emphasised and made it clear Iwould not personally use that publication as support for any view unless I could be very confident that the methodology did not do as you state it does.
I am not ignoring other studies, you miss the point here. The point is that this appeared to be an optimised sequence alignment that does not just rely on small parts of the chromosome but slices it up. I am interested in the whole chromosome regardless ofwhat you think is worth aligning or not (protein coding or not), I am interested in the whole thing as I do not personally subscribe to the idea that >95% of it is junk. That is not me “not listening to the experts” that is me reserving judgement on something that has only anecdotally been shown and is a huge assumption that was wrong 15 years ago, so what we still don’t know is probably wrong to assume today too.
PaV has also raised some interesting points but your behavious is quite common in any interactions I seem to have with naturalist evolutionists over this subject. If I concede something that could support them they either miss the fact that I am being fair, over-emphasise it, or pronounce victory as I have conceded a point. Yet the vast majority of evolutionists never will concede anything because they could not possibly agree with anything an IDer said. As per here, you are still saying I am bending over backwards to support the paper yet I am certainly not. It is quite bizzare to me that you would make this statement after I have clearly said I would not hold to those findings as accurate until I could definitively establish what those paramters mean.
But of course you would never accept anything from such publications anyway – as you say, you have predetermined that anything in there must be pseudoscience and it is a pseudojournal. You have already taken that stance.
Well I can assure you plenty of faked results and plenty of false data has appeared in the most prestigious journals around (Nature, Science, etc). Yet that does not make them pseudojournals or any less authoritative journals to pulish scientific findings in. I try to take each publication as it is, and assess the quality and likely interpretations from the data. When I see a publication that shows soft-body preservation from 100s of millions of years ago, embryos still intact, when I see plant analysis from 100s of MYA with no change in evolution from then and now, when I see a vast number of incredibly complex mechanisms for controling gene regulation and protein expression that makes us who we are and not chimps or another mammal, my logic does not automatically go “wow evolution is so clever!” It says, “well this does not fit with the mechanisms proposed of evolution and does not make sense to arise naturally.” Yet any publication that comes out with novel complexities simply tags on the end “Evolution is more complex than we though” or “evolution can acheive more than we thought” yet WE who doubt that are the intellectually challenged ones operating in pseudoscience? Please, come on now. That is not science.
Dr JDD, I’m sure if you have any specific questions, Dr. Tomkins will be gracious enough to answer any concerns you have in detail so that you can be assured that his research is done with integrity.
His contact info can be found here:
http://creationwiki.org/Jeffrey_Tomkins
as well, Here is a recent book of his (2012) that you may find insightful:
More Than a Monkey: The Human-Chimp DNA Similarity Myth
http://creationwiki.org/More_T.....arity_Myth
If I have been following the discussion properly, there is a disagreement between the genetic similarity between chimps and humans. The discrepancy is between comparisons performed using well thought out, rational and accepted practices (as represented by Piotr, WD400 and numerous peer reviewed papers) and one comparison performed by Tomkins, using a procedure that has been soundly criticized for its inappropriateness (as represented by BA77 and others, using creationist blogs, utube posts and other questionable sources).
But, for the sake of argument, let’s assume that Tomkins approach is valid and the % similarity between chimps and humans is less that the 98% that was previously thought. It is reasonable to assume that comparisons between the genetics of other species would suffer the same fate (i.e., lower the % similarity numbers between any two species that was previously looked at). The logical conclusion would be that chimps are still the closest relative to humans. So, nothing has changed.
Acartia_bogart wrote:
“The logical conclusion would be that chimps are still the closest relative to humans. So, nothing has changed.”
Respectfully there is a difference, as 28% more changes in a 3.1 billion or more nucleotide long genome, requires much more work … be it by random variations plus natural selection, or by design.
wd400 wrote:
“Willh,
ungapped means what I’ve said it means. You are welcome to download the BLAST executables and test it for yourself.”
Ok, fair comment. Though I am hoping to gain a bit more insight into how the BLAST programs actually work, at-least before any attempt to even use them. For instance how the initial string of 11 letter words are generated from the query set (chimp DNA?), then compared to the base (human DNA?), expanded, and finally scored. Are those comparisons always directly compared crosswise for instance, or are they shifted along to generate a high scoring match?
Thanks for the links BA77 and reference, much appreciated.
Acartia – this is my whole point of this whole discussion, down to what you have said. See you are still saying 98% similarity but that is misleading. That does not take into account indels and ORFans. Even L Moran accepts that:
http://sandwalk.blogspot.co.uk.....n-and.html
Then he claims that most of the differences are in the 90% junk, but does not reference this, as far as I can see, in papers modern enough to take into account that at least now we know a bit more of the genome is functional that we first thought. Plus, when you read this you see many assumptions are heavily laden within such writings. For example:
How do you know this? These are largely assumptions. Because they are in a gene family they MUST have duplicated or been lost. For some, there may be some supportive “evidence” of bits of one gene looking like bits of another existing one but again, this is pure assumption.
Additionally, Moran puts a heavy emphasis a few times on the likelihood of sequencing errors tidying up many of the differences. That argument could work the other way around and even more so when parts have been put together of the chimp chromosome based on a human template.
The point is what willh alludes to, and is the same reason why if 90% of the genome is not junk, but say only 50% is, it creates a much larger problem to explain in evolutionary terms. To me, the more we find out the more it is heading in that direction.
However to say we are 98.5% similar to chimps, to still teach that in the classroom is bogus and not true. The ONLY reason that “fact” is still taught to people is because it supports the evolutionary framework. You can guarantee if it was 94% in the first instance then they found out it was actually 98.5% what was taught would be rapidly changed!
But of course no, there is no bias in evolutionary biology.
Is DNA the most efficient information storage device known to man, vastly exceeding what man has ever done in computers?
Yes!
Has Darwinism given a experimental account for the origin of that astonishing DNA molecule?
Not even close!
Has Darwinism given a empirical account for the origin of digital information within DNA?
Not even close!
Is Darwinism given a free ride in science??
You bet your life!
notes:
Information Storage in DNA by Wyss Institute – video
https://vimeo.com/47615970
Quote from preceding video:
“The theoretical (information) density of DNA is you could store the total world information, which is 1.8 zetabytes, at least in 2011, in about 4 grams of DNA.”
Sriram Kosuri PhD. – Wyss Institute
Storing information in DNA – Test-tube data – Jan 26th 2013
Excerpt: Dr Goldman’s new scheme is significant in several ways. He and his team have managed to set a record (739.3 kilobytes) for the amount of unique information encoded. But it has been designed to do far more than that. It should, think the researchers, be easily capable of swallowing the roughly 3 zettabytes (a zettabyte is one billion trillion or 10²¹ bytes) of digital data thought presently to exist in the world and still have room for plenty more.
http://www.economist.com/news/.....d-magnetic
,,, If we were dealing with a real science instead of a ‘religion’ then, since Darwinism has not explained even the first steps, then it certainly would not be given a free pass on any of its other claims. But alas we are not dealing with a real science!
JDD,
You’ve spent an awful lot of time and words trying to find a awy in which Tomkins results can stand up for someone with no emotional investment. I don’t mean to suggest you are conviously biased toward creationist literature, just that you should check your unconcious bias
Well, you haven’t grapsed this data or even the meaning of the ungaped flag, so I’m not sure why you career to date is of any relevance.
Then you are defiately ignoring previous work, as previous work focuses on whole chromosomes not just protein coding (or even annotated) regions.
It was you who claimed to was reasoanable to assume something was well done since it was in a journal. I meerly pointed out that it wasn’t a real journal. I have explicitly said many times in this thread why Tomkins results are not as people claim they are, those are the reasons I dismiss them (not the venue they appeared in).
I’m also not sure why you think the 98% comparison wouldn’t include ORFans (of which there are very few in humans..)
Is DNA the most efficient information storage device known to man, vastly exceeding what man has ever done in computers?
Yes!
Has ID given a experimental account for the origin of that astonishing DNA molecule?
God did it
Has ID given a empirical account for the origin of digital information within DNA?
God did it
Is ID given a free ride in theology???
You bet your life!
Acartia_bogart although I’m pretty sure it is pointless to show you and wd400, both dogmatic atheists who IMHO could care less about what the evidence actually says, that there is empirical evidence for God creating the DNA molecule, none-the-less, to show that Theistic premises are up to the benchmark of testability and that atheistic/materialistic premises are not, I will show you (and onlookers) anyway:
DNA repair is a fascinating process to learn about. One facet of the process is highlighted here:
Quantum Dots Spotlight DNA-Repair Proteins in Motion – March 2010
Excerpt: “How this system works is an important unanswered question in this field,” he said. “It has to be able to identify very small mistakes in a 3-dimensional morass of gene strands. It’s akin to spotting potholes on every street all over the country and getting them fixed before the next rush hour.” Dr. Bennett Van Houten – of note: A bacterium has about 40 team members on its pothole crew. That allows its entire genome to be scanned for errors in 20 minutes, the typical doubling time.,, These smart machines can apparently also interact with other damage control teams if they cannot fix the problem on the spot.
http://www.sciencedaily.com/re.....123522.htm
What is interesting is that DNA repair machines ‘Fixing every pothole in America before the next rush hour’ is analogous to the traveling salesman problem. The traveling salesman problem is a NP-hard (read: very hard) problem in computer science; The problem involves finding the shortest possible route between cities, visiting each city only once. ‘Traveling salesman problems’ are notorious for keeping supercomputers busy for days.
NP-hard problem – Examples
Excerpt: Another example of an NP-hard problem is the optimization problem of finding the least-cost cyclic route through all nodes of a weighted graph. This is commonly known as the traveling salesman problem.
http://en.wikipedia.org/wiki/NP-hard#Examples
Finding: Bees Solve The Traveling Salesman Problem – October 2010
Excerpt: It is a classic problem in the field of computer science: In what order should a salesman visit his prospects? The traveling salesman problem may appear simple but it has engaged some of the greatest mathematical minds and today engages some of the fastest computers. This makes new findings, that bees routinely solve the problem before pollinating flowers, all the more remarkable.
http://www.uncommondescent.com.....n-problem/
What is interesting is that quantum computers excel in exactly this ‘narrow’ area of computation:
The Limits of Quantum Computers – March 2008
Excerpt: “Quantum computers would be exceptionally fast at a few specific tasks, but it appears that for most problems they would outclass today’s computers only modestly. This realization may lead to a new fundamental physical principle”
http://www.scientificamerican......-computers
Speed Test of Quantum Versus Conventional Computing: Quantum Computer Wins – May 8, 2013
Excerpt: quantum computing is, “in some cases, really, really fast.”
McGeoch says the calculations the D-Wave excels at involve a specific combinatorial optimization problem, comparable in difficulty to the more famous “travelling salesperson” problem that’s been a foundation of theoretical computing for decades.,,,
“This type of computer is not intended for surfing the internet, but it does solve this narrow but important type of problem really, really fast,” McGeoch says.
http://www.sciencedaily.com/re.....122828.htm
Since it is obvious that there is not a ‘classical’ supercomputer in the DNA, or cell, busily computing answers to this monster traveling salesman problem, in a purely ‘material’ fashion, by crunching bits, then it is readily apparent that this monster ‘traveling salesman problem’, for DNA repair, is somehow being computed by ‘non-local’ quantum computation within the cell and/or within DNA;
Quantum Entanglement/Information in DNA – video
https://vimeo.com/92405752
Is DNA a quantum computer? Stuart Hameroff
Excerpt: DNA could function as a quantum computers with superpositions of base pair dipoles acting as qubits. Entanglement among the qubits, necessary in quantum computation is accounted for through quantum coherence in the pi stack where the quantum information is shared,,,
http://www.quantumconsciousnes.....puter1.htm
The trouble for Darwinists with the finding of quantum entanglement/information, and computation, in DNA is that quantum entanglement/information requires a non-local, beyond space and time, cause in order to explain its effect.
Looking beyond space and time to cope with quantum theory – 29 October 2012
Excerpt: “Our result gives weight to the idea that quantum correlations somehow arise from outside spacetime, in the sense that no story in space and time can describe them,”
http://www.quantumlah.org/high.....uences.php
Yet neo-Darwinism holds that information ‘emerges’ from within space-time particles. Scientifically, finding quantum entanglement/information in molecular biology is a direct empirical falsification of a primary Darwinian precept!
Another place that a NP complete problem is found in molecular biology is in protein folding:
Combinatorial Algorithms for Protein Folding in Lattice
Models: A Survey of Mathematical Results – 2009
Excerpt: Protein Folding: Computational Complexity
4.1
NP-completeness: from 10^300 to 2 Amino Acid Types
4.2
NP-completeness: Protein Folding in Ad-Hoc Models
4.3
NP-completeness: Protein Folding in the HP-Model
http://www.cs.brown.edu/~sorin.....survey.pdf
And not so surprisingly, protein folding is also notorious for keeping supercomputers busy for days:
“Blue Gene’s final product, due in four or five years, will be able to “fold” a protein made of 300 amino acids, but that job will take an entire year of full-time computing.” Paul Horn, senior vice president of IBM research, September 21, 2000
http://www.news.com/2100-1001-233954.html
Networking a few hundred thousand computers together has reduced the time to a few weeks for simulating the folding of a single protein molecule:
A Few Hundred Thousand Computers vs. A Single Protein Molecule – video
https://www.youtube.com/watch?v=lHqi3ih0GrI
Of related note:
The Humpty-Dumpty Effect: A Revolutionary Paper with Far-Reaching Implications – Paul Nelson – October 23, 2012
Excerpt: Put simply, the Levinthal paradox states that when one calculates the number of possible topological (rotational) configurations for the amino acids in even a small (say, 100 residue) unfolded protein, random search could never find the final folded conformation of that same protein during the lifetime of the physical universe.
http://www.evolutionnews.org/2.....65521.html
And as with DNA repair, and not so surprisingly, protein folding is found to belong to the quantum world, not to the ‘classical’ world:
Physicists Discover Quantum Law of Protein Folding – February 22, 2011
Quantum mechanics finally explains why protein folding depends on temperature in such a strange way.
Excerpt: First, a little background on protein folding. Proteins are long chains of amino acids that become biologically active only when they fold into specific, highly complex shapes. The puzzle is how proteins do this so quickly when they have so many possible configurations to choose from.
To put this in perspective, a relatively small protein of only 100 amino acids can take some 10^100 different configurations. If it tried these shapes at the rate of 100 billion a second, it would take longer than the age of the universe to find the correct one. Just how these molecules do the job in nanoseconds, nobody knows.,,,
Their astonishing result is that this quantum transition model fits the folding curves of 15 different proteins and even explains the difference in folding and unfolding rates of the same proteins.
That’s a significant breakthrough. Luo and Lo’s equations amount to the first universal laws of protein folding. That’s the equivalent in biology to something like the thermodynamic laws in physics.
http://www.technologyreview.co.....f-protein/
Another factor severely complicating man’s ability to properly mimic protein folding is that, much contrary to evolutionary thought, many proteins are ‘context dependent’ and fold differently in different ‘molecular situations’:
The Gene Myth, Part II – August 2010
Excerpt: the rate at which a protein is synthesized, which depends on factors internal and external to the cell, affects the order in which its different portions fold. So even with the same sequence a given protein can have different shapes and functions. Furthermore, many proteins have no intrinsic shape, taking on different roles in different molecular contexts. So even though genes specify protein sequences they have only a tenuous influence over their functions.
http://darwins-god.blogspot.co.....rt-ii.html
How all this plays out is investigated here:
Origin of life: A problem in the origin of information – April 2014
Excerpt: A hallmark of life is the way information flows between different levels of organization. In non-living systems, information flows from the bottom up–the properties of the individual parts determine the fate of the system.
But with living systems, that flow goes both ways. Not only genes dictate the nature of proteins which in turn affect the functioning of cells, tissues and organisms, but the behavior of proteins, cells, and organisms also control gene expression. This is what Walker calls “top-down control” or “top-down causation.”
And to Walker, this transition–from information seeping upward only to information flowing both up and down–is the key to understanding life’s origins. Put differently, the blueprint for building an organism isn’t stored in its DNA only, but it’s distributed in the state of the entire system.
Dr. Sara Walker
http://www.uncommondescent.com.....formation/
‘Top down’ causation is antithetical to basic Darwinian precepts:
Intelligent Design Might Be Wrong, But Not the Way You Think by Stephen H. Webb – February 2014
Excerpt: Darwin, like all moderns, believed that matter was something particular, that matter is composed of small bits of stuff called atoms, and thus it can be pushed from behind, as it were, without being pulled from beyond, by form.
http://www.firstthings.com/web.....-causation
Verse, Quote, and Music:
Psalm 139:15
My frame was not hidden from you when I was made in the secret place, when I was woven together in the depths of the earth.
“Now the world appears to be divided into two realms, described by two different sets of physical laws. The quantum (world),, which is immaterial, coexisting possibilities, non-local, unified, connected, has some ultimate truth although we don’t know what it is yet, deeper levels of reality, and in many senses ‘spirit-like’. The classical world, the (illusory) billiard ball universe that we (appear to) live in right now, but not so, is material, Newtonian, definite, macroscopic, local, predictable, disconnected, post-modern, and somewhat boring actually. Now, what is life? If you approach life from classical physics, you see that biology is a set of self-organizing functions. There is no secret to life. Brain activities are equivalent to computers, consciousness is a epi-phenomenal illusion with no causal power. That’s the party line in standard neuroscience and philosophy. Accordingly, Thomas Huxley said years ago, ‘We are merely conscious automaton,’ helpless spectators., That’s the story we get from classical physics approach to the brain. Now,, applying quantum physics to biology, first by Erwin Schrodinger,,, quantum features (of biology include), non-local entanglement, super-position, unity, quantum coherence, quantum information. A kind of quantum vitalism, may play key roles in biological function.,,,”
Stuart Hameroff – Does Quantum Biology Support A Quantum Soul? – video
https://vimeo.com/29895068
High School Musical 2 – You are the music in me
http://www.youtube.com/watch?v=IAXaQrh7m1o
Of related note to ‘form’ falsifying Darwinian claims:
Darwin’s Finches Show Rule-Constrained Variation in Beak Shape – June 10, 2014
Excerpt: A simple yet powerful mathematical rule controls beak development, Harvard scientists find, while simultaneously preventing beaks from evolving into something else.,,,
We find in Darwin’s finches (and all songbirds) an internal system, controlled by a non-random developmental process. It is flexible enough to allow for variation, but powerful enough to constrain the beak to its basic form (a conical shape modulated by scaling and shear) so that the rest of the bird’s structures are not negatively affected. Beak development is controlled by a decay process that must operate at a particular rate. It’s all very precise, so much so that it could be modeled mathematically.,,,
The very birds that have long been used as iconic examples of natural selection become, on closer examination, paragons of intelligent design.
http://www.evolutionnews.org/2.....86581.html
Acartia_bogart @211
I basically agree, with the following reservation: greater similarity (whether molecular or morphological) does not necessarily correspond to closer relatedness. Let’s imagine that a clade conatins three taxa, A, B, and C, and that its structure is as follows: (A (B C)). Now let’s imagine that the evolution of C was for some reason accelerated in comparison with A and B (for example, as a result of colonising a new habitat, with strong selective pressures, or some dramatic genomic event, e.g. a whole genome duplication). As a result, the more conservative taxa A and B will be more “similar” to each other than either is to C, although they aren’t more closely related. For determining historical relationships, what matters is that B and C share some common innovations not shared with A, and A exhibits its own unique innovations not shared with B or C. The nested hierarchy is still there.
I believe you said, BA, that the materialist cultists believe we’ve come to the end of science, and I believe that they’re substantially correct in terms of its approach to metaphysics, but like pre-civilised (before building urban agglomerations) hunter-gatherer types, they identify the end, but have not identified the means that brought them to it. Indeed, as you pointed out, QM is the ultimate, physical paradigm.
Although hunter-gatherers show a more disciplined intellectual approach to their religions, not going to pieces with wild fantasies.
In that regard, one might argue that they are more illogically emotional nihilists (Spock suffering a bout of the vapours, as it were), rather than religious devotees.
I very much doubt whether in the history of religion, indeed, the history of mankind, there has ever been a cult so pathologically cretinous that its adherents believe (and seek to explain…) that, once upon a time, nothing turned itself into everything.
‘In that regard, one might argue that they are more illogically-emotional nihilists (Spock suffering a bout of the vapours, as it were), rather than religious devotees.’
I mean, of course, the emotional nihilists.
“the history of mankind, there has ever been a cult so pathologically cretinous”
but what are you REALLY trying to say Axel? 🙂