Burdens of Proof

If it appears to be designed, as Dawkins concedes, then it could be designed. The burden of proof is on Dawkins to demonstrate step-by-incremental-step how some mindless natural process completely accounts for the appearance of design. Even if he were able to explain this (I don’t think that he has) in existing biological forms, by invoking natural selection acting on random variation, that doesn’t help him, or anyone else, in explaining the origin of life. john_a_designer

I'm a bit late to this discussion but here's my 2 cents: Dr. Behe addresses the burden of proof regarding design and where it lies in his Afterward of the 10th anniversary edition of Darwin's Black Box. Behe quotes Richard Dawkins' understanding of what biology is:

"Biology is the study of complicated things that give the appearance of having been designed for a purpose."

Behe:

"Let me repeat, he says that's the very definition of biology - the study of things that appear designed...Dawkins doesn't just grudgingly acknowledge some faint impression of design in life; he insists that the appearance of design, which he ascribes to natural selection, is overpowering: [Dawkins] "yet the living results of natural selection overwhelmingly impress us with the appearance of design as if by a master watchmaker, impress us with the illusion of design and planning." [emphasis mine]

Behe again:

A crucial, often-overlooked point is that the overwhelming appearance of design strongly affects the burden of proof: in the presence of manifest design, the onus of proof is on the one who denies the plain evidence of his eyes. For example, a person who conjectured that the statues of Easter Island or the images on Mount Rushmore were actually the result of unintelligent forces would bear the substantial burden of proof the claim demanded.

Wild speculation notwithstanding, the flagellum has never been shown not to be irreducibly complex nor has any other system Behe mentions in his book. RexTugwell

seversky: You actually wrote “outboard propeller” which can reasonably be interpreted as an allusion to an outboard motor, given that the analogy has cropped up in previous discussions about the flagellum. Good try at deflection. Why would Barry's analog require an 'outboard' motor? You know good and well there is no outboard motor analog with flagella. They are outboard propellers as opposed the the inboard impellers on jet skiis. groovamos

sagebrush gardener @ #54, I got my idea for this puzzle from what Richard Dawkins wrote in his book, The Blind Watchmaker, where he informs us:

Modern genetic engineers already have the technology to write the New Testament or anything else into a bacterium's DNA. The 'meaning' of the symbols in any information technology is arbitrary, and there is no reason why we should not assign combinations, say triplets, from DNA's 4-letter alphabet, to letters of our own 26-letter alphabet (there would be room for all the upper and lower-case letters with 12 punctuation characters). Unfortunately, it would take about five man-centuries to write the New Testament into a bacterium, so I doubt if anybody will bother. If they did, the rate of reproduction of bacteria is such that 10 million copies of the New Testament could be run off in a single day, a missionary's dream if only people could read the DNA alphabet but, alas, the characters are so small that all 10 million copies of the New Testament could simultaneously dance upon the surface of a pin's head. (p. 116, Norton 1987)

I have highlighted what I think is the key point above: “The 'meaning' of the symbols in any information technology is arbitrary…” In other words in the sequence I created up above @#9 I assigned the letters this way: CAA=(I) GTA=(N) GGG=(space) AGT=(T) TGA=(H) TAA=(E)… However, I could have done it this way: ATA=(I) TAA=(N) TCA=(space) CAA=(T) GTA=(H) GGG=(E)… Or, a large, indeed, very large number of other ways. Since there 64 codon triplets to choose from there are 64 possible combinations that can be selected to represent any letter, space or punctuation character. Again, it is totally arbitrary. With the genetic code it appears to be just as arbitrary. There is no known physical law (as far as we know) that would have dictated the sequence of the first strands of DNA or RNA. Therefore we are left with the question scientific question: How does (or did) chemistry create code? And a philosophical question: Is it even possible for chemistry (or some mindless natural process) to create a code? The burden of proof falls on those making such a claim. Can an intelligence create a code using DNA codons? I just did (see #9, 46, 49 & 50 above). But I am open minded. If you believe that some mindless natural process is the origin of the code we find in DNA, just tell me how. Or, do I need to accept it by faith? (For anyone else interested in this discussion, start @ #9 above, then 16, 22, 43, 46, 49, 50, 52-54.) john_a_designer

I am about 20% of the way through Doug Axe's book. If the rest of the book is pointless (which I doubt), this part alone is a keeper. So far it is a philosophy of science or knowledge discussion using his personal experiences to illustrate many of the points. He discusses how materialism corrupts both science and knowledge. It is a completely unnecessary concept for science. He uses personal examples of how one is limited in what one can express due to current trends in thinking and how science is often not a search for the truth. He wants to create a layman's version of the science to help them decide who is right. He is not unaware of how difficult this will be because of the entrenched flow in the other direction. A flow that is not based on anything found in science. I was discussing the book with my wife this morning and I was telling her that his work revolves around the rareness of proteins. Her immediately reply was that there were tens of thousands of proteins so how could they be rare. The answer is that there is about a 100,000 proteins or about 10ˆ5 while the potential proteins based on amino acid sequences is 10ˆ70 which means that randomly one of these sequence is only 1 in 10ˆ65. So yes, they are rare. Now the question is whether functional proteins actually make up a much larger population than the 100,000 we know about. As far as ID, here is how he contrasts creationism with ID

The truth is that ID and creationism have always differed fundamentally in their methods and starting assumptions. Creationism starts with a commitment to a particular understanding of the biblical text of Genesis and aims to reconcile scientific data with that understanding. ID, on the other hand, starts with a commitment to the essential principles of science and shows how those principles ultimately compel us to attribute life to a purposeful inventor— an intelligent designer. ID authors settle for this vague description not because they want to smuggle God into science but because the jump from “intelligent designer” to “God” requires something beyond the essential principles of science.

Hopefully, will have more time today to read further. Axe is an excellent writer or has an extremely good editor. jerry

hi seversky and upright. we know that the flagellum is the result of design' even if its made from organic parts or its drive by a different way then a human motor. think about a ufo with an advance tech. anyone that will see a flying ufo will conclude that this ufo was designed because of its complexity (even if its have a different tech then us). you can also think about a self replicating robot or watch with dna. even in this case anyone will agree that those kind of watches and robots are designed. mk

The point is, as it has always been, whether the similarities are sufficient to warrant the inference that, because outboard motor propeller assemblies are designed, so must the bacterial flagellum. This question has yet to be resolved so the point is moot.

Hello Seversky, Many people have likened the flagellum to an outboard motor, particularly in function. Others, apparently including yourself, see the uncanny resemblance to human-designed electrical motors, stators, etc. Frankly, I can easily imagine a prop designer looking at the flagellum and seeing the spiraling flow that trails the blades a prop. He or she might very well take issue with your statement that it bears no resemblance at all to a propeller -- after all, what do you think the surfaces are doing? In any case, it seems somewhat idle to fixate over what the flagellum reminds individuals of. After all, its a biological object and its construction is observable to us. The flagellum is constructed by the reading of a representational medium. The medium contains permutations of spatially-oriented objects organized in a reading-frame code. The medium is established by preserving the physical discontinuity between the arrangement of the objects and their referents within the system. This independence is what enables the capacity to specify the end products of the system (which cannot be derived from the physical properties of the medium). The only other place this physical system can be found is in recorded language and mathematics (two unambiguous correlates of intelligence). The inference to design comes directly from universal experience, prediction, and experiment. It's wrapped up in the observed realities of the system, and the observations aren't even controversial. Upright BiPed

further to rvb8:

Evolution of the Genus Homo – Annual Review of Earth and Planetary Sciences – Ian Tattersall, Jeffrey H. Schwartz, May 2009 Excerpt: “Unusual though Homo sapiens may be morphologically, it is undoubtedly our remarkable cognitive qualities that most strikingly demarcate us from all other extant species. They are certainly what give us our strong subjective sense of being qualitatively different. And they are all ultimately traceable to our symbolic capacity. Human beings alone, it seems, mentally dissect the world into a multitude of discrete symbols, and combine and recombine those symbols in their minds to produce hypotheses of alternative possibilities. When exactly Homo sapiens acquired this unusual ability is the subject of debate.” http://www.annualreviews.org/doi/abs/10.1146/annurev.earth.031208.100202 “A number of hominid crania are known from sites in eastern and southern Africa in the 400- to 200-thousand-year range, but none of them looks like a close antecedent of the anatomically distinctive Homo sapiens…Even allowing for the poor record we have of our close extinct kin, Homo sapiens appears as distinctive and unprecedented…there is certainly no evidence to support the notion that we gradually became who we inherently are over an extended period, in either the physical or the intellectual sense.” Dr. Ian Tattersall: – paleoanthropologist – emeritus curator of the American Museum of Natural History – (Masters of the Planet, 2012) Leading Evolutionary Scientists Admit We Have No Evolutionary Explanation of Human Language - December 19, 2014 Excerpt: Understanding the evolution of language requires evidence regarding origins and processes that led to change. In the last 40 years, there has been an explosion of research on this problem as well as a sense that considerable progress has been made. We argue instead that the richness of ideas is accompanied by a poverty of evidence, with essentially no explanation of how and why our linguistic computations and representations evolved.,,, (Marc Hauser, Charles Yang, Robert Berwick, Ian Tattersall, Michael J. Ryan, Jeffrey Watumull, Noam Chomsky and Richard C. Lewontin, "The mystery of language evolution," Frontiers in Psychology, Vol 5:401 (May 7, 2014).) Casey Luskin added: “It's difficult to imagine much stronger words from a more prestigious collection of experts.” http://www.evolutionnews.org/2014/12/leading_evoluti092141.html The Fundamental Difference Between Humans and Nonhuman Animals - Michael Egnor - November 5, 2015 Excerpt: Human beings have mental powers that include the material mental powers of animals but in addition entail a profoundly different kind of thinking. Human beings think abstractly, and nonhuman animals do not. Human beings have the power to contemplate universals, which are concepts that have no material instantiation. Human beings think about mathematics, literature, art, language, justice, mercy, and an endless library of abstract concepts. Human beings are rational animals. Human rationality is not merely a highly evolved kind of animal perception. Human rationality is qualitatively different -- ontologically different -- from animal perception. Human rationality is different because it is immaterial. Contemplation of universals cannot have material instantiation, because universals themselves are not material and cannot be instantiated in matter.,,, It is a radical difference -- an immeasurable qualitative difference, not a quantitative difference. We are more different from apes than apes are from viruses.,,, http://www.evolutionnews.org/2015/11/the_fundamental_2100661.html Do Animals Have Language? - Michael Egnor - July 12, 2016 Excerpt: Shallit mischaracterizes de Waal's work. De Waal is a pioneer in the study of animal emotion and moral behavior. De Waal's views on the link between thought and language are nuanced and are not views I share, but his view on animal language is worth noting. De Waal: "You won't often hear me say something like this, but I consider humans the only linguistic species. We honestly have no evidence for symbolic communication, equally rich and multifunctional as ours, outside our species." Perhaps, in addition to recommending de Waal's books, Shallit should read them. http://www.evolutionnews.org/2016/07/do_animals_have102990.html Mental time travel: An exclusively human capacity? December 22, 2015 Excerpt: There is, however, no evidence that they (animals) are able to construct, reflect and compare different future scenarios like humans are. We therefore don't believe that animals are capable of mental time travel," says Prof Sen Cheng. http://www.sciencedaily.com/releases/2015/12/151222082343.htm

Moreover, the ability to create and understand information, that is unique to humans, provides very strong evidence that humans were indeed created in the image of God. This is because both reality itself and life are both 'information theoretic' in the foundational basis:

"it from bit” Every “it”— every particle, every field of force, even the space-time continuum itself derives its function, its meaning, its very existence entirely—even if in some contexts indirectly—from the apparatus-elicited answers to yes-or-no questions, binary choices, bits. “It from bit” symbolizes the idea that every item of the physical world has a bottom—a very deep bottom, in most instances, an immaterial source and explanation, that which we call reality arises in the last analysis from the posing of yes-no questions and the registering of equipment—evoked responses, in short all matter and all things physical are information-theoretic in origin and this is a participatory universe." – Princeton University physicist John Wheeler (1911–2008) (Wheeler, John A. (1990), “Information, physics, quantum: The search for links”, in W. Zurek, Complexity, Entropy, and the Physics of Information (Redwood City, California: Addison-Wesley)) 48:24 mark: “It is operationally impossible to separate Reality and Information” 49:45 mark: “In the Beginning was the Word” John 1:1 Prof Anton Zeilinger speaks on quantum physics. at UCT - video http://www.youtube.com/watch?v=s3ZPWW5NOrw "The most fundamental definition of reality is not matter or energy, but information–and it is the processing of information that lies at the root of all physical, biological, economic, and social phenomena." Vlatko Vedral - Professor of Physics at the University of Oxford, and CQT (Centre for Quantum Technologies) at the National University of Singapore, and a Fellow of Wolfson College - a recognized leader in the field of quantum mechanics. Complex grammar of the genomic language – November 9, 2015 Excerpt: The ‘grammar’ of the human genetic code is more complex than that of even the most intricately constructed spoken languages in the world. The findings explain why the human genome is so difficult to decipher –,,, ,,, in their recent study in Nature, the Taipale team examines the binding preferences of pairs of transcription factors, and systematically maps the compound DNA words they bind to. Their analysis reveals that the grammar of the genetic code is much more complex than that of even the most complex human languages. Instead of simply joining two words together by deleting a space, the individual words that are joined together in compound DNA words are altered, leading to a large number of completely new words. http://www.sciencedaily.com/releases/2015/11/151109140252.htm

It is hard to imagine a more convincing proof that we are made 'in the image of God', than finding that both the universe and life itself are 'information theoretic' in their foundational basis, and that we, of all the creatures on earth, uniquely possess an ability to understand and create information. I guess a more convincing evidence could be if God Himself became a man, defeated death on a cross, and then rose from the dead to prove that He was God. But who has ever heard of such overwhelming evidence as that?

Shroud of Turin: From discovery of Photographic Negative, to 3D Information, to Quantum Hologram - video https://www.facebook.com/philip.cunningham.73/videos/1119619634717635/?pnref=story

Verses and Music:

Genesis 1:26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth. John 1:1-4 In the beginning was the Word, and the Word was with God, and the Word was God. The same was in the beginning with God. All things were made by Him, and without Him was not anything made that was made. In Him was life, and that life was the Light of men. Casting Crowns - The Word Is Alive https://www.youtube.com/watch?v=X9itgOBAxSc

bornagain77

Barry Arrington @ 19

Seversky @ 11.

The bacterial flagellum is nothing like [a motor].

I said it was like a propeller, not a motor. Sev, if I felt compelled to set up straw men every time I addressed my opponent’s argument, it would probably give me pause. That’s just me — ya know, committed to logic and evidence and all.

You actually wrote "outboard propeller" which can reasonably be interpreted as an allusion to an outboard motor, given that the analogy has cropped up in previous discussions about the flagellum.

1. The question is whether intelligent agents have been demonstrated to be capable of assembling machinery like propeller assemblies, which are analogous in some respects to the flagellum assembly, which even Sev admits.

Agreed. Human beings, in some cases at least, can be considered as intelligent agents and human beings have designed propeller assemblies such as those seen on outboard motors.

Sev, if I had to try to use Jedi mind tricks in idiotic attempts to dismiss my opponents’ arguments, because I could not defeat them with logic or evidence, I think I would change my position. Just sayin’

The point is, as it has always been, whether the similarities are sufficient to warrant the inference that, because outboard motor propeller assemblies are designed, so must the bacterial flagellum. This question has yet to be resolved so the point is moot. Seversky

If Modern Humans Are So Smart, Why Are Our Brains Shrinking? - January 20, 2011 Excerpt: John Hawks is in the middle of explaining his research on human evolution when he drops a bombshell. Running down a list of changes that have occurred in our skeleton and skull since the Stone Age, the University of Wisconsin anthropologist nonchalantly adds, “And it’s also clear the brain has been shrinking.” “Shrinking?” I ask. “I thought it was getting larger.” The whole ascent-of-man thing.,,, He rattles off some dismaying numbers: Over the past 20,000 years, the average volume of the human male brain has decreased from 1,500 cubic centimeters to 1,350 cc, losing a chunk the size of a tennis ball. The female brain has shrunk by about the same proportion. “I’d call that major downsizing in an evolutionary eyeblink,” he says. “This happened in China, Europe, Africa—everywhere we look.” http://discovermagazine.com/2010/sep/25-modern-humans-smart-why-brain-shrinking Study suggests humans are slowly but surely losing intellectual and emotional abilities - November 12, 2012 Excerpt: "Human intelligence and behavior require optimal functioning of a large number of genes, which requires enormous evolutionary pressures to maintain. A provocative hypothesis published in a recent set of Science and Society pieces published in the Cell Press journal Trends in Genetics suggests that we are losing our intellectual and emotional capabilities because the intricate web of genes endowing us with our brain power is particularly susceptible to mutations and that these mutations are not being selected against in our modern society." http://medicalxpress.com/news/2012-11-humans-slowly-surely-intellectual-emotional.html#jCp Is Human Intellect Degenerating? - February 19, 2013 Excerpt: A recent study of the Online Mendelian Inheritance in Man (OMIM) database, although incomplete, indicates that about half of all human genetic diseases have a neurologic component, [6], frequently including some aspect of [intellectual deficiency], consistent with the notion that many genes are required for intellectual and emotional function. The reported mutations have been severe alleles, often de novo mutations that reduce fecundity. However, each of these genes will also be subject to dozens if not hundreds of weaker mutations that lead to reduced function, but would not significantly impair fecundity, and hence could accumulate with time... https://uncommondescent.com/intelligent-design/is-human-intellect-degenerating/ Human Genetic Variation Recent, Varies Among Populations - (Nov. 28, 2012) Excerpt: Nearly three-quarters of mutations in genes that code for proteins -- the workhorses of the cell -- occurred within the past 5,000 to 10,000 years,,, "One of the most interesting points is that Europeans have more new deleterious (potentially disease-causing) mutations than Africans,",,, "Having so many of these new variants can be partially explained by the population explosion in the European population. However, variation that occur in genes that are involved in Mendelian traits and in those that affect genes essential to the proper functioning of the cell tend to be much older." (A Mendelian trait is controlled by a single gene. Mutations in that gene can have devastating effects.) The amount variation or mutation identified in protein-coding genes (the exome) in this study is very different from what would have been seen 5,000 years ago,,, The report shows that "recent" events have a potent effect on the human genome. Eighty-six percent of the genetic variation or mutations that are expected to be harmful arose in European-Americans in the last five thousand years, said the researchers. The researchers used established bioinformatics techniques to calculate the age of more than a million changes in single base pairs (the A-T, C-G of the genetic code) that are part of the exome or protein-coding portion of the genomes (human genetic blueprint) of 6,515 people of both European-American and African-American decent.,,, http://www.sciencedaily.com/releases/2012/11/121128132259.htm

bornagain77

Andre, 'Hahahahahaha', is not really a reply. Would you agree intelligent parents have intelligent children? I fully agree that 'environment' (another Darwinian factor), plays a significant role in developing intelligence, but so does genetics. Why is it so difficult for you to grasp that curiosity, along with brown eyes can be a genetic trait. Your ID friends spend screeds of paper explaining the enormous numbers involved in genetic combination, and recombination. Scientists today fully understand that they have barely scrathched the epidermis of a layer, beneath which lay caverns of unknowns. Yet you, with that curious inability to be curious laugh off the possibility that curiosity may be inherited? This seems to be an ID genetic trait; an inability to be curious. Perhaps it's inherited? rvb8

Hi john_a_designer, I had an interest in codes when I was a kid, and spent a lot of time figuring them out with pencil and paper. But I have not done it for a long time, and no longer have all day to play, so your post inspired me to look up some online deciphering tools. I found http://quipqiup.com/ to be especially helpful. It wasn't as easy as copy-paste-and-click, but it did save a lot of time. Thanks for the entertaining puzzle! sagebrush gardener

Hi sagebrush gardener, That is @ #50 (drum roll please) the correct answer. For our listening audience, can you tell us a little bit more how you figured that out? john_a_designer

By the way, john_a_designer, your little puzzle is a wonderful counter-example to the idea that seems to be endemic among atheists (as nicely illustrated by rvb8 @22) that belief in design is somehow the end of inquiry. In my experience, the situation is quite the opposite. When I first saw your seemingly random string of letters @9, I passed it over, thinking there was not much worth exploring there. But when I realized (thanks to GBDixon @46 and your additional clue @49) that there was an intelligent design behind the seeming randomness, my curiosity was piqued. I spent some time digging deeper, and found it quite satisfying to have discovered the meaning. As another example, I am 100% certain that this computer in front of me was designed by an intelligence greater than mine. Does that inhibit my desire to learn more? Of course not! On the contrary, it makes me want to learn more, knowing that whoever made it has a much greater understanding than my own. sagebrush gardener

Gpuccio @ 48:

If yur post at #42 is an answer to me, you have a very strange idea of what an answer is. First of all, why do you “answer” my #30 (in the other thread, while you have completely ignored my #16, which is much more detailed and requested any specific answers from you

Read the OP. Our moderator quoted from #30 when he hijacked the thread for the third time. The Designer (WMNBG) only knows why. I had a response to #16 about half finished when I found out from another site that the thread had been hijacked again. No message left on the old thread to tell readers it had been hijacked, of course. I'll finish the message if I ever find the old thread again, but I may answer it here too because I'm getting tired of all this thread jacking around. If you're going to stick to "evolution is impossible" then we probably haven't got much to talk about, but if you ever have any questions ask Barry where the thread is and and ask there. MatSpirit

john_a_designer @49 In the beginning was the code. https://www.youtube.com/watch?v=T1Ogwa76yQo sagebrush gardener

GBDixon @ 46 That’s an interesting possibility… However, you are wrong. GGG does not equal E. Try TAA. Any other code breakers out there? john_a_designer

MatSpirit: If yur post at #42 is an answer to me, you have a very strange idea of what an answer is. First of all, why do you "answer" my #30 (in the other thread, while you have completely ignored my #16, which is much more detailed and requested any specific answers from you? Regarding the rest, my only claim is that complex functional information originates in the mind of a designer, and nowhere else. We observe complex functional information arising from the mind of designers all the time. Would you say that stating that Windows 10 was designed is the same as recurring to some Intelligent Poofer? Would you say that trying to decode some ancient language is Intelligent Poofery? You don't know what you are talking about. If we accept that functional information was inputted into biological objects ny some designer, we have a lot to look for and analyze. We have to find what information was inputted, when, the general form and purpose of that information, the way it was implemented, and so on. All those are perfectly scientific aims. As we try to reconstruct some ancient civilization from its artifacts, so we can try to decode the natural history of biological design from the artifacts that are left to us, in fossils and, especially, in living biological beings. That is a fascinating scientific task, much better and much more satisfying than just trying to imagine how something which never evolved could have evolved. gpuccio

Dionisio @35

Would post @32 help to reinforce your arguments?

I had assumed, perhaps incorrectly, that this information was common knowledge here, and did not need reinforcement. But yes, your links @32 would be helpful for anyone who is curious about how the flagellar motor works. Thanks. sagebrush gardener

Mr. Designer seems to be toying with us. I think his DNA strand is in a code contrived by him, where each three consecutive letters decode to a letter of the English alphabet. I think GGG=E, the first word is likely THE and the second word appears to be four letters long and is repeated in the second section. I tried to figure it out but have run out of time. There are, of course, a myriad of ways information can be encoded into DNA. For all we know, a great deal of information about the designer is encoded in cell DNA, just waiting for someone smart enough to decode it. GBDixon

OT: Memory in cells outside of DNA

Protein pairs make cells remember – 15 July 2016 Excerpt: Like our brains, individual cells also have a kind of memory, which enables them to store information. To make this possible, the cells require positive feedback from their proteins. The research group led by Prof. Attila Becskei at the Biozentrum of the University of Basel has now discovered that the proteins need to form pairs in these feedback loops to store information.,,, The cell not only requires the appropriate feedback from protein pairs in order to remember information but also for cell division and cell differentiation - the development of specialized cells. http://www.eurekalert.org/pub_releases/2016-07/uob-ppm071516.php

bornagain77

John I can answer it from a materialist pov... It evolved Andre

Seversky & rvb8, Thanks for taking my word that the strand that I provided above @9 is really a coded sequence. But how do you know that it is not just a random sequence? Obviously if it was a random sequence no one could or would claim the sequence was coded. Here again is the sequence: CAAGTAGGGAGTTGATAAGGGATATAATCACAAGTAGTACAAGTATCAGGG…TCTAAAACTGGGAGTTGATAAGGGACAGCAAGATAA (A=adenine, G=guanine, T=thymine & C=cytosine) …rvb8 wrote @ 22,

john- ‘How did the code get there?’ I don’t know. No one knows…

How can you say that “no one knows?” I know. Do you know how I know?

But what I do know is that the theories being proposed are infinately more substantial, plausible, and intellectually fulfilling, and satisfying than saying, ‘the Designer did it.’

I am not making the argument ‘the Designer did it.’ However, I am willing to argue that “an intelligence” is a possible source of coded semiotic information. I could also ask how mindless chemistry and mindless natural law can create a semiotic code. Can you answer that question? john_a_designer

This answer, which is in the "Burden of Proof" thread, is to Gpuccio's Msg 30 in the "That's Gotta Hurt" thread. That thread was torn off the "On Gritting Teeth" thread which in turn came from the "Gobsmackingly Stupid" thread which was started by Barry Arrington, apparently to prove he can't parse a logical statement. The "its" gpuccio is talking about is the modern DNA/RNA system in operation in today's cells. He is apparently a biosemiosis supporter and biosemiosis believes this system did not evolve. In fact, if it did, biosemiosis is basically dead. gpuccio:

If you try to explain its origin by stating that simpler systems existed in the past, it’s your burden to support that hypothesis by reasonable facts and inferences. We have no reason to “prove” that your unsubstantiated assumptions are wrong. They are unsubstantiated, and that’s enough to dismiss them, unless and until you substantiate them.

You claim that the DNA/RNA system did not evolve, yet the complexity of that system is many many orders of magnitude too complex to have occurred by chance. [See Dembski.] So if it's too complex to have occurred by chance and you insist it didn't evolve, it's up to you to tell us how it did come to exist. Saying it was poofed into existence by the Intelligent Poofer (who might not necessarily be God) is a pure God of the Gaps argument. It's a good tactical position to take because the reality-based world (often called materialists) has no fossils from that ancient date and little hope of finding any, and you can pooh pooh any hypothetical answers they may present. But meanwhile the biosemiosis hypothesis is built on a physically impossible foundation so your side is understandably not investigating those foundations. (Intelligent Poofery is not a mechanistic theory, and it’s not IP’s task to match your pathetic level of detail in telling mechanistic stories.) So you're basically standing on air with no hope of that situation improving. The reality based community, on the other hand, has no rEason to fear ino estimating the OoL and it ìs.. You'll be able to dismiss whatever they find, of course, even if they make actual self reproducing molecules. (Test tube science! We demand you show us what really happened, like we don't!) They'll never be able to show you the step by step evolution of the modern system from simple self reproducing molecules, which is what IP demands and, of course, you don't have to meet that pathetic level of proof because ... you can't? MatSpirit

RVB8 You actually believe your story? Hahahahahaha!!!! Curiosity can not evolve from non curiosity..... Darwinian evolution can only work with matter... Curiosity does not consist of matter... Try again and this time try harder. Andre

gpuccio Sorry I misspelled your name @34. Definitely I should be more careful next time. Dionisio

... if your short on time and patience to grasp Plantinga’s nuanced argument, see if you can digest this thought from evolutionary cognitive psychologist Steve Pinker, who baldly states: “Our brains are shaped for fitness, not for truth; sometimes the truth is adaptive, sometimes it is not.”

I would like to add that, given evolutionary materialism, there is no such thing as a person "who" has a brain. So it makes little sense to say that "our brains" are shaped for fitness. There is no person, which implies that, when rvb8 speaks about being "intellectually fulfilled" by some theory, all that is going on is blind chemical interactions in a clump of matter. And, to make matters even worse, the chemical state of this clump of matter, which rvb8 terms "being intellectually fulfilled", is completely unrelated to the theory rvb8 imagines "he" is fulfilled by. The chemical state is not about some theory. Even atheistic philosophers acknowledge that:

Physics and neuroscience both tell us, for different reasons, that one clump of matter can’t be about another clump of matter. Computer science combines both to show that human brain states can’t really be about stuff for exactly the same reason that the internal workings of your laptop can’t really be about anything at all. Introspection must be wrong when it credits consciousness with thoughts about birthdays, keys, and bosses’ names. But the mistake introspection makes is so deep and so persuasive, it’s almost impossible to shake, even when you understand it. At first you won’t even be able to conceive how it could be a mistake. But it has to be. The mistake is the notion that when we think, or rather when our brain thinks, it thinks about anything at all. We have to see very clearly that introspection tricks us into the illusion that our thoughts are about anything at all. [Rosenberg, 'The Atheist Guide To Reality']

Origenes

rvb8 at 36, actually contrary to what you believe, if naturalism were true there would be no true perception of reality:

Scientific Peer Review is in Trouble: From Medical Science to Darwinism - Mike Keas - October 10, 2012 Excerpt: Survival is all that matters on evolutionary naturalism. Our evolving brains are more likely to give us useful fictions that promote survival rather than the truth about reality. Thus evolutionary naturalism undermines all rationality (including confidence in science itself). Renown philosopher Alvin Plantinga has argued against naturalism in this way (summary of that argument is linked on the site:). Or, if your short on time and patience to grasp Plantinga's nuanced argument, see if you can digest this thought from evolutionary cognitive psychologist Steve Pinker, who baldly states: "Our brains are shaped for fitness, not for truth; sometimes the truth is adaptive, sometimes it is not." Steven Pinker, evolutionary cognitive psychologist, How the Mind Works (W.W. Norton, 1997), p. 305. http://blogs.christianpost.com/science-and-faith/scientific-peer-review-is-in-trouble-from-medical-science-to-darwinism-12421/ Content and Natural Selection - Alvin Plantinga - 2011 http://www.andrewmbailey.com/ap/Content_Natural_Selection.pdf

Donald Hoffman has, through detailed analysis of population genetics, extended Plantinga's 'evolutionary argument against naturalism' to be a much more devastating 'evolutionary argument against reality' since it shows that not only are some of our observations of reality unreliable but that ALL of our observations of reality are unreliable:

The Evolutionary Argument Against Reality - April 2016 The cognitive scientist Donald Hoffman uses evolutionary game theory to show that our perceptions of an independent reality must be illusions. Excerpt: “The classic argument is that those of our ancestors who saw more accurately had a competitive advantage over those who saw less accurately and thus were more likely to pass on their genes that coded for those more accurate perceptions, so after thousands of generations we can be quite confident that we’re the offspring of those who saw accurately, and so we see accurately. That sounds very plausible. But I think it is utterly false. It misunderstands the fundamental fact about evolution, which is that it’s about fitness functions — mathematical functions that describe how well a given strategy achieves the goals of survival and reproduction. The mathematical physicist Chetan Prakash proved a theorem that I devised that says: According to evolution by natural selection, an organism that sees reality as it is will never be more fit than an organism of equal complexity that sees none of reality but is just tuned to fitness. Never.” https://www.quantamagazine.org/20160421-the-evolutionary-argument-against-reality/ Donald Hoffman: Do we see reality as it is? - Video - 9:59 minute mark Quote: “fitness does depend on reality as it is, yes.,,, Fitness is not the same thing as reality as it is, and it is fitness, and not reality as it is, that figures centrally in the equations of evolution. So, in my lab, we have run hundreds of thousands of evolutionary game simulations with lots of different randomly chosen worlds and organisms that compete for resources in those worlds. Some of the organisms see all of the reality. Others see just part of the reality. And some see none of the reality. Only fitness. Who wins? Well I hate to break it to you but perception of reality goes extinct. In almost every simulation, organisms that see none of reality, but are just tuned to fitness, drive to extinction that perceive reality as it is. So the bottom line is, evolution does not favor veridical, or accurate perceptions. Those (accurate) perceptions of reality go extinct. Now this is a bit stunning. How can it be that not seeing the world accurately gives us a survival advantage?” https://youtu.be/oYp5XuGYqqY?t=601

Although atheists, because of the mathematics of population genetics, are forced to believe that ALL of their observations of reality are unreliable and therefore 'illusory', it is interesting to point out that reliable observation of reality in a necessary cornerstone of the scientific method:

Steps of the Scientific Method Observation/Research Hypothesis Prediction Experimentation Conclusion http://www.sciencemadesimple.com/scientific_method.html

Thus, in what should be needless to say, a worldview that undermines the scientific method itself by holding all our observations of reality are unreliable, even illusory, is NOT a worldview that can be firmly grounded within the scientific method! Moreover, completely contrary to materialistic premises, conscious observation, far from being unreliable and illusory, is experimentally found to be far more integral to reality, i.e. far more reliable of reality, than the math of population genetics predicted. In the following experiment, it was found that reality doesn’t exist without an observer.

New Mind-blowing Experiment Confirms That Reality Doesn’t Exist If You Are Not Looking at It – June 3, 2015 Excerpt: The results of the Australian scientists’ experiment, which were published in the journal Nature Physics, show that this choice is determined by the way the object is measured, which is in accordance with what quantum theory predicts. “It proves that measurement is everything. At the quantum level, reality does not exist if you are not looking at it,” said lead researcher Dr. Andrew Truscott in a press release.,,, “The atoms did not travel from A to B. It was only when they were measured at the end of the journey that their wave-like or particle-like behavior was brought into existence,” he said. Thus, this experiment adds to the validity of the quantum theory and provides new evidence to the idea that reality doesn’t exist without an observer. http://themindunleashed.org/2015/06/new-mind-blowing-experiment-confirms-that-reality-doesnt-exist-if-you-are-not-looking-at-it.html

Apparently science itself could care less if atheists are forced to believe, because of the math of population genetics, that their observations of reality are illusory! bornagain77

In order to state the obvious fact that a 2016 Ford car is fully designed, do we have to know or mention that there was a fully designed 1908 Model T? Dionisio

That's easy Andre. Our earliest ancestors had a survival advantage if they went to check what made the bush rustle. Those ancestors who made sure there was no danger passed on their curious nature, those who had faith that the bushes russeled for unknown reasons, were eaten by the stalking leopard:) rvb8

sagebrush gardener @25 Would post @32 help to reinforce your arguments? Dionisio

gouccio @29 Your interlocutor might benefit from seriously reading the post @32 too. :) Dionisio

rvb8 claims that

Faith, goes exactly against our evolved curiosity and therefore leaves us psychologically desperately trying to fill this ‘curiosity gap’.

Besides the fact that atheists have not one shred of empirical evidence that curiosity, nor any other mental attribute of consciousness, ever evolved, the blind faith displayed by atheists in unguided material processes to create, not only the universe, but the unfathomable complexity being dealt with in life, puts the faith that Christians have in God to shame.

Atheism and the remarkable faith of the atomist by Dave Armstrong • May 12, 2016 Excerpt: The atheist places extraordinary faith in matter — arguably far more faith than we place in God, because it is much more difficult to explain everything that “god-matter” does using science alone. Indeed, this is a faith of a non-rational, almost childlike kind. It is quite ironic, then, to hear the constant charge that we Christians have a blind, “fairy tale,” gullible faith, as opposed to the self-described “rational, intellectual and sophisticated” atheist. In reality, atheistic belief is [see my explanatory “disclaimer” at the end] a kind of polytheistic idolatry of the crudest, most primitive sort. The ancient Babylonians, Philistines, Aztecs, and other groups believed that their silver amulets and wooden idols could make the sun shine, defeat an enemy or cause crops to flourish. The polytheistic materialist, on the other hand, believes trillions of “atom-gods” and their distant relatives, the “cell-gods,” make everything in the universe occur by their own power, possessed eternally either in full or (who knows how?) in inevitably unfolding potentiality. One might call this (to coin a phrase) Atomism (“belief that the atom is god”). To the atomist, trillions of omnipotent, omniscient atoms can do absolutely everything that the Christian God can do, and for little or no reason that anyone can understand (i.e., why and how the atom-god came to possess such powers in the first place). The atomist openly and unreservedly worships these trillions of gods, with the most perfect, trusting, non-rational faith. He or she is what sociologists call a “true believer.” http://www.themichigancatholic.org/2016/05/atheism-remarkable-faith-atomist/

And if you doubt that Atheistic materialists really do bestow omnipotence and omniscience on material particles, you need look no further than the many worlds interpretation of quantum mechanics. The material particle is given so much unmerited power in the many worlds interpretation of Quantum Mechanics that every time someone simply observes a particle, instead of the wave function merely collapsing, the particle instead creates a virtual infinity of parallel universes.

Too many worlds - Philip Ball - Feb. 17, 2015 Excerpt:,,, You measure the path of an electron, and in this world it seems to go this way, but in another world it went that way. That requires a parallel, identical apparatus for the electron to traverse. More – it requires a parallel you to measure it. Once begun, this process of fabrication has no end: you have to build an entire parallel universe around that one electron, identical in all respects except where the electron went. You avoid the complication of wavefunction collapse, but at the expense of making another universe.,,, http://aeon.co/magazine/science/is-the-many-worlds-hypothesis-just-a-fantasy/ A Critique of the Many Worlds Interpretation - (Inspiring Philosophy - 2014) - video https://www.youtube.com/watch?v=_42skzOHjtA&list=UU5qDet6sa6rODi7t6wfpg8g

i.e. Many worlds is basically saying that, instead of God, the material particle has somehow bestowed within itself the power to create as many universes as it wants or needs to in order to ‘explain away' wave function collapse! To call this blind faith that atheists have in material particles bizarre and irrational is to be kind in your description of their blind faith in material particles! Of related note, contrary to the many worlds interpretation of atheists, where the material particle is basically given omnipotent power to create a virtual infinity of parallel universes every time someone simply observes a material particle, the following experiment shows that the collapse of the wave function is indeed a real effect. Thus, the following experiment empirically falsified the atheist's contention that material particles somehow have the omnipotent power to create universes within themselves,

Quantum experiment verifies Einstein's 'spooky action at a distance' - March 24, 2015 Excerpt: An experiment,, has for the first time demonstrated Albert Einstein's original conception of "spooky action at a distance" using a single particle. ,,Professor Howard Wiseman and his experimental collaborators,, report their use of homodyne measurements to show what Einstein did not believe to be real, namely the non-local collapse of a (single) particle's wave function.,, According to quantum mechanics, a single particle can be described by a wave function that spreads over arbitrarily large distances,,, ,, by splitting a single photon between two laboratories, scientists have used homodyne detectors—which measure wave-like properties—to show the collapse of the wave function is a real effect,, This phenomenon is explained in quantum theory,, the instantaneous non-local, (beyond space and time), collapse of the wave function to wherever the particle is detected.,,, "Einstein never accepted orthodox quantum mechanics and the original basis of his contention was this single-particle argument. This is why it is important to demonstrate non-local wave function collapse with a single particle," says Professor Wiseman. "Einstein's view was that the detection of the particle only ever at one point could be much better explained by the hypothesis that the particle is only ever at one point, without invoking the instantaneous collapse of the wave function to nothing at all other points. "However, rather than simply detecting the presence or absence of the particle, we used homodyne measurements enabling one party to make different measurements and the other, using quantum tomography, to test the effect of those choices." "Through these different measurements, you see the wave function collapse in different ways, thus proving its existence and showing that Einstein was wrong." http://phys.org/news/2015-03-quantum-einstein-spooky-action-distance.html

bornagain77

Barry Arrington @19 [Follow-up addendum to post @21] In light of some seemingly uninformed (or intentionally misleading?) comments posted by at least one of your interlocutors in this thread, regarding the association between the terms "bacteria flagellum" and "motor", here are few posts (@1692-1698) referencing relatively recent papers on that topic: https://uncommondescent.com/intelligent-design/mystery-at-the-heart-of-life/#comment-612824 @1692 Diverse high-torque bacterial flagellar motors assemble wider stator rings using a conserved protein scaffold @1693-1695 Molecular Architecture of the Bacterial Flagellar Motor in Cells @1696 Internal and external components of the bacterial flagellar motor rotate as a unit @1697 How Biophysics May Help Us Understand the Flagellar Motor of Bacteria Which Cause Infections @1698 Dynamism and regulation of the stator, the energy conversion complex of the bacterial flagellar motor If your interlocutor still doesn't get it, there are more papers on the same subject. Actually there will be more in the days ahead. The ongoing research on that particular issue is far from over. We ain't seen nothing yet. :) Dionisio

RVB8 How exactly did curiosity evolve? Did it evolve like morals? Andre

rvb8, @22

rvb8: I don’t know. No one knows. But what I do know is that the theories being proposed are infinately more substantial, plausible, and intellectually fulfilling, and satisfying than saying, ‘the Designer did it.’

There is a fundamental problem with the mode of explanation you propose; even if we allow for the unlikely possibility that ‘explanations’ like “sheer dumb luck” and “for no reason at all” can be experienced as substantial, plausible and intellectually fulfilling, as you claim. The fundamental problem with the idea that biological functions are produced by blind particles bumping into each other and sheer dumb luck is that it undercuts rationality and personhood. IOWs a theory which states that bottom-up blind processes explain biological functions — including personhood and rationality —, can, in principle, never be intellectually fulfilling, since it does not accommodate personhood and rationality.

Lewis: If human reason came from non-reason it would lose all rational credentials and would cease to be reason.

Haldane: “It seems to me immensely unlikely that mind is a mere by-product of matter. For if my mental processes are determined wholly by the motions of atoms in my brain I have no reason to suppose that my beliefs are true. They may be sound chemically, but that does not make them sound logically. And hence I have no reason for supposing my brain to be composed of atoms. In order to escape from this necessity of sawing away the branch on which I am sitting, so to speak, I am compelled to believe that mind is not wholly conditioned by matter.” [“When I am dead,” in Possible Worlds: And Other Essays, 1927]

Origenes

Seversky: "The bacterial flagellum is nothing like that." The flagellum is a machine. A molecular machine. Human design can build machines, potentially of any level of complexity, and of any type. The simple facts is: the conscious processes of cognitive understanding (intelligence) and feeling and will (desire and initiation of purposeful action) are capable of generating complex functional information. Nothing else has ever been proven capable to do that. gpuccio

Seqenenre: "Isn’t it also true then that ID has the burden of proof to show that an Intelligent Designer is capable of making a flagellum?" I don't understand your point. Obviously, intelligent design can achieve that kind of results. We have so many examples of machines designed by humans, which achieve remarkable levels of complex functional information. The computer you are using to read this post of mine is certainly a good example. Humans have achieved remarkable successes even in the field of biological engineering, as you probably will acknowledge. I can agree that at present we are not smart enough to compete with the level of biological design that we observe in living beings. Indeed, we are very far from that. But it is simply a question of time. We can certainly achieve new successes as we improve our designing ability with biological things. It is perfectly reasonable that in some time we can project and implement biological machines of the same complexity as the flagellum, using exactly the same design principles that we already use in other fields (like computers), or in biological engineering. The simple point is: intelligent design can generate complex functional information, while non design systems cannot. That is the core of ID theory, a theory which is absolutely supported by observed facts. gpuccio

Rvb8 How do we test your luck chance event? How do we replicate it? How do we observe it? Which natural riddles have you explained? Andre

Andre. Because it assuages our evolved curiosity. Faith, goes exactly against our evolved curiosity and therefore leaves us psychologically desperately trying to fill this 'curiosity gap'. When we explain one natural riddle we happily move onto the next. At the moment it is how did chemicals come together to produce organic life. And I am very sorry to have to tell you, but the possible answers produced by the scientific community are indeed more fulfilling than suggesting an unaccountable, nebulous, unknowable Designer moulded Nature. rvb8

Mung @20

An electric motor is an electrical machine that converts electrical energy into mechanical energy. Given a flagellum, there is nothing that converts anything to anything.

Obviously the flagellum is driven by the conversion of electrochemical energy into mechanical energy via the proton motive force. I am pretty sure you are smart enough to know that, Mung, so I am not sure what your point is. Is this a joke that is going over my head? sagebrush gardener

AMEM to burden of proof. Its the burden to show complexity could create itself OR is not the result of intelligent intent. It really is a complex universe and people(tailless primates for some) are called genesis for figuring out< if they did accurately, one tiny, tiny, part of this complexity. Its complex. The burden of proof is oin those saying it arose from chance encounters. Its on those saying its not intelligently conceived. To see fish become fishermen is also a burden of proof for advocates of it. Not the the opposition. Darwin was wrong about this point of who must prove what Robert Byers

Rvb8 How is saying that luck and chance did it, more intellectually fulfilling? Andre

john- 'How did the code get there?' I don't know. No one knows. But what I do know is that the theories being proposed are infinately more substantial, plausible, and intellectually fulfilling, and satisfying than saying, 'the Designer did it.' BA: Luke 10:27. Hmmmm, an odd contribution to an OOL, or Origins Of Complex Self Replicating molecules discussion. How is this on topic? We have a periodic table of elements, we know the early universe was a Hydrogen universe, gravity brought these atoms together, stars burst forth, and in their unbelievably high pressure and temperature hearts, the elements of which we are made were formed; this much we know. Now some of these elements have shapes which bond easily with many other elements, and are incredibly stable, Carbon being our most obvious example; molecules formed. Any dissent yet? So why is your imagination so stymied that you can't make the leap to understanding that these molecules, present in more complex and organic amino acid molecules couldn't go the extra yard as it were? rvb8

Barry Arrington @19 Regarding the association between bacteria flagellum and motors, here are few papers on that topic. https://uncommondescent.com/intelligent-design/mystery-at-the-heart-of-life/#comment-612824 @1692 Diverse high-torque bacterial flagellar motors assemble wider stator rings using a conserved protein scaffold @1693 Molecular Architecture of the Bacterial Flagellar Motor in Cells Dionisio

According to Wikipedia: An electric motor is an electrical machine that converts electrical energy into mechanical energy. Given a flagellum, there is nothing that converts anything to anything. Mung

Seversky @ 11.

The bacterial flagellum is nothing like [a motor].

I said it was like a propeller, not a motor. Sev, if I felt compelled to set up straw men every time I addressed my opponent's argument, it would probably give me pause. That's just me -- ya know, committed to logic and evidence and all.

Whether this partial resemblance is sufficient to infer design is a moot point.

Here Sev channels Obi Wan Kenobi: 1. The question is whether intelligent agents have been demonstrated to be capable of assembling machinery like propeller assemblies, which are analogous in some respects to the flagellum assembly, which even Sev admits. 2. ID proponent makes the uncontroversial observation that they have, thus answering the question in the affirmative. 3. Sev/Obi Wan waves hand and says "the point is moot." Sev, if I had to try to use Jedi mind tricks in idiotic attempts to dismiss my opponents' arguments, because I could not defeat them with logic or evidence, I think I would change my position. Just sayin' As is often the case in these debates, what fascinates me the most is not Sev's lame and easily rebutted attempt to dissemble and deflect. The psychology is the really fascinating thing. I know Sev is smart enough to know that what he says is false. It is not a mistake. It is a lie. Why does he feel compelled to tell lies, especially lies that are easily exposed like this one? I have seen this phenomenon literally hundreds of times. I still have no idea why they do it. Barry Arrington

as the Sev's claim "Naturalism is the philosophical or metaphysical basis of science" Hmmm, that claim is, as is usual for claims from atheists, false. Let us be VERY clear to the fact that ALL of science is dependent on basic Theistic presuppositions about the rational intelligibility of the universe and the ability of our mind to comprehend that rational intelligibility.

The Great Debate: Does God Exist? – Justin Holcomb – audio of the 1985 Greg Bahnsen debate available at the bottom of the site Excerpt: When we go to look at the different world views that atheists and theists have, I suggest we can prove the existence of God from the impossibility of the contrary. The transcendental proof for God’s existence is that without Him it is impossible to prove anything. The atheist worldview is irrational and cannot consistently provide the preconditions of intelligible experience, science, logic, or morality. The atheist worldview cannot allow for laws of logic, the uniformity of nature, the ability for the mind to understand the world, and moral absolutes. In that sense the atheist worldview cannot account for our debate tonight.,,, http://justinholcomb.com/2012/01/17/the-great-debate-does-god-exist/

In fact, modern science was uniquely born out of, and is still dependent on, the Christian worldview:

Science and Theism: Concord, not Conflict* – Robert C. Koons IV. The Dependency of Science Upon Theism (Page 21) Excerpt: Far from undermining the credibility of theism, the remarkable success of science in modern times is a remarkable confirmation of the truth of theism. It was from the perspective of Judeo-Christian theism—and from the perspective alone—that it was predictable that science would have succeeded as it has. Without the faith in the rational intelligibility of the world and the divine vocation of human beings to master it, modern science would never have been possible, and, even today, the continued rationality of the enterprise of science depends on convictions that can be reasonably grounded only in theistic metaphysics. http://www.robkoons.net/media/69b0dd04a9d2fc6dffff80b3ffffd524.pdf The truth about science and religion By Terry Scambray – August 14, 2014 Excerpt: In 1925 the renowned philosopher and mathematician, Alfred North Whitehead speaking to scholars at Harvard said that science originated in Christian Europe in the 13th century. Whitehead pointed out that science arose from “the medieval insistence on the rationality of God, conceived as with the personal energy of Jehovah and with the rationality of a Greek philosopher”, from which it follows that human minds created in that image are capable of understanding nature. The audience, assuming that science and Christianity are enemies, was astonished. http://www.americanthinker.com/blog/2014/08/the_truth_about_science_and_religion.html The Threat to the Scientific Method that Explains the Spate of Fraudulent Science Publications – Calvin Beisner | Jul 23, 2014 Excerpt: It is precisely because modern science has abandoned its foundations in the Biblical worldview (which holds, among other things, that a personal, rational God designed a rational universe to be understood and controlled by rational persons made in His image) and the Biblical ethic (which holds, among other things, that we are obligated to tell the truth even when it inconveniences us) that science is collapsing. As such diverse historians and philosophers of science as Alfred North Whitehead, Pierre Duhem, Loren Eiseley, Rodney Stark, and many others have observed,, science—not an occasional flash of insight here and there, but a systematic, programmatic, ongoing way of studying and controlling the world—arose only once in history, and only in one place: medieval Europe, once known as “Christendom,” where that Biblical worldview reigned supreme. That is no accident. Science could not have arisen without that worldview. http://townhall.com/columnists/calvinbeisner/2014/07/23/the-threat-to-the-scientific-method-that-explains-the-spate-of-fraudulent-science-publications-n1865201/page/full Several other resources backing up this claim are available, such as Thomas Woods, Stanley Jaki, David Linberg, Edward Grant, J.L. Heilbron, and Christopher Dawson.

Moreover, if we cast aside those basic Theistic presuppositions about the rational intelligibility of the universe and the ability of our mind to comprehend that rational intelligibility, and try to use naturalism as our basis for practicing science then everything within that atheistic/naturalistic worldview, (i.e. sense of self. observation of reality, even reality itself), collapses into self refuting, unrestrained, flights of fantasies and imagination.

Darwinian evolution, and atheism/naturalism in general, are built entirely upon a framework of illusions and fantasy – June 2016 https://docs.google.com/document/d/1Q94y-QgZZGF0Q7HdcE-qdFcVGErhWxsVKP7GOmpKD6o/edit

In fact, besides naturalism NOT being the basis of science, it would be hard to fathom a more anti-scientific worldview than atheistic naturalism. Even Darwinian evolution itself is dependent on basic Theistic presuppositions. But where Darwinian evolution goes off the rails, theologically speaking, as far as science itself is concerned, is that it uses bad liberal theology to try to establish the legitimacy of its atheistic claims, all the while forgetting that it itself is dependent on basic Theistic presuppositions about the rational intelligibility of the universe and of our mind to comprehend it. In fact, Darwin’s book, ‘Origin’, is replete with bad liberal theology. Which should not really be all that surprising since Darwin’s college degree was not in math but was in (bad liberal) theology:

Charles Darwin, Theologian: Major New Article on Darwin’s Use of Theology in the Origin of Species – May 2011 Excerpt: The Origin supplies abundant evidence of theology in action; as Dilley observes: I have argued that, in the first edition of the Origin, Darwin drew upon at least the following positiva theological claims in his case for descent with modification (and against special creation): 1. Human beings are not justified in believing that God creates in ways analogous to the intellectual powers of the human mind. 2. A God who is free to create as He wishes would create new biological limbs de novo rather than from a common pattern. 3. A respectable deity would create biological structures in accord with a human conception of the ‘simplest mode’ to accomplish the functions of these structures. 4. God would only create the minimum structure required for a given part’s function. 5. God does not provide false empirical information about the origins of organisms. 6. God impressed the laws of nature on matter. 7. God directly created the first ‘primordial’ life. 8. God did not perform miracles within organic history subsequent to the creation of the first life. 9. A ‘distant’ God is not morally culpable for natural pain and suffering. 10. The God of special creation, who allegedly performed miracles in organic history, is not plausible given the presence of natural pain and suffering. http://www.evolutionnews.org/2011/05/charles_darwin_theologian_majo046391.html

To this day, Darwinists are still dependent on bad liberal theology in order to try to establish the supposedly ‘scientific’ legitimacy of Darwinian claims:

Nothing in biology makes sense except in light of theology? – Dilley S. – 2013 Abstract This essay analyzes Theodosius Dobzhansky’s famous article, “Nothing in Biology Makes Sense Except in the Light of Evolution,” in which he presents some of his best arguments for evolution. I contend that all of Dobzhansky’s arguments hinge upon sectarian claims about God’s nature, actions, purposes, or duties. Moreover, Dobzhansky’s theology manifests several tensions, both in the epistemic justification of his theological claims and in their collective coherence. I note that other prominent biologists–such as Mayr, Dawkins, Eldredge, Ayala, de Beer, Futuyma, and Gould–also use theology-laden arguments. I recommend increased analysis of the justification, complexity, and coherence of this theology. http://www.ncbi.nlm.nih.gov/pubmed/23890740

Moreover, besides Christianity providing the proper foundation so as to practice modern science in the first place, Christianity also offers the correct solution for the much sought after 'theory of everything' so as to bring a semblance of closure to modern science:

(Centrality Concerns) The Resurrection of Jesus Christ from Death as the “Theory of Everything” – video https://www.facebook.com/philip.cunningham.73/videos/vb.100000088262100/1143437869002478/?type=2&theater

Verse and Music:

Colossians 1:15-20 The Son is the image of the invisible God, the firstborn over all creation. For in him all things were created: things in heaven and on earth, visible and invisible, whether thrones or powers or rulers or authorities; all things have been created through him and for him. He is before all things, and in him all things hold together. And he is the head of the body, the church; he is the beginning and the firstborn from among the dead, so that in everything he might have the supremacy. For God was pleased to have all his fullness dwell in him, and through him to reconcile to himself all things, whether things on earth or things in heaven, by making peace through his blood, shed on the cross. The Great I Am - Phillips, Craig & Dean https://www.youtube.com/watch?v=y_VR-zwp2KA

bornagain77

It’s argument by metaphor. Lying trolls are still liars. And trolls. Mung

john_a_designer @ 9

I can absolutely prove to you that an intelligence of some kind was the source of the code.

Go ahead, I'm listening. Seversky

News @ 3

Materialism is not science. It is a chronic parasite on science, like fleas on a dog. Similar level of usefulness too.

No, materialism is not science. It seems to be regarded as an obsolete concept in philosophy. The current version is physicalism which is roughly equivalent to my a/mat v2.0. Naturalism is the philosophical or metaphysical basis of science which, in my interpretation, derives from the principle or Law of Identity. And if you think that understanding the role of insulin in glucose metabolism has not contributed to the management of diabetes then you and I have very different notions about what constitutes "usefulness". Seversky

The bacterial flagellum is nothing like that. Yes, at a molecular level, part of the structure of the flagellum resembles the stator/rotor arrangement of a human-designed electric motor but the ‘tail’ itself is nothing like a propeller. Whether this partial resemblance is sufficient to infer design is a moot point.

It's not even moot. It's fantasy. It's argument by metaphor. Obviously, time is money. Daniel King

And, once again, the burden of proof for a claim rests with the claimant if, and only if, the claimant is concerned with persuading an audience of the merits of the claim. If the claimant couldn't care less whether anyone believes the claim, there is no obligation to do anything. Seversky

gpuccio: Well done!!! Truth Will Set You Free

Barry Arrington @ 7

Seqenenre @ 5:

Isn’t it also true then that ID has the burden of proof to show that an Intelligent Designer is capable of making a flagellum?

Of course it is. And that burden has been sustained literally millions of times. Just drop by your nearest boat engine dealer and you will see for yourself. As has been explained countless times in these pages, the flagellum assembly is essentially an outboard propeller.

The typical outboard motor is a gasoline-powered, reciprocating, internal-combustion engine. Small amounts of gasoline are burnt inside a set of cylinders and the explosions drive small pistons. The pistons are connected to a crankshaft which converts the linear motion into rotary motion. The crankshaft is connected to a drive-shaft which conducts that rotary motion to a set of gears which turn that motion through 90 degrees to drive a propeller. The propeller is a component which uses the rotation of angled blades to literally 'screw' itself through the water. The bacterial flagellum is nothing like that. Yes, at a molecular level, part of the structure of the flagellum resembles the stator/rotor arrangement of a human-designed electric motor but the 'tail' itself is nothing like a propeller. Whether this partial resemblance is sufficient to infer design is a moot point. Seversky

re #5 "Isn’t it also true then that ID has the burden of proof to show that an Intelligent Designer is capable of making a flagellum?" Stop it! My palm and forehead can't take any more! SteRusJon

For the naturalists, physicalists and materialists commenting here at UD, here is a coded strand of DNA: CAAGTAGGGAGTTGATAAGGGATATAATCACAAGTAGTACAAGTATCAGGG... TCTAAAACTGGGAGTTGATAAGGGACAGCAAGATAA (A=adenine, G=guanine, T=thymine & C=cytosine) How did the code get there? I can absolutely prove to you that an intelligence of some kind was the source of the code. john_a_designer

FYI: What Origin-of-Life Researchers Forget Heartlander

Seqenenre @ 5:

Isn’t it also true then that ID has the burden of proof to show that an Intelligent Designer is capable of making a flagellum?

Of course it is. And that burden has been sustained literally millions of times. Just drop by your nearest boat engine dealer and you will see for yourself. As has been explained countless times in these pages, the flagellum assembly is essentially an outboard propeller. The construction of outboard propellers by intelligent agents has been witnessed millions of times. Their ability to do so is an established fact. The ability of blind, unguided natural forces to do so has never been observed. Even a single such observation would destroy the ID paradigm. Barry Arrington

as to: "Isn’t it also true then that ID has the burden of proof to show that an Intelligent Designer is capable of making a flagellum?" I hold that there is no way to convince anyone who is unwilling to acknowledge the reality of their own mind that Intelligence is capable of creating anything. That atheists are willing to deny the reality of the one thing they can be most sure about existing, i.e. the existence of their own mind, just so as to, IMHO, avoid the Theistic implications clearly associated with admitting the reality of one's own mind, is a sure sign that you are not dealing with a person who weighs evidence honestly.

Darwin's Robots: When Evolutionary Materialists Admit that Their Own Worldview Fails - Nancy Pearcey - April 23, 2015 Excerpt: Even materialists often admit that, in practice, it is impossible for humans to live any other way. One philosopher jokes that if people deny free will, then when ordering at a restaurant they should say, "Just bring me whatever the laws of nature have determined I will get." An especially clear example is Galen Strawson, a philosopher who states with great bravado, "The impossibility of free will ... can be proved with complete certainty." Yet in an interview, Strawson admits that, in practice, no one accepts his deterministic view. "To be honest, I can't really accept it myself," he says. "I can't really live with this fact from day to day. Can you, really?",,, In What Science Offers the Humanities, Edward Slingerland, identifies himself as an unabashed materialist and reductionist. Slingerland argues that Darwinian materialism leads logically to the conclusion that humans are robots -- that our sense of having a will or self or consciousness is an illusion. Yet, he admits, it is an illusion we find impossible to shake. No one "can help acting like and at some level really feeling that he or she is free." We are "constitutionally incapable of experiencing ourselves and other conspecifics [humans] as robots." One section in his book is even titled "We Are Robots Designed Not to Believe That We Are Robots.",,, When I teach these concepts in the classroom, an example my students find especially poignant is Flesh and Machines by Rodney Brooks, professor emeritus at MIT. Brooks writes that a human being is nothing but a machine -- a "big bag of skin full of biomolecules" interacting by the laws of physics and chemistry. In ordinary life, of course, it is difficult to actually see people that way. But, he says, "When I look at my children, I can, when I force myself, ... see that they are machines." Is that how he treats them, though? Of course not: "That is not how I treat them.... I interact with them on an entirely different level. They have my unconditional love, the furthest one might be able to get from rational analysis." Certainly if what counts as "rational" is a materialist worldview in which humans are machines, then loving your children is irrational. It has no basis within Brooks's worldview. It sticks out of his box. How does he reconcile such a heart-wrenching cognitive dissonance? He doesn't. Brooks ends by saying, "I maintain two sets of inconsistent beliefs." He has given up on any attempt to reconcile his theory with his experience. He has abandoned all hope for a unified, logically consistent worldview. http://www.evolutionnews.org/2015/04/when_evolutiona095451.html

Verse:

Luke 10:27 He answered, "'Love the Lord your God with all your heart and with all your soul and with all your strength and with all your mind'; and, 'Love your neighbor as yourself.'"

bornagain77

mk Isn't it also true then that ID has the burden of proof to show that an Intelligent Designer is capable of making a flagellum? Seqenenre

the burden of proof is in the side that claim that a self replicating motor (flagellum) can evolve without a designer. mk

Materialism is not science. It is a chronic parasite on science, like fleas on a dog. Similar level of usefulness too. News

For illusions, unfettered imagination constitutes undeniable evidence. How could it be otherwise?

“We have so much confidence in our materialist assumptions (which are assumptions, not facts) that something like free will is denied in principle. Maybe it doesn’t exist, but I don’t really know that. Either way, it doesn’t matter because if free will and consciousness are just an illusion, they are the most seamless illusions ever created. Film maker James Cameron wishes he had special effects that good.” Matthew D. Lieberman – neuroscientist – materialist – UCLA professor The Confidence of Jerry Coyne - Ross Douthat - January 6, 2014 Excerpt: But then halfway through this peroration, we have as an aside the confession (by Coyne) that yes, okay, it’s quite possible given materialist premises that “our sense of self is a neuronal illusion.” At which point the entire edifice suddenly looks terribly wobbly — because who, exactly, is doing all of this forging and shaping and purpose-creating if Jerry Coyne, as I understand him (and I assume he understands himself) quite possibly does not actually exist at all? The theme of his argument is the crucial importance of human agency under eliminative materialism, but if under materialist premises the actual agent is quite possibly a fiction, then who exactly is this I who “reads” and “learns” and “teaches,” and why in the universe’s name should my illusory self believe Coyne’s bold proclamation that his illusory self’s purposes are somehow “real” and worthy of devotion and pursuit? (Let alone that they’re morally significant: But more on that below.) Prometheus cannot be at once unbound and unreal; the human will cannot be simultaneously triumphant and imaginary. http://douthat.blogs.nytimes.com/2014/01/06/the-confidence-of-jerry-coyne/?_r=0 Darwinian evolution, and atheism/naturalism in general, are built entirely upon a framework of illusions and fantasy – June 2016 https://docs.google.com/document/d/1Q94y-QgZZGF0Q7HdcE-qdFcVGErhWxsVKP7GOmpKD6o/edit

bornagain77

Even the happy atheist PZ Myers is on our side on this one.... Andre