Intelligent Design

Functional information defined

Spread the love

What is function? What is functional information? Can it be measured?

Let’s try to clarify those points a little.

Function is often a controversial concept. It is one of those things that everybody apparently understands, but nobody dares to define. So it happens that, as soon as you try to use that concept in some reasoning, your kind interlocutor immediately stops you at the beginning, with the following smart request: “Yes, but what is function? How can you define it?

So, I will try to define it.

A premise. As we are not debating philosophy, but empirical science, we need to remain adherent to what can be observed. So, in defining function, we must stick to what can be observed: objects and events, in a word facts.

That’s what I will do.

But as usual I will include, in my list of observables, conscious beings, and in particular humans. And all the observable processes which take place in their consciousness, including the subjective experiences of understanding and purpose. Those things cannot be defined other than as specific experiences which happen in a conscious being, and which we all understand because we observe them in ourselves.

That said, I will try to begin introducing two slightly different, but connected, concepts:

a) A function (for an object)

b) A functionality (in a material object)

I define a function for an object as follows:

a) If a conscious observer connects some observed object to some possible desired result which can be obtained using the object in a context, then we say that the conscious observer conceives of a function for that object.

b) If an object can objectively be used by a conscious observer to obtain some specific desired result in a certain context, according to the conceived function, then we say that the object has objective functionality, referred to the specific conceived function.

The purpose of this distinction should be clear, but I will state it explicitly just the same: a function is a conception of a conscious being, it does not exist  in the material world outside of us, but it does exist in our subjective experience. Objective functionalities, instead, are properties of material objects. But we need a conscious observer to connect an objective functionality to a consciously defined function.

Let’s make an example.

Stones

I am a conscious observer. At the beach, I see various stones. In my consciousness, I represent the desire to use a stone as a chopping tool to obtain a specific result (to chop some kind of food). And I choose one particular stone which seems to be good for that.

So we have:

a) The function: chopping food as desired. This is a conscious representation in the observer, connecting a specific stone to the desired result. The function is not in the stone, but in the observer’s consciousness.

b) The functionality in the chosen stone: that stone can be used to obtain the desired result.

So, what makes that stone “good” to obtain the result? Its properties.

First of all, being a stone. Then, being in some range of dimensions and form and hardness. Not every stone will do. If it is too big, or too small, or with the wrong form, etc., it cannot be used for my purpose.

But many of them will be good.

So, let’s imagine that we have 10^6 stones on that beach, and that we try to use each of them to chop some definite food, and we classify each stone for a binary result: good – not good, defining objectively how much and how well the food must be chopped to give a “good” result. And we count the good stones.

I call the total number of stones: the Search space.

I call the total number of good stones: the Target space

I call –log2 of the ratio Target space/Search space:  Functionally Specified Information (FSI) for that function in the system of all the stones I can find in that beach. It is expressed in bits, because we take -log2 of the number.

So, for example, if 10^4 stones on the beach are good, the FSI for that function in that system is –log2 of 10^-2, that is  6,64386 bits.

What does that mean? It means that one stone out of 100 is good, in the sense we have defined, and if we choose randomly one stone in that beach we have a probability to find a good stone of 0.01 (2^-6,64386).

I hope that is clear.

So, the general definitions:

c) Specification. Given a well defined set of objects (the search space), we call “specification”, in relation to that set, any explicit objective rule that can divide the set in two non overlapping subsets:  the “specified” subset (target space) and the “non specified” subset.  IOWs, a specification is any well defined rule which generates a binary partition in a well defined set of objects.

d) Functional Specification. It is a special form of specification (in the sense defined above), where the rule that specifies is of the following type:  “The specified subset in this well defined set of objects includes all the objects in the set which can implement the following, well defined function…” .  IOWs, a functional specification is any well defined rule which generates a binary partition in a well defined set of objects using a function defined as in a) and verifying if the functionality, defined as in b), is present in each object of the set.

It should be clear that functional specification is a definite subset of specification. Other properties, different from function, can in principle be used  to specify. But for our purposes we will stick to functional specification, as defined here.

e) The ratio Target space/Search space  expresses the probability of getting an object from the search space by one random search attempt, in a system where each object has the same probability of being found by a random search (that is, a system with an uniform probability of finding those objects).

f) The Functionally Specified  Information  (FSI)  in bits is simply –log2 of that number. Please, note that I  imply  no specific  meaning of the word “information” here. We could call it any other way. What I mean is exactly what I have defined, and nothing more.

One last step. FSI is a continuous numerical value, different for each function and system.  But it is possible to categorize  the concept in order to have a binary variable (yes/no) for each function in a system.

So, we define a threshold (for some specific  system of objects). Let’s say 30 bits.  We compute different values of FSI for many different functions which can be conceived for the objects in that system. We say that those functions which have a value of FSI above the threshold we have chosen (for example, more than 30 bits) are complex. I will not discuss here how the threshold is chosen, because that is part of the application of these concepts to the design inference, which will be the object of another post.

g) Functionally Specified Complex Information is therefore a binary property defined for a function in a system by a threshold. A function, in a specific system, can be “complex” (having  FSI above the threshold). In that case, we say that the function implicates FSCI in that system, and if an object observed in that system implements that function we say that the object exhibits FSCI.

h) Finally, if the function for which we use our objects is linked to a digital sequence which can be read in the object, we simply speak of digital FSCI: dFSCI.

So, FSI is a subset of SI, and dFSI is a subset of FSI. Each of these can be expressed in categorical form (complex/non complex).

Some final notes:

1) In this post, I have said nothing about design. I will discuss in a future post how these concepts can be used for a design inference, and why dFSCI is the most useful concept to infer design for biological information.

2) As you can see, I have strictly avoided to discuss what information is or is not. I have used the word for a specific definition, with no general implications at all.

1030743_72733179

3) Different functionalities for different functions can be defined for the same object or set of objects. Each function will have different values of FSI. For example, a tablet computer can certainly be used as a paperweight. It can also be used to make complex computations. So, the same object has different functionalities. Obviously, the FSI will be very different for the two functions: very low for the paperweight function (any object in that range of dimensions and weight will do), and very high for the computational function (it’s not so easy to find a material object that can work as a computer).

OLYMPUS DIGITAL CAMERA

4) Although I have used a conscious observer to define function, there is no subjectivity in the procedures. The conscious observer can define any possible function he likes. He is absolutely free. But he has to define objectively the function, and how to measure the functionality, so that everyone can objectively verify the measurement. So, there is no subjectivity in the measurements, but each measurement is referred to a specific function, objectively defined by a subject.

278 Replies to “Functional information defined

  1. 1
    Mung says:

    Hi gpuccio,

    When you can find the time I’d love to see you create some OPs on basic bioinformatics research:

    What are the tools and databases you use?

    What information can be derived from them?

    How does that assist in the argument for intelligent design?

    Nothing necessarily expansive or detailed, perhaps spread them out over several OPs. Basically looking for introductory level material so that readers (myself included) can perform the same research and obtain the same results. You know, science! 😉

    Also, how to do statistical analysis. I’ve seen you reference the R language. What do you use it for, and how?

    Where can we find your source code?

    Do you have an account on GitHub?

    Thanks!

  2. 2
    Querius says:

    So far, so good.

    Functional information seems like a subset of information. But what makes information functional? Or is all information functional?

    Just asking.

    -Q

  3. 3
    gpuccio says:

    Mung:

    It’s a good idea. I will see what I can do. 🙂

    I perform a lot of medical data analysis with R, which is open source and can be used by anyone. At first it is not very user-friendly, but it is a wonderful software, with packages which allow almost anything, and it is completely free. I find very useful to use it by a graphical interface, which in the beginning simplifies the work very much (I would recommend R Commander).

    My interest for biological databases and procedures of bioinformatics is mainly motivated by my involvement in ID, even if I must say that being a medical doctor certainly helps. The resources are freely available on the Internet (for example, UNIPROT, BLASTP at nlm, SCOP, PDB).

    OK, I hope I can post something more detailed in the future.

  4. 4
    gpuccio says:

    Querius:

    Everything can be functional, if we find a way to use it.

    The point is, some things can be used for very special functions. Machines are specially efficient to do things. Even simple tools can do things that natural objects cannot do.

    Efficiency at specific functions usually depends on specific forms. The more a form is specific, the more its functional information is high.

    In this sense, information just means some kind of form. In that sense, everything has information, but this is not a semiotic meaning of the word.

    Always in this sense, everything has some functional information, because everything has a form that can be used for something. But in most cases the functional information of natural objects is very low: many objects can perform the functions that are possible for those natural objects.

    It’s like in my examples of the stone: a stone can be used to do many things, but all those things can be done by many stones. No really strict functional constraint is necessary.

    Instead, take a machine, like an engine. The things that an engine can do, you cannot do them with stones or other natural objects. You need a special configuration of matter, a configuration which is designed and does not occur naturally.

    With digital sequences, the reasoning is easier, because it is easier to compute the target space/search space ratio.

    As we already know (but I will debate it in detail in a future post) no random process in the whole universe can ever generate 500 bits of functional information in a sequence. Probably, not even much less.

  5. 5
    gpuccio says:

    Querius:

    Functional information seems like a subset of information.

    Well, just to be fastidiously precise:

    Specified information is a subset of information.

    Functionally specified information is a subset of specified information.

    Digital functionally specified information is a subset of functionally specified information.

  6. 6
    Mung says:

    Q:

    Functional information seems like a subset of information. But what makes information functional? Or is all information functional?

    All information is functional. So functional information is not a subset of information.

    I actually deleted some material I started to post earlier in which I asked what is non-functional information, lol!

    So gpuccio is not out to define information, nor to differentiate functional information from non-functional information, but rather to develop a definition of functional information that is objective.

    As far as I know this is all that is required in order to allow it to be useful in science.

  7. 7
    bornagain77 says:

    What a long way this argument has come. I remember when, a few years back, I first ran across Dr. Durston’s work on functional information,

    Robert M. Hazen, Patrick L. Griffin, James M. Carothers, and Jack W. Szostak:
    Abstract: Complex emergent systems of many interacting components, including complex biological systems, have the potential to perform quantifiable functions. Accordingly, we define ‘functional information,’ I(Ex), as a measure of system complexity. For a given system and function, x (e.g., a folded RNA sequence that binds to GTP), and degree of function, Ex (e.g., the RNA-GTP binding energy), I(Ex)= -log2 [F(Ex)], where F(Ex) is the fraction of all possible configurations of the system that possess a degree of function > Ex. Functional information, which we illustrate with letter sequences, artificial life, and biopolymers, thus represents the probability that an arbitrary configuration of a system will achieve a specific function to a specified degree. In each case we observe evidence for several distinct solutions with different maximum degrees of function, features that lead to steps in plots of information versus degree of functions.
    http://www.pnas.org/content/104/suppl.1/8574.full

    Measuring the functional sequence complexity of proteins – Kirk K Durston, David KY Chiu, David L Abel and Jack T Trevors – 2007
    Excerpt: We have extended Shannon uncertainty by incorporating the data variable with a functionality variable. The resulting measured unit, which we call Functional bit (Fit), is calculated from the sequence data jointly with the defined functionality variable. To demonstrate the relevance to functional bioinformatics, a method to measure functional sequence complexity was developed and applied to 35 protein families.,,,
    http://www.tbiomed.com/content/4/1/47

    Mathematically Defining Functional Information In Molecular Biology – Kirk Durston – video
    https://vimeo.com/1775160

    and when I pointed this work out to Darwinists, many die-hard evolutionists would deny that information even existed in a cell. If a Darwinists admitted information was in the cell, then he try to say information is generated using Claude Shannon’s broad definition of information. They did this since ‘non-functional’ information bits may be considered information in his broad definition of information. Yet, Shannon information completely fails to explain the type of information being dealt with in molecular biology:

    Mutations, epigenetics and the question of information –
    Excerpt: By definition, a mutation in a gene results in a new allele. There is no question that mutation (defined as any change in the DNA sequence) can increase variety in a population. However, it is not obvious that this necessarily means there is an increase in genomic information.,, If one attempts to apply Shannon’s theory of information, then this can be viewed as an increase. However, Shannon’s theory was not developed to address biological information. It is entirely unsuitable for this since an increase of information by Shannon’s definition can easily be lethal.
    http://creation.com/mutations-.....nformation

    The Evolution-Lobby’s Useless Definition of Biological Information – Feb. 2010
    Excerpt: By wrongly implying that Shannon information is the only “sense used by information theorists,” the NCSE avoids answering more difficult questions like how the information in biological systems becomes functional, or in its own words, “useful.”,,,Since biology is based upon functional information, Darwin-skeptics are interested in the far more important question of, Does neo-Darwinism explain how new functional biological information arises?
    http://www.evolutionnews.org/2.....ss_de.html

    The GS (genetic selection) Principle – David L. Abel – 2009
    Excerpt: Konopka also found Shannon complexity not to be a suitable indicator of evolutionary progress over a wide range of evolving genes. Konopka’s work applies Shannon theory to known functional text. Kok et al. (71) also found that information does not increase in DNA with evolution. As with Konopka, this finding is in the context of the change in mere Shannon uncertainty. The latter is a far more forgiving definition of information than that required for prescriptive information (PI) (21, 22, 33, 72). It is all the more significant that mutations do not program increased PI. Prescriptive information either instructs or directly produces formal function. No increase in Shannon or Prescriptive information occurs in duplication. What the above papers show is that not even variation of the duplication produces new information, not even Shannon “information.”
    http://www.bioscience.org/fbs/.....6/3426.pdf

    Programming of Life – Information – Shannon, Functional & Prescriptive – video
    https://www.youtube.com/watch?v=h3s1BXfZ-3w

    Three subsets of sequence complexity and their relevance to biopolymeric information – Abel, Trevors
    Excerpt: Three qualitative kinds of sequence complexity exist: random (RSC), ordered (OSC), and functional (FSC).,,, Shannon information theory measures the relative degrees of RSC and OSC. Shannon information theory cannot measure FSC. FSC is invariably associated with all forms of complex biofunction, including biochemical pathways, cycles, positive and negative feedback regulation, and homeostatic metabolism. The algorithmic programming of FSC, not merely its aperiodicity, accounts for biological organization. No empirical evidence exists of either RSC of OSC ever having produced a single instance of sophisticated biological organization. Organization invariably manifests FSC rather than successive random events (RSC) or low-informational self-ordering phenomena (OSC).,,,
    http://www.tbiomed.com/content/2/1/29

    Biological Information — What is It? – published online May 2013 –
    Werner Gitt 1*, Robert Compton 2 and Jorge Fernandez 3
    http://www.worldscientific.com.....08728_0001

  8. 8
    bornagain77 says:

    Dr. Durston, has extended his work here:

    (A Reply To PZ Myers) Estimating the Probability of Functional Biological Proteins? Kirk Durston , Ph.D. Biophysics – 2012
    Excerpt (Page 4): The Probabilities Get Worse
    This measure of functional information (for the RecA protein) is good as a first pass estimate, but the situation is actually far worse for an evolutionary search. In the method described above and as noted in our paper, each site in an amino acid protein sequence is assumed to be independent of all other sites in the sequence. In reality, we know that this is not the case. There are numerous sites in the sequence that are mutually interdependent with other sites somewhere else in the sequence. A more recent paper shows how these interdependencies can be located within multiple sequence alignments.[6] These interdependencies greatly reduce the number of possible functional protein sequences by many orders of magnitude which, in turn, reduce the probabilities by many orders of magnitude as well. In other words, the numbers we obtained for RecA above are exceedingly generous; the actual situation is far worse for an evolutionary search.
    http://powertochange.com/wp-co.....Myers_.pdf

    And Dr. Abel, Dr. Johnson and company, extended functional information to include prescriptive information here:

    Dichotomy in the definition of prescriptive information suggests both prescribed data and prescribed algorithms: biosemiotics applications in genomic systems – 2012
    David J D’Onofrio1*, David L Abel2* and Donald E Johnson3
    Excerpt: The DNA polynucleotide molecule consists of a linear sequence of nucleotides, each representing a biological placeholder of adenine (A), cytosine (C), thymine (T) and guanine (G). This quaternary system is analogous to the base two binary scheme native to computational systems. As such, the polynucleotide sequence represents the lowest level of coded information expressed as a form of machine code. Since machine code (and/or micro code) is the lowest form of compiled computer programs, it represents the most primitive level of programming language.,,,
    An operational analysis of the ribosome has revealed that this molecular machine with all of its parts follows an order of operations to produce a protein product. This order of operations has been detailed in a step-by-step process that has been observed to be self-executable. The ribosome operation has been proposed to be algorithmic (Ralgorithm) because it has been shown to contain a step-by-step process flow allowing for decision control, iterative branching and halting capability. The R-algorithm contains logical structures of linear sequencing, branch and conditional control. All of these features at a minimum meet the definition of an algorithm and when combined with the data from the mRNA, satisfy the rule that Algorithm = data + control. Remembering that mere constraints cannot serve as bona fide formal controls, we therefore conclude that the ribosome is a physical instantiation of an algorithm.,,,
    The correlation between linguistic properties examined and implemented using Automata theory give us a formalistic tool to study the language and grammar of biological systems in a similar manner to how we study computational cybernetic systems. These examples define a dichotomy in the definition of Prescriptive Information. We therefore suggest that the term Prescriptive Information (PI) be subdivided into two categories: 1) Prescriptive data and 2) Prescribed (executing) algorithm.
    It is interesting to note that the CPU of an electronic computer is an instance of a prescriptive algorithm instantiated into an electronic circuit, whereas the software under execution is read and processed by the CPU to prescribe the program’s desired output. Both hardware and software are prescriptive.
    http://www.tbiomed.com/content.....82-9-8.pdf

    And then there is also non-local ‘Quantum Information’ in a cell of which classical information is found to be a subset:

    Quantum Information/Entanglement In DNA – short video
    https://vimeo.com/92405752

    Quantum knowledge cools computers: New understanding of entropy – June 2011
    Excerpt: No heat, even a cooling effect;
    In the case of perfect classical knowledge of a computer memory (zero entropy), deletion of the data requires in theory no energy at all. The researchers prove that “more than complete knowledge” from quantum entanglement with the memory (negative entropy) leads to deletion of the data being accompanied by removal of heat from the computer and its release as usable energy. This is the physical meaning of negative entropy. Renner emphasizes, however, “This doesn’t mean that we can develop a perpetual motion machine.” The data can only be deleted once, so there is no possibility to continue to generate energy. The process also destroys the entanglement, and it would take an input of energy to reset the system to its starting state. The equations are consistent with what’s known as the second law of thermodynamics: the idea that the entropy of the universe can never decrease. Vedral says “We’re working on the edge of the second law. If you go any further, you will break it.”
    http://www.sciencedaily.com/re.....134300.htm

    Quantum Entanglement and Information
    Quantum entanglement is a physical resource, like energy, associated with the peculiar nonclassical correlations that are possible between separated quantum systems. Entanglement can be measured, transformed, and purified. A pair of quantum systems in an entangled state can be used as a quantum information channel to perform computational and cryptographic tasks that are impossible for classical systems. The general study of the information-processing capabilities of quantum systems is the subject of quantum information theory.
    http://plato.stanford.edu/entries/qt-entangle/

    Quantum no-hiding theorem experimentally confirmed for first time
    Excerpt: In the classical world, information can be copied and deleted at will. In the quantum world, however, the conservation of quantum information means that information cannot be created nor destroyed. This concept stems from two fundamental theorems of quantum mechanics: the no-cloning theorem and the no-deleting theorem. A third and related theorem, called the no-hiding theorem, addresses information loss in the quantum world. According to the no-hiding theorem, if information is missing from one system (which may happen when the system interacts with the environment), then the information is simply residing somewhere else in the Universe; in other words, the missing information cannot be hidden in the correlations between a system and its environment.
    http://www.physorg.com/news/20.....tally.html

    It is very interesting to note that quantum entanglement, which conclusively demonstrates that ‘information’ in its pure ‘quantum form’ is completely transcendent of any time and space constraints, should be found in molecular biology on such a massive scale, for how can the quantum entanglement ‘effect’ in biology possibly be explained by a material (matter/energy) ’cause’ when the quantum entanglement ‘effect’ falsified material particles as its own ‘causation’ in the first place? (A. Aspect) Appealing to the probability of various configurations of material particles, as Darwinism does, simply will not help since a timeless/spaceless cause must be supplied which is beyond the capacity of the material particles themselves to supply! To give a coherent explanation for an effect that is shown to be completely independent of any time and space constraints one is forced to appeal to a cause that is itself not limited to time and space! i.e. Put more simply, you cannot explain a effect by a cause that has been falsified by the very same effect you are seeking to explain! Improbability arguments of various ‘special’ configurations of material particles, which have been a staple of the arguments against neo-Darwinism, simply do not apply since the cause is not within the material particles in the first place! Yet it is also very interesting to note, in Darwinism’s inability to explain this ‘transcendent quantum effect’ adequately, that Theism has always postulated a transcendent component to man that is not constrained by time and space. i.e. Theism has always postulated a ‘living soul’ for man that lives past the death of the body.

    And then there is also ‘photonic information’ in the cell:

    Are humans really beings of light?
    Excerpt: “We now know, today, that man is essentially a being of light.”,,, “There are about 100,000 chemical reactions happening in every cell each second. The chemical reaction can only happen if the molecule which is reacting is excited by a photon… Once the photon has excited a reaction it returns to the field and is available for more reactions… We are swimming in an ocean of light.”
    http://viewzone2.com/dna.html

    etc.. etc.. etc…

  9. 9
    Dionisio says:

    gpuccio,

    I’m so glad to read this interesting OP you’ve written, as well as the follow-up comments it has provoked. Good job! Thanks.

  10. 10
    bornagain77 says:

    It is also interesting to note that much of the functional information in the genome is overlapping. At the 7:55 mark of the video, Trifonov makes reference of up to ’13 codes’ in the genome:

    Second, third, fourth… genetic codes – One spectacular case of code crowding – Edward N. Trifonov – video
    https://vimeo.com/81930637

    In the preceding video, Trifonov elucidates codes that are, simultaneously, in the same sequence, coding for DNA curvature, Chromatin Code, Amphipathic helices, and NF kappaB. In fact, at the 58:00 minute mark he states, “Reading only one message, one gets three more, practically GRATIS!”. And please note that this was just an introductory lecture in which Trifinov just covered the very basics and left many of the other codes out of the lecture. Codes which code for completely different, yet still biologically important, functions. Also of note, at the 10:30 minute mark of the preceding video, Dr. Trifonov states that the idea of Dawkins’ selfish gene ‘inflicted an immense damage to biological sciences’, for over 30 years:

    In the following paper, it is mathematically demonstrated what is intuitively obvious. Namely, that the probability of finding overlapping functional sequences, by unguided processes, is vastly more improbable than finding that rare single functional sequence by unguided processes.

    Multiple Overlapping Genetic Codes Profoundly Reduce the Probability of Beneficial Mutation George Montañez 1, Robert J. Marks II 2, Jorge Fernandez 3 and John C. Sanford 4 – published online May 2013
    Excerpt: In the last decade, we have discovered still another aspect of the multi- dimensional genome. We now know that DNA sequences are typically “ poly-functional” [38]. Trifanov previously had described at least 12 genetic codes that any given nucleotide can contribute to [39,40], and showed that a given base-pair can contribute to multiple overlapping codes simultaneously. The first evidence of overlapping protein-coding sequences in viruses caused quite a stir, but since then it has become recognized as typical. According to Kapronov et al., “it is not unusual that a single base-pair can be part of an intricate network of multiple isoforms of overlapping sense and antisense transcripts, the majority of which are unannotated” [41]. The ENCODE project [42] has confirmed that this phenomenon is ubiquitous in higher genomes, wherein a given DNA sequence routinely encodes multiple overlapping messages, meaning that a single nucleotide can contribute to two or more genetic codes. Most recently, Itzkovitz et al. analyzed protein coding regions of 700 species, and showed that virtually all forms of life have extensive overlapping information in their genomes [43].
    http://www.worldscientific.com.....08728_0006

  11. 11
    Eric Anderson says:

    BA77:

    . . . and when I pointed this work out to Darwinists, many die-hard evolutionists would deny that information even existed in a cell. If a Darwinists admitted information was in the cell, then he try to say information is generated using Claude Shannon’s broad definition of information. They did this since ‘non-functional’ information bits may be considered information in his broad definition of information.

    You mean like the example discussed here:

    http://www.uncommondescent.com.....ent-498779

    🙂

  12. 12
    Eric Anderson says:

    gpuccio:

    Thanks for the OP. I hope to be able to think through this in more detail and respond in the next day or so with some thoughts.

    In the meantime (and with apologies for linking to my own piece here), the hierarchy you outlined involving specification and function reminded me of something I wrote a while back. It was focused specifically on Behe’s concept of irreducible complexity (as complemented by Dembski’s writings), but has some relevance to this discussion:

    One of the principal challenges with the concept of irreducible complexity is defining a system’s basic function within a particular environment, and thus determining the irreducible core. Suggestions that certain complex systems are not irreducibly complex often arise from a failure to comprehensively identify the system in question. (Emphasis added.)

    http://www.researchgate.net/pu.....xity_Space

  13. 13
    dgw says:

    Perhaps progress could be made on this topic by considering enzymes as biological embodiments of functional information. Their function is to catalyze a reaction. They are far more effective than chemical catalysts and they have a complex molecular structure. Metabolic pathways rely on a sequence of enzymes to efficiently transform components.

    In a recent publication, PMC3443871, Nanda and Koder write on the design of artificial enzymes. They comment:

    Today, a Boeing 747 is an incredibly complex machine with over 6,000,000 parts. As such, computers have become indispensable in the aerospace industry. Although much smaller in size, the mechanistic complexity of enzymes and challenges associated with their design (Box 1) argue that they are as sophisticated as passenger airliners, and it is expected that computational methods in chemistry and biology will promote a similar revolution in the design of artificial catalysts.

    They go on to describe means of improving enzymes using design techniques and directed evolution.

    Directed evolution implies a target in mind, the result is an enzyme with an improved design that meets their purpose.

  14. 14
    gpuccio says:

    Mung:

    So gpuccio is not out to define information, nor to differentiate functional information from non-functional information, but rather to develop a definition of functional information that is objective.

    As far as I know this is all that is required in order to allow it to be useful in science.

    I am so glad that you have completely appreciated my point!

    The problem is that the word “information” means too many things for too many people. Rather then debating the different meanings, I have just tried to give an operational definition of a particular aspect.

    In a sense, we could say that true information is only designed information: a message of meaning and purpose which is passed from a conscious being to another one, through some physical transmission system. That is true, but how could it help in a discussion about design detection. It would simply be self-referential. We could never argue that designed information is a clue to design!

    The simple truth is, when we want to infer design, we don’t know in the beginning if what we are observing is designed. Otherwise, no inference would be necessary.

    Therefore, we look at configurations of matter, IOWs at forms, and we wonder: is this designed? Is this intelligent, intentional, consciously originated information?

    So, we must start with an open mind, and accept that any configuration we observe could be designed information.

    Function in itself cannot help us, because, as I have said, we can always find some function for something. That’s why it is important to remember that function is a product of consciousness, it is not in the object itself, or in its configuration. But functionality, as I have defined it, is objective, even if in relation to a function objectively defined by a conscious subject.

    But, again, functionality in itself is not enough. Many non designed things are functional for simple functions.

    But functionality for complex functions is the real thing. 🙂

  15. 15
    gpuccio says:

    BA:

    Thank you for your excellent contributions.

    Of course, Dembski, Abel, Durston and many others are the absolute references for any discussion about functional information. I think and hope that my ideas are absolutely derived from theirs. My only purpose is to detail some aspects of the problem.

    And you are perfectly right about the inconsistent objections that are routinely made about this concept, especially by different exploitations of the potential ambiguity of the word “information”. Having discussed for years with our kind (or less kind) interlocutors, as you have done, I know them all. 🙂

  16. 16
    gpuccio says:

    Dionisio:

    Thank you!

  17. 17
    gpuccio says:

    Eric:

    Thank you. Of course, I am aware of the recent discussions here about the information problem, and of your very active and very good role in them. That’s exactly one of the reasons that stimulated me to publish this post, because this is really a central issue for ID, and the more we discuss, clarify and deepen it, the better for us. 🙂

    Behe’s irreducible complexity is another fundamental concept, and it is obviously linked to the concept of functional complexity, but I think that it is a meta-concept. Indeed, irreducibly complex system could be viewed as systems where many different parts, each of them exhibiting high functional complexity, contribute to a higher meta-function, which could not be implemented if even one of the complex parts did not exist.

    In that case, the total functional complexity for the meta-function is obviously obtained by summing the individual functional complexities of the parts in bits (IOWs, multiplying the individual probabilities).

  18. 18
    gpuccio says:

    dgw:

    You are perfectly right, and I agree with each single word you have written in your post.

    Enzymes are the best model for biological functional complexity. The reason is simple. Enzymes are in a sense the most easily understood biological machines. Their function can be very easily defined in terms of the biochemical reaction that they accelerate, and of how much they accelerate it, and it is very easy to define an objective way to measure that function in standard lab conditions, and to fix a minimal threshold of function to be detected if we want to express the measurement in binary form.

    The concepts remain valid for all functional proteins, but for enzymes the application is really straightforward.

  19. 19
    bornagain77 says:

    Eric Anderson, but of course, how could I have forgotten ‘Mr. ‘Just Chemistry’ Evolve’ recent denial of information in the cell 🙂

    “It’s all chemistry, Eric.”
    http://www.uncommondescent.com.....ion-redux/

    No, Mr. Evolve, it certainly is NOT all chemistry, ‘It’s all Information’:

    “a one-celled bacterium, e. coli, is estimated to contain the equivalent of 100 million pages of Encyclopedia Britannica. Expressed in information in science jargon, this would be the same as 10^12 bits of information. In comparison, the total writings from classical Greek Civilization is only 10^9 bits, and the largest libraries in the world – The British Museum, Oxford Bodleian Library, New York Public Library, Harvard Widenier Library, and the Moscow Lenin Library – have about 10 million volumes or 10^12 bits.” – R. C. Wysong
    http://books.google.com/books?.....;lpg=PA112

    ‘The information content of a simple cell has been estimated as around 10^12 bits, comparable to about a hundred million pages of the Encyclopedia Britannica.”
    Carl Sagan, “Life” in Encyclopedia Britannica: Macropaedia (1974 ed.), pp. 893-894

    For calculations, from the thermodynamic perspective, please see the following site:

    Molecular Biophysics – Information theory. Relation between information and entropy: – Setlow-Pollard, Ed. Addison Wesley
    Excerpt: Linschitz gave the figure 9.3 x 10^12 cal/deg or 9.3 x 10^12 x 4.2 joules/deg for the entropy of a bacterial cell. Using the relation H = S/(k In 2), we find that the information content is 4 x 10^12 bits. Morowitz’ deduction from the work of Bayne-Jones and Rhees gives the lower value of 5.6 x 10^11 bits, which is still in the neighborhood of 10^12 bits. Thus two quite different approaches give rather concordant figures. https://docs.google.com/document/d/18hO1bteXTPOqQtd2H12PI5wFFoTjwg8uBAU5N0nEQIE/edit

    Information and Thermodynamics in Living Systems – Andy C. McIntosh – May 2013
    Excerpt: The third view then that we have proposed in this paper is the top down approach. In this paradigm, the information is non-material and constrains the local thermodynamics to be in a non-equilibrium state of raised free energy. It is the information which is the active ingredient, and the matter and energy are passive to the laws of thermodynamics within the system.
    As a consequence of this approach, we have developed in this paper some suggested principles of information exchange which have some parallels with the laws of thermodynamics which undergird this approach.,,,
    http://www.worldscientific.com.....08728_0008
    – Dr Andy C. McIntosh is the Professor of Thermodynamics (which is, I believe, the highest teaching/research rank in the U.K.) at the University of Leeds.

    Quantum Information/Entanglement In DNA – short video
    https://vimeo.com/92405752

    Quote:

    Earth’s crammed with heaven,
    And every common bush afire with God;
    But only he who sees, takes off his shoes,
    The rest sit round it and pluck blackberries.
    – Elizabeth Barrett Browning

    Kirsten Powers’ Reluctant Journey from Atheism to Christian – 2013
    Excerpt: Powers doesn’t recall what Kathy Keller taught on that day, but when she left the Bible study she knew everything had changed. “I’ll never forget standing outside that apartment on the Upper East Side and saying to myself, ‘It’s true. It’s completely true.’ The world looked entirely different, like a veil had been lifted off it. I had not an iota of doubt. I was filled with indescribable joy.”,,,
    “Everywhere I turned, there He was. Slowly there was less fear and more joy.
    http://crossmap.christianpost......stian-6355

    Verses, and music:

    Exodus 3:5
    “Do not come any closer,” God said. “Take off your sandals, for the place where you are standing is holy ground.”

    John1:1-4
    In the beginning was the Word, and the Word was with God, and the Word was God. He was with God in the beginning. Through him all things were made; without him nothing was made that has been made. In him was life, and that life was the light of all mankind.

    Casting Crowns – The Word Is Alive – Live
    http://www.youtube.com/watch?v=X9itgOBAxSc

  20. 20
    gpuccio says:

    BA (and Evolve, if you are there):

    The interesting thing is that random variation in genomes, which is supposed to be the engine which generates new functional information in neodarwinism, is not even the working of biochemistry, but the working of errors in biochemistry.

    Indeed, the molecular machines which duplicate the information in DNA are supposed to duplicate it exactly. But no machine can work perfectly, so errors happen, once in a while. Those errors are the origin of random variation. They happen randomly, because they are errors, Biochemistry is algorithmic. Therefore, if biochemical machines worked perfectly and algorithmically, genomic information would always remain the same (if there were no design intervention).

    So, form a neo darwinian point of view, it’s not all chemistry, it’s all errors in chemistry!

    Expressed that way, it sounds a little foolish, doesn’t it? 🙂

  21. 21
    CuriousCat says:

    gpuccio,

    Thanks for the interesting and informative post. I’m looking forward to reading the rest of this discussion. There is one point I would like to mention, related to the “functionality” concept. You say:

    b) The functionality in the chosen stone: that stone can be used to obtain the desired result.

    You also add:

    4) Although I have used a conscious observer to define function, there is no subjectivity in the procedures. The conscious observer can define any possible function he likes. He is absolutely free. But he has to define objectively the function, and how to measure the functionality, so that everyone can objectively verify the measurement.

    As far as I can see, and Mung pointed out and you agreed, you want to quantify “objective functional information”, so that later you can employ a hypothesis test for the existence of design. The point that I do not feel comfortable is defining the function AFTER observing the function itself. In Darwinian sense (though I disagree), function is not defined beforehand, so the function, itself, is a random variable.

    To explain things a little bit further, let’s take the example of stones on the beach. We may define a certain a function, find the resulting Shannon entropy for that specified function and amazed at that value, but that would be, I think, a biased experiment. To be really amazed at that value, I believe we should (somehow) compute (and/or compare) this value to those computed for all the possible specified functions (the total function space) which have been realized and which will be realized in the universe. In other words, for a specified function we may have high FSI value, but this does not guarantee a highly unlikely process, because the function space is also (quite possibly) infinite (or very huge).

    For instance, if we can guarantee that a single biochemical path exists for the existence of life, then your reasoning is, I believe, sound. Then, we can compute FSI of the ordering of molecules, and so on. However, we cannot guarantee the existence of single ordering of molecules, which will yield life (or something like life). Logically, it may be some other combination(s) of molecules which may produce other types of life(s). Hence, functional space is unknown. I think a single high FSI value (though it indicates the unlikeliness of that event) does not take this factor into consideration.

  22. 22
    Dionisio says:

    This thread is very juicy. I’m taking my time to read it carefully, so that I can digest it well. The main subject discussed here is very important to my current project, so I’m enjoying this discussion. Thanks. 🙂

  23. 23
    gpuccio says:

    CuriousCat:

    Thank you for your intervention, and for your very good and thoughtful objections.

    I will try to answer you, even if that means anticipating some concepts about the design inference.

    First of all, you can see that, as I have defined them, FSI (and therefore dFSI) are not subject to your second objection.

    I quote myself:

    So, let’s imagine that we have 10^6 stones on that beach, and that we try to use each of them to chop some definite food, and we classify each stone for a binary result: good – not good, defining objectively how much and how well the food must be chopped to give a “good” result. And we count the good stones.

    I call the total number of stones: the Search space.

    Emphasis added.

    That means that all my reasoning is referred here to a well defined search space, not to a generic search space.

    And later:

    e) The ratio Target space/Search space expresses the probability of getting an object from the search space by one random search attempt, in a system where each object has the same probability of being found by a random search (that is, a system with an uniform probability of finding those objects).

    So, my definitions are referred to a known search space and a known target space: ideally, each item in the search space should be tested for the function. That’s what is implied in the definition.

    Obviously, I am well aware that in any real context, if the search space is very big, that cannot be done. But there are indirect ways to measure functional information, for example in the protein search space (see Durston). However, I have reserved those aspect of the discussion for a future post.

    For the moment, I want to specify:

    a) That my definiton is relative to some specified function, not to any possible function. I will deal with the “any possible function” perspective, often raised by darwinists, when I will discuss the design inference for proteins. The FSI value is the improbability of getting that function in that system and in that search space, by one attempt and with a uniform probability distribution.
    I can anticipate that the “any possible function” argument is not valid, because in a neodarwinian perspective what we need is:

    – a function which is useful in the complex context of the existing cell

    – a function which is coordinated (in terms of quantity, sequence and location and regulation) with the complex context of the existing cell

    – a function which is so useful that it confers detectable reproductive advantage, and can be expanded and fixed by NS.

    That reduces the space of candidate functions a lot.

    Now, just consider that almost 4 billion years of evolution, whatever the causal mechanism, have found about 2000 basic functional structures (superfamilies) in the huge search space of protein sequences. And that new superfamilies appear at a constantly slower rate.

    We will see, when we debate the design inference for proteins, that even if many new complex functions were potentially available in a specific context, the result would not change much.

    For example, let’s say that 100 new protein structures of about 150 AAs are potentially useful in a cellular context (which, IMO, is highly unlikely), and that each of them has a functional complexity of 300 bits, and therefore a probability of being found of 1e-90. So, we have a search space of 1e195 (20^150), and we are assuming a target space of about 1e105. Let’s say that we want the probability of finding one of the 100 functional proteins, instead of the probability of finding one specific protein. We have to sum the 100 target spaces, while the search space remains the same. So, the total target space will be 1e105*10^2=1e107.
    So, the probability of finding one of the useful proteins has changed of only two orders of magnitude, and it is now 1e-88. Not a great problem, for the design inference.

    More in next post.

  24. 24
    gpuccio says:

    CuriousCat:

    Now, your first objection.

    Is it correct to define the function AFTER observing the function itself?

    And the answer is: yes, provided that the function is well defined.

    You see, if the function is well defined objectively, without any post-hoc reference to the real sequence of bits, then it is perfectly correct to define it after having observed it.

    Let’s make an example. I get by chance the number 83436952. The I say: “Well, let’s define a function for that number. I set my lock combination exactly that way, and then I define the function as being the key for my lock”.

    That is not allowed. That is building an ad hoc function for a random sequence after having observed it. In this case, the only correct definition for the function is: “any number which I can set as a key for my lock”. That is a correct function definition, but it is not complex: a lot of numbers will be functional.

    But let’s say that I observe the number 3.14159265359, and I say: “Hey, these are the first 11 decimal figures of pi!”. And I define the function (well, in this case it’s a meaning more than a function, but let’s not be fastidous 🙂 ) as “the first eleven decimal figures of pi”.

    That is perfectly correct. Why? Because pi is a special number with a special meaning whose definition does not change before and after we observe that result. IOW, the definition is wholly independent from what we observe. Our observation is just a trigger to recognize a function which can be objectively defined at any time, and remains always the same.

    If an enzyme can accelerate a reaction, it can do it. It’s not because we observe the process. It is a functionality which is really in the molecule, we don’t make it up for the observed molecule.

    That will be enough, for now.

  25. 25
    Dionisio says:

    Wow, this discussion is getting really substantial. The old Wendy’s commercial question ‘where’s the beef?’ seems to be addressed here 😉
    Thanks.

  26. 26
    CentralScrutinizer says:

    gpuccio: Because pi is a special number with a special meaning whose definition does not change before and after we observe that result.

    Exactly. Even if humanity had never discovered Pi before, and someone produced the first 500 digits of Pi on a Roulette wheel, that would still be a very special event whether we realized it or not, because of the pre-existing specialness of Pi. The fact is, nobody believes this would ever happen with the probabilistic resources at hand. If, after such an event occurred, we discovered Pi, we would immediately conclude the Roulette wheel’s output was not random- someone rigged the game! That would be the rational conclusion.

    So the question is, with regards to certain biological features, such as OOL and protein domains is, how special were the events leading to them? That is, is the number of chemical pathways that could lead to OOL as we know it large or small compared to all possible chemical events? The smaller that number of pathways, the more special they are. And what sort of impediments might such pathways face? What sort of chemical affinity or resistance?

    “It’s all chemistry” (as Evolve likes to spout) answers nothing. One needs to show the precise pathway(s) that chemical interactions could have tread into order to build the first replicator that is stable and complex enough to develop into what we observe. The OOL theoreticians are light years away from any sort of complete picture. Good luck to them. Given certain lack of chemical affinities (as Meyer explains in Signature of the Cell), it appears downright ridiculous to me to think it wasn’t “rigged.” But time will tell if the anti-ID crowd can fund their promissory notes.

    Thanks for all your great posts, gpuccio.

  27. 27
    Piotr says:

    @gpuccio:

    That is perfectly correct. Why? Because pi is a special number with a special meaning whose definition does not change before and after we observe that result.

    But how many “special numbers” are there? If π qualifies, so presumably do 2π and π/2, and perhaps the binary representation of π, and of course Euler’s number e, and the Golden Ratio φ; and Jean-Claude Perez can assure you that (3-φ)/2 is also very special. So are ?2, ?3, ?5, and 9046503395561 (it’s the 314159265359th prime, and we have already established that the number 314159265359 is special). Oh, yeah, and there are constants in physics too, like the fine structure constant α = 0.00729735257, and its reciprocal 137.035999074.

  28. 28
    Piotr says:

    If you see question marks before 2, 3 and 5 in my post — they were meant to be square root signs.

  29. 29
    gpuccio says:

    Piotr:

    OK, and so? There are many special numbers, but you will never get the first, say, 100 digital figures of any of them by chance.

    There are many ways in which all the molecules of a gas in a container could stay in half the space of the container, leaving absolute void in the other half of the container. But that will never happen, as the second law of termodinamics tells us.

    Why? Because there are so many more, hugely many more, ways in which the molecules are diffused almost equally in all the space of the container.

    And there are so many more, hugely many more, real numbers which are not special at all.

    As the search space increases exponentially, there is no chance at all that the target space linked to order, function or meaning can increase adequately. The probabilities of ordered or functional states diminish inexorably, and very early they become an empirical impossibility.

    Please, see also my post #23. When we speak of hundreds of orders of magnitude of complexity, what does it matter if the target space is a few orders of magnitude greater because we sum the functional events?

  30. 30
    gpuccio says:

    CentralScrutinizer:

    Thank you for your contribution.

  31. 31
    Piotr says:

    OK, and so? There are many special numbers, but you will never get the first, say, 100 digital figures of any of them by chance.

    Not if you have a list of (sufficiently few) “special numbers” in advance. But how is even remotely relevant to the discussion of function in biology? Do you expect to find the digits of π encoded in a DNA sequence? What makes a particular sequence special before you know what it does? Can you give me a list of base sequences that you know to be “special” in the sense π is special? Is the following 183-base-long sequence special or not, and how on earth do you know?

    ACGTAGTGGCGTTCTTCGACTGTTCCCAAATTGTAACTTATTGTTTTGTGAAAATCAAAGTTATTTCTCGATCCTTTTTATGTACGTACCATATTCTTTTAATTCTTTGGTTATTTTTCCGAAGTAGGAGTGAATAAACTTTCGTTTACGTCTTATTATTAATGATATAGCTATGCACTTTGT

  32. 32
    Piotr says:

    Correction: “But how is it even remotely relevant…”

  33. 33
    gpuccio says:

    Piotr:

    You are a linguist.

    An english sonnet is made of about 600 characters.

    Now, I will ask:

    If you have a random generator of character sequences, how many do you think the probabilities are, in one attempt, of generating:

    a) A specific sonnet by Shakespeare?

    b) One of Shakespeare’s sonnets?

    c) Any good meaningful sonnet in english?

    d) Any good meaningfful text of 600 characters in english?

    While certainly a) is lower than b (not much), and b) is lower than c) (much), and c) is lower than d) (very much), would you bet on d)? Even if you had a lot of attempts? (Let’s say 10^42).

  34. 34
    gpuccio says:

    Piotr:

    We must distinguish between descriptive information and prescriptive information (see Abel). Pi is an example of descriptive information (it coveys a meaning). A protein gene is an example of prescriptive information (it conveys the sequence of AAs of a functional protein that can, for example, accelerate a specific biochemical reaction). A protein gene is more similar to the plan of a machine.

    A machine does something. Maybe I don’t know how to convert the information into the machine. That’s not a problem. I never said that we can always recognize the function. The design inference has 100% specificity, but low sensitivity.

    If a sequence of nucleotides is a protein coding sequence, the protein can be built and tested. The biochemical activity we observe, if we observe it, does not depend on our “understanding”. It is there. It does not depend on us.

  35. 35
    Piotr says:

    gpuccio:

    Are you sure you are dealing with anything as specific as “as a sonnet by Shakespeare” or even “a meaningful text in English”? Actually, any sequence of bases is potentially “meaningful” in the sense that it can be interpreted as a sequence of codons. Apart from being translatable it can also produce RNA, or play some other role (a binding site, an enhancer, whatever). Even if you know what protein is produced, how do you determine whether the protein has any kind of “functionality”? How do you define your target space?

  36. 36
    CuriousCat says:

    gpuccio

    Your answers made my my mind much clearer about what we are talking about.

    Just a couple of points.

    …2000 basic functional structures (superfamilies) in the huge search space of protein sequences…
    let’s say that 100 new protein structures of about 150 AAs are potentially useful in a cellular context..

    I think you confine your search through all the previously found protein structures (in my opinion, “folds” may be also used here) and all the possible structures that is likely to be found (which may be estimated based on historical data) in the future. I agree with this definition. Here, I object to Piotr who said Is the following 183-base-long sequence special or not, and how on earth do you know? . We can easily check whether this sequence folds or not (well, maybe not so easily, since folding depends on temperature, pH, ligand, etc.) Nevertheless, at least in principle, we MAY check whether this sequence has the POTENTIAL to have a function (so may be special) or not.

    The second point I would like to talk abaout:

    If an enzyme can accelerate a reaction, it can do it. It’s not because we observe the process. It is a functionality which is really in the molecule, we don’t make it up for the observed molecule

    I see your point, and I agree with you to a large extent. One minor aspect I do not feel very comfortable is that we define the concepts of “enzyme” and “reaction” since they are already out there. Your suggestion may be, as I said earlier, justifiable if ours is the only life form in the universe. However, assume that we were living in a Star Wars universe, in which there were many different space-species and each had a different biomolecular structure. In that universe, a certain biomolecular organization would not be deemed to be special, since different molecular organizations would also be “functional”. So I guess, here, FSI depends (though implicitly) on the uniqueness of the biochemistry of living organisms. There should be one to one mapping between enzymes and life. In this case, we would KNOW that there is a unique solution to the problem of life, so the ultimate function (life) may be reduced to a lower set of functions (structures and then coding of proteins).

    Thanks again for the thought provoking discussion.

  37. 37
    gpuccio says:

    Piotr:

    You are anticipating issues which I have not yet debated in this thread, but it’s OK.

    First of all, not all nucleotide sequences can be interpreted as protein coding. Even if we don’t know the protein, there are rules to identify possible ORFs (open reading frames) in a genome: they must have a starting codon, a minimum length and a stop codon).

    But that’s not important. The point is, with proteins we are not looking at a meaning, but at a function. Functions can be objectively defined and measured. An enzymatic function is the best example.

    Now, the problem is: how do we measure functional complexity in proteins? That should have been the object of a future OP, but I am glad to anticipate something now.

    Once we have defined a specific function, obviously we cannot measure each possible sequence to see if it is functional in that sense. The search space is too big. We will never be able to do that. Indeed, the whole universe cannot do that.

    But there are other ways.

    What do we want to know? First of all, it is useful to start from the observed functional protein (an enzyme, for example), and assume as search space the total number of sequences of that same length. There are many reasons to do that, but I will not deal with them now. So, let’s assume that the search space is 20^n, where n is the number of AAs in the protein.

    That gives us huge search spaces even for relatively short proteins.

    But how do we measure the target space? That is the real problem. We have to use indirect ways.

    Now, a good understanding of functional protein space and of the relationship between sequence, structure and function is the best way top proceed. Unfortunately, that understanding is still limited. You may have read that Axe evaluates at 1:10^70 the number of sequences that fold. Szostak is the author of the paper you cited which is usually used to refute Axe, but believe me, that paper is completely flawed.

    Another way is to look at the existing proteome. The 2000 superfamilies are isolated at sequence level, and that tells us that protein function is organized in islands. The rugged landscape theories tell us that the islands are more than we could think, but that they are anyway isolated.

    I have given you an example of a protein, the beta subunit of ATP synthase, where 630 AAs could never change in billion of years. That should tell you how restricted and constrained the target space can be.

    Finally, Durston has given a simple and very good method to measure functional complexity in protein families. Please, read his paper:

    “Measuring the functional sequence complexity of proteins”

    http://www.tbiomed.com/content.....2-4-47.pdf

    and then we can discuss it.

  38. 38
    Eric Anderson says:

    gpuccio:

    First quick comment:

    I realize you have stated that functional specification is a subset of specification. The difference being that the functional specification includes parameters about the function/functionality, whereas the specification does not. That is fine as far as it goes. I’m just wondering how far it goes.

    It seems the only distinction here is that the specification wasn’t really very specified? 🙂 Meaning, if we loosely and vaguely define our specification then it might not be specific enough to clearly articulate the function. But if we then go on to better articulate the details, the function emerges, almost by definition.

    This kind of thing happens in engineering situations all the time. The boss says “Do X.” He has made a specification, per your definition. But it is so vague and general, that the poor engineer has no idea where to turn. After a few more questions, the boss finally articulates the request in a bit more detail and the engineer can start to home in on what the boss really wants X to do. Finally, perhaps after some additional back-and-forth, a light will turn on in the engineer’s mind and the engineer might reply, “Ah, I see. So what you really want to do is Y.” To which the boss replies, “Yes, yes, that’s what I’ve been trying to describe.” Then perhaps even after a few days of initial work, some feedback and trial-and-error, they get a very good handle on exactly what it is they want the system to do. At this point they call it Z.

    Now we could call X a “specification” and Z a “functional specification.” And maybe that has some utility (I’m not yet convinced). But really all we’ve seen is that X was too general, and Z is a more specific statement.

    Z, has more specification by definition, because it is more specific.

    In other words, getting from a “specification” to a “functional specification” is not, it seems in most cases, a matter of substantive or theoretical difference between the two. Rather, it is just a question of being more specific in outlining the parameters. It is just a question of having properly specified exactly what is required.

    So the only real distinction between the two is that one is vague/general, and the other is more specific. One is specified and the other is more specified. One is poorly defined/specified, the other is well defined/specified. One is the lazy man’s description, the other is the careful engineer’s description.

    —–

    Please note I am not at this point disputing your approach, nor am I necessarily suggesting that it needs to be changed. This is a very fine nuance I am focusing in on, namely the fact that the difference between what you are calling “specification” and “functional specification” is really just one of degree — the degree to which we have done the work and taken the time to properly specify what it is we’re talking about.

    (This is virtually the identical issue I was critiquing Bill Dembski about in his essay on irreducible complexity.)

    Again, maybe there is still value to your broader point in defining the two as separate things, I’m not sure. But substantively it seems they could collapse into the same definition (call it either “specification” or “functional specification”). It is just a question of whether we have properly and adequately done the work of laying out the specification.

  39. 39
    gpuccio says:

    CuriousCat:

    OK, I agree with your comments, but remember: even if completely different forms of life were possible on other planets, that would not help explain how a new protein structure arises here, in a cell which is already based on our biochemistry.

    As I said, the existence of a complex cellular environment limits extremely the number of useful new solutions in that environment.

    IOWs, you need not only write a new software procedure, but you also have to make one which may be useful in Windows 8, and compatible with the existing code!

  40. 40
    CuriousCat says:

    gpuccio

    I have been thinking about this example, but I could not remember where I read it. Going through a couple of statistics papers, I’ve found it!! Here’s the link:

    http://library.mpib-berlin.mpg.....s_2004.pdf

    Starting from the last paragraph on page 602 and through 603, the author tells a story attributing to Feynman. Though I, now, agree that the way you define functionality is unlike the case mentioned here (before vs. after the experiment case), that may be a kind of response you may encounter so I thought maybe you would like to take a look at it.

    Have a nice day.

  41. 41
    gpuccio says:

    Eric:

    Probably, I have been too quick about the problem of specification, just to avoid being too long in the OP.

    I will try to clarify better.

    I have written:

    Specification. Given a well defined set of objects (the search space), we call “specification”, in relation to that set, any explicit objective rule that can divide the set in two non overlapping subsets: the “specified” subset (target space) and the “non specified” subset. IOWs, a specification is any well defined rule which generates a binary partition in a well defined set of objects.

    Now, there are many possible ways to generate a binary partition in a set of objects. Defining a function for those objects (something for which they can be used) is only one way.

    For example, we could generate a partition by dividing sequences in compressible (ordered) and non compressible. I believe that Dembski sometimes uses this concept. But being compressible is not a function, but another kind of property.

    With Piotr, I have made an example based on meaning, and I have introduced a distinction between descriptive information (meaning) and prescriptive information (function). I take that distinction from Abel, and I find it very useful.

    There is a subtle difference between meaning and function, even if they are strictly linked, and even if both can be used to specify.

    A meaning is in the object (let’s say a sonnet on a sheet of paper), but if nobody understands it, nothing happens.

    A function is in the object (let’s say a machine), and if the machine is not working, nothing happens. But if the machine is working, a definite result happens in the outer world, even if nobody is there to understand and recognize it.

    A sonnet on a sheet of paper is inert. It can only be understood by a conscious being.

    A working machine works. It needs not a conscious being to work, even if a conscious being was necessary to build it.

    We detect enzymatic activities even when we don’t know anything about the protein, its sequence and how it works. We can just see the results.

    So, when I say that functional specification is a subset of specification, I don’t mean that specification is vague, and functional specification is more detailed. Not at all.

    I mean that functional specification is specification by a function, while meaning based specification is a specification based on meaning, and could be good for language. And specification by compressibility can be good to separate ordered sequences from non ordered sequences.

    It’s not a question of detail, but of what we use to generate a binary partition of the set.

    But in all cases, the specification must be clear, detailed ad objective. Otherwise, no reasoning can be done.

    I hope that clarifies better my views.

  42. 42
    gpuccio says:

    CuriousCat:

    Thank you for the link.

    Being involved in statistical analysis all the time, I am well aware of the problem of overfitting. It is certainly a serious problem, and one often not considered enough, especially in medical literature.

    However, it is a problem that can be solved, and I don’t think it is really relevant here.

    Here, we are not modeling some result by many variables, so that random noise in those variables can be considered as a true effect if we use a dubious threshold for significance. Here, we are just rejecting the null hypothesis that random noise can generate a very powerful, objective effect that we really observe, and we reject that hypothesis because its improbability is amazing, tens and hundreds of magnitude beyond any conventional threshold.

    When you get p values of the order of 1e-10 or 1e-20, overfitting is certainly not your major concern.

    And the effect of functionality in an enzyme is not certainly a false effect, generated by random noise. The effect is there, as big as the sun. Thousand of functional proteins are not a false effect.

    If the appearance of design were a false effect of random noise, it would not appears in 2000 different and isolated systems. Functional information is certainly not the result of overfitting in our analysis. It must be explained, either by neo darwinism (which can’t do it) or by design. Those are the only two games in town. One of them must be true.

    Guess which?

  43. 43
    Mung says:

    gpuccio:

    CuriousCat:

    Thank you for your intervention, and fur your very good and thoughtful objections.

    There, I fixed it fur ya!

  44. 44
    Mung says:

    Eric:

    Z, has more specification by definition, because it is more specific.

    Specification By Example

    🙂

  45. 45
    Mung says:

    gpuccio:

    When you get p values of the order of 1e-10 or 1e-20, overfitting is certainly not your major concern.

    CuriousCat on P-value

  46. 46
    gpuccio says:

    Mung:

    CuriousCat is perfectly right:

    “P-value is not the probability of null hypothesis being correct given the current data. It is the probability of obtaining the current data given that null hypothesis is correct. ”

    The correct definition of p in hypothesis testing is the first thing I try to explain to young medical doctors as soon as I can. It is perfectly true that the number of medical doctors who correctly understands that definition is… (no, I will not say it! 🙂 )

    “Experimenters in psychology and (in many cases) biology misuse (or misinterpret) this subtlety in the meaning of P-value, and take a P-value smaller than 0.05 as an indication of the improbability of the null hypothesis being true and reject it in favor of the alternative hypothesis. Since it is usually the alternative hypothesis that draws attention in the scientific community and makes the research publishable, researches collect many data points and “filter” them to get a magical P-value smaller than 0.05!”

    True. The use of statistic in medicine is often embarrassing, sometimes shameful. But it is possible to use it well. And many times it is used well, even in medicine.

    However, all that has nothing to do with our design inferences, which are a good example of a good use of statistics. And, certainly, are not at all based on “a magical P-value smaller than 0.05” 🙂

  47. 47

    On the distinction between Specification (S) and Functional Specification (FS) as per Eric Anderson at # 38 and gpuccio at #41.

    Gpuccio your posts excell always by their clarity, interesting perspectives and topics.

    On the topic at hand I wonder if you can help me to better understand the S and FS by giving us a concrete (complete) example of a Specification and a Functional Specification for the “chooping tool” scenario you used at the beginning of your post

    For the “stones on the beach” case can you tell us:

    1. What would be a valid, concrete “specification”

    2. What would be a valid, concrete “functional specification”

    3. Emphasize for us what would be common between the two and what would be the specific difference between the two.

    4. Can be argued(as Eric did) that the difference between 1 and 2 is more a matter of degree rather than one of substance?

    If I can try my hand here for 1 and 2 above:

    1. The natural language statement: “a stone appropriate to be used as a chopping tool”

    2. A stone is appropriate to be used as a chopping tool if it complies with this “function” (conditions | parameters):

    a. Weight greater than 1 pound

    b. Weight smaller than 10 pounds

    c. Made of hard material (not soft or breakable) (hardness between x and y)

    d. Can be held in my hand comfortably (size: between 4 and 8 inches)

    You may have a better idea about particular and concrete examples of Specification and Functional Specification for your “stones on the beach” scenario.

    I am wondering if you have time and inspiration to give concrete examples of an S and the corresponding FS for another, non-trivial example/case. (Is Behe’s mouse trap too complex of a case?)

    On a different line I would like your thoughts on the following question?

    Where do you see the most significant value of your essay about Functional Information?

    a. Conceptual value (clearly defines and demarcates fundamental concepts for the domain)

    b. Theoretical value (set the basis of coherent theory with correspondence to reality)

    c. Pragmatic value (provide specific approaches and formulas to compute FSI, FSCI, dFSCI, etc., detect design, etc.)

  48. 48
    gpuccio says:

    InVivoVeritas:

    Thank you for the kind words.

    And for the good questions, which allow some better clarification of aspects which I have not detailed enough.

    So, your 4 questions:

    1) A generic specification is any kind of specification (any “rule” which generates a binary partition in the set of objects). Let’s call this set of specifications S. As functional specifications are a subset of S, FS is included in S. But, if you want some specification in S which is not in FS, then you have to use some rule which is not related to a function to generate the partition. Your example for 1 is not an example of S specification which is not an FS specification. It is an example of incomplete FS specification. The difference between S (non FS) and FS is in the type of rule, not in the completeness of the definition of the rule.
    An example of S specification which is not an FS specification, based for instance on order/compressibility, could be the following: any stone on the beach which is almost perfectly spherical (with defined limits of tolerance). That rule generates a binary partition, but is not related to a function.

    2) A functional specification would be the “chopping food” rule, with enough details (what food needs to be chopped, in what context, and how well) to make the assessment of the function objective.

    3) It should be clear now why the two specifications are different. Although we could define a function for a spherical stone, the specification by a geometrical form in itself makes no reference to a function, or to a specific use of that form. I believe that FS is more useful than generic specification for design inference in biology for two reasons:

    a) It is the natural kind of specification for biological molecules, especially proteins: proteins are biological machines, their information is prescriptive, not descriptive.

    b) The concept of function is specially apt to be a tool to detect design, because it is obviously connected to one of the two fundamental experiences of conscious beings: purpose. Meaning is the other fundamental conscious experience, and it is equally good to detect design, but it is more appropriate for objects with descriptive information (language). Function is the natural specification for software and biological molecules.
    Instead, specification based on compressibility, while valid, is less useful in our contexts as a design detection tool. Compressibility can be connected to conscious experiences, but the link is less obvious. Moreover, order and compressibility have another hindrance: in appropriate contexts, they can be generated by necessity algorithms. This is an aspect I have not yet discussed in this thread, but it is obviously part of the design detection procedure (excluding necessity).

    4) I think I have already clarified that the difference between S (non FS) and FS is of substance, and not of degree.

    Regarding the final “questionnaire”, what can I say? Being naturally humble, I hope my essay has significant value for all three of them. 🙂

  49. 49
    CuriousCat says:

    It seems that I had an indirect contribution (while sleeping :)) to the rest of this interesting discussion with a previous post about p-values linked given by Mung. Very briefly, I should say that I agree with gpuccio on the use of P-values in the scenario related with proteins. However, I emphasize the importance of uniqueness once again, and I slightly disagree with gpuccio who says that this has nothing to do with design inference.

    I do not want to be tedious, but I believe this is the heart of the controversy between the Theistic and Darwinian views, so I’ll try to explain it shortly, using the example of Feynman.

    Say that we have a maze, in which we put a rat. Rat may choose left (L) or right (R) directions. We leave the rat, it goes LRLLRRLLLLLRRRRRLLLRRRRR (make it as long as you want) and finds the exit. How can we test the hypothesis that the movements (choosing L or R) of the rat is random or not? One way is to assume say that Ho: LRLLRRLLLLLRRRRRLLLRRRRR pattern is random vs.
    H1: LRLLRRLLLLLRRRRRLLLRRRRR pattern is NOT random. When you find the P-value for this specific pattern, it’s going to come out …. (whatever). The thing is as the sequence gets larger larger, P-value will get smaller, so we reject the randomly moving rat hypothesis.

    So, are we justifed in performing the test in the above presented manner? My answer is a reserved no. The rat would of course choose a L-R pattern, and the specific chosen path would be a highly unlikely choice as the sequence gets larger. However, there are two reservations:

    1. If we can show (or assume) that this is the ONLY path that leads to the exit, then this is a special path. I think gpuccio would call (and I agree) this path a functional path. In this case, we MAY be justifed in this hypothesis test. When it comes proteins-life case, this path may correspond to folded proteins, I think. That’s why I think folded proteins should be the starting point for such a theory. Life is not only a transformation of 2-d coding to function, in this case Darwinists would be more justified in their views. For instance, as Piotr pointed out, why can’t we assume that any 2-d code would not work (be functional for life)? We cannot because folding (at least under some conditions) is a MUST. Hence, life is 2-d code -> 3-d structures -> life, it is not something like “anything goes”. So the paths which lead to life (as we know up this day) consists of finite number of functional entities. This is why I insist on the uniqueness of paths leading to life. Otherwise, the hypothesis test presented above would not work, in my opinion.

    2. The other is more controversial and maybe irrelevant to the current topic, but may be relevant to the general ID-Darwinism controversy. Let’s say that the shortest path to exit is LRLLLRR. However, mouse makes a couple of wrong turns, does LRLLLRLRR (an additional LR added) but finds the exit at the end. Can we still use the above hypothesis test? Not directly, but in the following way we may, I guess. We may consider all the paths which do not lead to the exit and which lead to exit making with some wrong turns in between, and then see where the current observation lies. For a low P-value, we would say that this is not random. So, why do I call this controversial? Unfortunately, life is not a single exit as presented here. Say, there are cheese pieces along the way to the exit, so the immediate aim of the mouse may not be to get out of the maze but first eat these cheese pieces, then get out. So it may unnecessarily (from the point of view of a person who thinks exiting the maze is the first aim) visit many additonal paths. This is a mistake many Darwinists make, I think. They assume that they know the mind of God (who they do not believe), and say that if this were a guided process, this and that would not have happened, which is actually a bad hypothesis test, in my opinion.

  50. 50
    gpuccio says:

    CuriousCat:

    Thank you for your very good contributions, both indirect and direct. 🙂

    A few comments.

    Say that we have a maze, in which we put a rat. Rat may choose left (L) or right (R) directions. We leave the rat, it goes LRLLRRLLLLLRRRRRLLLRRRRR (make it as long as you want) and finds the exit. How can we test the hypothesis that the movements (choosing L or R) of the rat is random or not? One way is to assume say that Ho: LRLLRRLLLLLRRRRRLLLRRRRR pattern is random vs.
    H1: LRLLRRLLLLLRRRRRLLLRRRRR pattern is NOT random. When you find the P-value for this specific pattern, it’s going to come out …. (whatever). The thing is as the sequence gets larger larger, P-value will get smaller, so we reject the randomly moving rat hypothesis.

    I am not sure I understand what you mean here. Why would the p value get smaller? How are you getting a p value here? What is the H0 hypothesis?

    If there are only a few sequences that reach the exit, and the rat easily finds the exit, then we can reject the Hypothesis that it is moving randomly (if that is our null hypothesis). We still have to try to explain how the rat found the exit route: IOWs, rejecting the null hypothesis does not automatically support an alternative hypothesis. That is another methodological problem which is often misunderstood. IOPWs, rejecting that null hypothesis just means rejecting that the rat is moving randomly, but does not explain automatically how it finds the route.

    The only reason why a longer pattern would be “less random” is that, if the rat finds the route, the longer the way, the lower is the probability that he finds the route by chance. Therefore, if the way is long enough, we can safely reject the null hypothesis of a random movement. If there are only 3 binary nodes, and only one sequence finds the exit, we have 2^3 = 8 possible sequences, and the probability of the rat finding the exit by chance is 1:8, 0.125. Rejecting the null hypothesis does not make sense.

    But is there are 100 nodes, and still the rat finds the exit in one attempt, the probability of that is about 1e-30. If still the rat finds the exit, I would definitely reject the null hypothesis. The rat is not moving randomly. The scenario is similar to the problem of protein function. Overfitting has nothing to do with this situation. Observing the result after it has happened has no relevance. Finding the exit is a well defined special result, and nothing changes if we define it before or after it happens. What other special result could the poor rat get? Flying?

    General considerations on life have no relevance too. Finding a 300 AAs long proteins which is an enzyme, and accelerates a reaction which in nature is extremely difficult and slow, or just would not happen, is like finding the exit with hundreds of nodes. It will never happen by chance. The null hypothesis of chance can very safely be rejected.

  51. 51
    aqeels says:

    Great post gpuccio.

    For what it is worth, the concept of dFSCI has always been very clear to me and IMHO it is the most productive version of the specified complexity argument.

    The best bit about it is that for any given protein we dont even need to work out all of the “functions”; On the contrary we just need to find one unambiguous function.

    Eric:

    It seems the only distinction here is that the specification wasn’t really very specified? Meaning, if we loosely and vaguely define our specification then it might not be specific enough to clearly articulate the function. But if we then go on to better articulate the details, the function emerges, almost by definition.

    Well said. That is precisely the distinction that dFSCI is trying to make and that is why it will be the most productive approach in demonstrating the implausability of what the non-design proponents are trying to say…

  52. 52
    gpuccio says:

    aqeels:

    I am honored of your appreciation.

    The best bit about it is that for any given protein we dont even need to work out all of the “functions”; On the contrary we just need to find one unambiguous function.

    That’s it! By leaving the observer completely free to define any function he likes, we are no more interested in how many different functions can be found. One single function which is also complex will be enough for the design inference.

  53. 53
    CuriousCat says:

    gpuccio:

    If there are only a few sequences that reach the exit, and the rat easily finds the exit, then we can reject the Hypothesis that it is moving randomly (if that is our null hypothesis).

    EXACTLY! If there are ONLY A FEW sequences that reach the exit, then we reject the null hypothesis that rat is moving randomly.

    However, the way a Darwinist thinks is different from a person who sees the universe in teleological perspective. The way he/she would respond this hypothesis test would be by saying that how do we know that these are the only paths?

    Actually, I remember a discussion here, where Darwinists were not persuaded by 500 coins all Heads as some special event, and they said this is just a sequence among 2^500. As a molecular biology analogy, they may have a point (on the other hand, for a real life engineering situation this thinking is sheer stupidity). It is humans that give a special meaning to all heads case, since this is not something randomly occurring in our daily lives. If we try to “isolate” a certain event from its surroundings and test its randomness, it will be a biased experiment and analysis. That’s also the issue with P-value getting smaller (I mentioned earlier), the longer the sequence the lower probability of obtaining a specific sequence (0.5^500), but it may us who give a meaning to specific sequence.

    Now, you may say that what if this specific sequence is functional (objective function). Say that we toss a dice 500 times and the resulting sequence somehow creates a key and this key opens a door. Can’t we now do the hypothesis test? Still no, unless we know that tossing other sequences will not open a door. We have but one advantage over Darwinism, biology tells us that most of the other sequences will not open a door, and will not have a function. However, we have a another problem.

    A Darwinist may argue that those doors are not aligned side by side, but they are one in another. So other doors (call it A1, A2, ..) are opened when you open the first one (call it A). And if you happen to open another door (call it B) in the first instance, different doors (B1, B2, ..) may be waiting for you. In summary, objective functions have not been clearly defined previously (how can it be for a random process?), but the functions themselves are evolving (or formed) as sequences are evolving. So we’re back to square one, because a single sequence having a function, or a series of sequences having functions cannot be tested because the functions themselves do not preexist (I’m still Darwinist’s shoes, in my shoes I believe they preexist). I think it was Stephen Gould who said something like it is only due to chance that humans instead of dolphins, or other creatures rule the earth (this might be an awful quotation but I cannot find the exact words right now), which shows that the path and existing status of sequences and functions could have been different. If this is the case (or dominating view in science), then I do not think we are justified in the hypothesis test we are arguing above.

    On the other hand, you already suggested a solution here. You said ~2000 functional protein families exist. The reason why I think functionality here could be replaced by “folds” (and that may be the reason why Axe based his study in folds) is that coin tossing sequence should first produce a key (fold), so that it may open a door (have a function). Now, we see that fold is a preexisting entity (in Platonic sense), which depends only on the fundamental laws of nature. Though function itself is like a fluid, whose existence depends on the existence of other functions and may change (again from a Darwinist perspective) fold is not. Please go back to what Piotr asked how do you determine whether the protein has any kind of “functionality”? How do you define your target space?. This means (in my opinion): in the current laboratory environment, protein may not have a function. It may not currently have any function in the whole nature. However, in 1000.. so years, it may have function. Or in an alternative path that could have been taken by evolution, it would have a function. So a random non-functional sequence would be functional in an alternative evolution history.

    I think I have written too much, and I may have bored people (if anyone bothered to read up to this point), so I stop here and not say anymore for this discussion. We’ll probably continue in another topic gpuccio. I must say I really like the atmosphere of the discussion board here 🙂

    Erratum: In the previous post I wrote 2-d code. It should be of course 1-d code.

    One last unscientific point: I find the existence of a protein fold a miracle; the connection between a protein and its function another miracle.

  54. 54
    Piotr says:

    Actually, I remember a discussion here, where Darwinists were not persuaded by 500 coins all Heads as some special event, and they said this is just a sequence among 2^500.

    I wouldn’t say so. I would treat such as result as proof that the coin isn’t fair (and I’d hypothesise that it most likely has Heads on either side). I’d also think of ruling out the possibility of an illusion trick. An apparently unlikely result may have a mundane explanation. Heads in 500 consecutive fair flips would qualify as a putative miracle — but then I’ve never seen any such thing happen.

  55. 55
    Joe says:

    As long as you realize it wasn’t by chance, Piotr. That is the point.

  56. 56
    gpuccio says:

    CuriousCat:

    I think I answered many of the darwinist objection you mention in my post #23.

    Regarding folding, in SCOP 2.03 classification there are 1194 independent foldings, 1961 superfamilies, 4496 families. While foldings is the fundamental grouping, superfamilies are still a completely sequence isolated grouping, based mostly on structure and function. That’s why I refer usually to them. Foldings would be good too, and probably also families, although between families you could sometimes find some possible vague evolutionary connection.

    There is no absolute connection between the length of a sequence and a p value. A p value must be referred to some definite result, for which we can build H0 and some alternative hypothesis.

    So, if we have a 200 bit sequence, there is no p value about it in itself. If we get that sequence randomly, it’s fine. It is just a sequence that we can get randomly. The probability of getting a generic 200 bit sequence by 200 random events each generating 1 bit is 1.

    But, if we have a 200 digit sequence and we ask for the probability of generating that sequnce after we have defined it, it is 1:2^200. This is an example of pre-specification. The sequence has nothing peculiar, but it becomes peculiar becuase we know it in advance.

    And if we ask the probability of getting a sequence of 200 1s or 200 0s, the probability is 2:2^200, always. Here, it’s not important that we define the peculiarity before or after. The peculiarity is there anyway.

    Please, see my post #29 to Piotr:

    There are many special numbers, but you will never get the first, say, 100 digital figures of any of them by chance.

    There are many ways in which all the molecules of a gas in a container could stay in half the space of the container, leaving absolute void in the other half of the container. But that will never happen, as the second law of termodinamics tells us.

    Why? Because there are so many more, hugely many more, ways in which the molecules are diffused almost equally in all the space of the container.

    And there are so many more, hugely many more, real numbers which are not special at all.

    As the search space increases exponentially, there is no chance at all that the target space linked to order, function or meaning can increase adequately. The probabilities of ordered or functional states diminish inexorably, and very early they become an empirical impossibility.

  57. 57
    gpuccio says:

    Piotr at #54:

    Please, see my answer to Eric at #41:

    Specification. Given a well defined set of objects (the search space), we call “specification”, in relation to that set, any explicit objective rule that can divide the set in two non overlapping subsets: the “specified” subset (target space) and the “non specified” subset. IOWs, a specification is any well defined rule which generates a binary partition in a well defined set of objects.

    Now, there are many possible ways to generate a binary partition in a set of objects. Defining a function for those objects (something for which they can be used) is only one way.

    For example, we could generate a partition by dividing sequences in compressible (ordered) and non compressible. I believe that Dembski sometimes uses this concept. But being compressible is not a function, but another kind of property.

    With Piotr, I have made an example based on meaning, and I have introduced a distinction between descriptive information (meaning) and prescriptive information (function). I take that distinction from Abel, and I find it very useful.

    There is a subtle difference between meaning and function, even if they are strictly linked, and even if both can be used to specify.

    A meaning is in the object (let’s say a sonnet on a sheet of paper), but if nobody understands it, nothing happens.

    A function is in the object (let’s say a machine), and if the machine is not working, nothing happens. But if the machine is working, a definite result happens in the outer world, even if nobody is there to understand and recognize it.

    A sonnet on a sheet of paper is inert. It can only be understood by a conscious being.

    A working machine works. It needs not a conscious being to work, even if a conscious being was necessary to build it.

    We detect enzymatic activities even when we don’t know anything about the protein, its sequence and how it works. We can just see the results.

    Emphasis added.

    And to InVivoVeritas at #48:

    The concept of function is specially apt to be a tool to detect design, because it is obviously connected to one of the two fundamental experiences of conscious beings: purpose. Meaning is the other fundamental conscious experience, and it is equally good to detect design, but it is more appropriate for objects with descriptive information (language). Function is the natural specification for software and biological molecules.
    Instead, specification based on compressibility, while valid, is less useful in our contexts as a design detection tool. Compressibility can be connected to conscious experiences, but the link is less obvious. Moreover, order and compressibility have another hindrance: in appropriate contexts, they can be generated by necessity algorithms. This is an aspect I have not yet discussed in this thread, but it is obviously part of the design detection procedure (excluding necessity).

    Emphasis added.

    You may be aware that excluding a necessity (algorithmic) explanation is an integral part of ID from the beginning, it’s already there in Dembski’s explanatory filter.

    Complexity due to order is often (but not always) generate by algorithms. That is not true of complexity due to function (prescriptive information) or to meaning (descriptive information). Those types of complexity are scarcely compressible, and cannot be generated by simple algorithms.

    I have not dealt with this part in detail, in this thread, but it is an important part. It includes explaining why protein sequences can never be generated by NS acting on RV.

  58. 58
    gpuccio says:

    I must have forgotten to add the emphasis in the first quote. It was meant for the following paragraph:

    For example, we could generate a partition by dividing sequences in compressible (ordered) and non compressible. I believe that Dembski sometimes uses this concept. But being compressible is not a function, but another kind of property.

  59. 59
    Eric Anderson says:

    gpuccio @41:

    Thanks for your additional clarifications. A follow-up question:

    A sonnet written on a piece of paper presumably has a function. We might say its function is to express an idea or sentiment or thought. Its function might be to convey information.

    My dictionary defines “function” as “the purpose for which something was designed.” In that sense, essentially everything that is designed has a “function,” regardless of whether the function is more mechanical or more mental in nature. For example, this sentence has a function.

    You seem to be using “function” to describe mechanical or biochemical work. I’m wondering if you intend to limit it that way, and if so, is there another way to describe this mechanical work rather than using the broader word “function”?

  60. 60
    Piotr says:

    As long as you realize it wasn’t by chance, Piotr. That is the point.

    If I see a highly regular repetitive sequence like …ACACACACACACACACAC… or …GGGGGGGGGGGG…. in a genome, the very last explanation that comes to mind is “design” or “miracle”. Why? Because it’s precisely repetitive, periodic or symmetrical structures that are easily produced by dumb mechanical processes.

    As for 500 Heads, of course it’s just as unlikely as any other particular sequence. Whatever result you get from 500 flips is just as unique and “specific” as HHHHH…HHHHH. It’s just us humans, with our pattern recognition skills and the perceptual bias they produce, who see regular sequences as special, and so we lump together sequences like HHHTHTTHHTTTHTTTHH or TTHTTHHHTHHHHHTHTH as “ordinary” but regard HHHHHHHHHHHHHHHHHH or HTHHTHHTHHTHHTHHTH as “extraordinary”.

  61. 61
    Eric Anderson says:

    Piotr @60:

    Quote true that highly repetitive sequences do not allow us to infer design, in and of themselves. They are terrible examples of how to infer design, except in very limited cases.

    Why? Because it’s precisely repetitive, periodic or symmetrical structures that are easily produced by dumb mechanical processes.

    Exactly. Well said.

    However, it is most definitely not true that because every sequence is just as likely to happen by chance as every other sequence from a purely statistical standpoint, that chance is the best answer or that we can’t infer design. Particularly when we see sequences that are functional, meaningful, that have independent specification apart from the odds of generating the sequence itself.

    The repetitive sequence fails the design filter because it is not complex. Any old random sequence fails the design filter because it is not specified. Both aspects are required.

  62. 62
    rhampton7 says:

    #54 Piotr,

    The outcome would be miraculous, but the process that generated the outcome was, by all manner of detection, completely “natural”. Scientifically, there is no alternative to describe the mechanics of the event except in a traditionally materialist sense.

    On the other hand, if 500 coins appeared out of thin air (in a carefully controlled and observed environment), then an alternative scientific explanation (like a quantum anomaly on a macro-scale) would be wildly speculative and ultimately unsatisfactory.

    The “problem” some in the ID community seem to have with the first scenario is that it does not refute evolutionary theory’s mechanical explanations, but compliments them.

  63. 63
    Piotr says:

    Any old random sequence fails the design filter because it is not specified.

    Actually, the fewer formal constraints on the structure of “old random sequences” (e.g. if they don’t have to be periodic, palindromic, etc.), the lower their redundancy, and the larger the amount of information that can be packed into them (in Shannon’s terms).

  64. 64
    Piotr says:

    On the other hand, if 500 coins appeared out of thin air (in a carefully controlled and observed environment), then an alternative scientific explanation (like a quantum anomaly on a macro-scale) would be wildly speculative and ultimately unsatisfactory.

    Of course it wouldn’t hurt to try and replicate the experiment (preferably with a professional illusionist enlisted as a consultant). 😉

  65. 65
    Eric Anderson says:

    Piotr @63:

    . . . the lower their redundancy, and the larger the amount of information that can be packed into them (in Shannon’s terms).

    Yep. And that is why so-called “Shannon information” is essentially useless for determining whether we are dealing with design or not.

  66. 66
    Piotr says:

    EricAnderson @65

    So are we or are we not dealing with design in this case?

    ACGTAGTGGCGTTCTTCGACTGTTCCCAAA
    TTGTAACTTATTGTTTTGTGAAAATCAAAG
    TTATTTCTCGATCCTTTTTATGTACGTACC
    ATATTCTTTTAATTCTTTGGTTATTTTTCC
    GAAGTAGGAGTGAATAAACTTTCGTTTACG
    TCTTATTATTAATGATATAGCTATGCACTT
    TGT

  67. 67
    gpuccio says:

    Eric at #59:

    Yes, in this thread I am using “function” in a restricted sense, and not in the general sense of “purposeful output”.

    So, I have distinguished between three different potential specifications:

    a) Order, regularity, compressibility

    b) Meaning (descriptive information according to Abel)

    c) Function (prescriptive information according to Abel).

    As I have tried to argue, all three can be valid specifications, but it is useful to understand their differences:

    a) Order can be the result of algorithms, and not of design. So, specification by order needs special attention to exclude any known algorithmic cause. It is, in a sense, “weaker” for a design inference. As Piotr has correctly stated, a 500 heads sequence can well be the result of an unfair coin.

    b) Meaning (language) and function (software, machines) are very good indicators of design. The main difference is that meaning is more “passive”: a sonnet written on a piece of paper needs to be read by someone who understands it to make some difference in the outer world, while enzymes have been working for billion of years even when nobody (except maybe the designer) knew that they existed. Moreover, biological molecules are machines: they are made to do things, rather than to convey meaning. If and when we find sonnets in DNA, obviously, my statements could be falsified. 🙂

    However, it is true that all forms of design (order, meaning, function) are purposeful actions, so in a more general sense they could be called “functions”. But I believe that a more specific terminology can only help.

  68. 68
    gpuccio says:

    Piotr at #60:

    As for 500 Heads, of course it’s just as unlikely as any other particular sequence.

    But the point is exactly that: any other particular sequence which is too unlikely will practically never be seen as the result of chance. What we see is “non particular” sequences. It’s exactly like in the second laws. Please, read again my statement about gas molecules. Ordered states (all the molecules in half the space of the container) are in no way more unlikely than each individual state where the molecules are dispersed quite equally in all the space of the container. But the number of states of the second type is infinitely more numerous than the number of ordered states. That’s why we never see spontaneously ordered states of a gas.

    You are right that 500 heads could be the result of an unfair coin. That is true. Ordered states can be the result of necessity.

    But, if we are sure that the coin is fair, and that the system is truly random, then we will never see 500 heads.

    Can you see the difference?

  69. 69
    gpuccio says:

    rhampton7:

    Realistically, 500 heads warrant one and only one explanation: the system is not random. Probably, it is designed (for fraud). Or it is simply not random because it was designed to be random, but by a bad designer. You see, design is always there in some way! 🙂

    Nobody would ever believe that the result is really sheer luck (not even darwinists: they may say so when they have no other argument left, but deep in their heart they know it is not true).

  70. 70
    gpuccio says:

    Piotr at #63:

    Actually, the fewer formal constraints on the structure of “old random sequences” (e.g. if they don’t have to be periodic, palindromic, etc.), the lower their redundancy, and the larger the amount of information that can be packed into them (in Shannon’s terms).

    Correct! That’s exactly why we need scarcely constrained material sequences to “write” (design) meaningful and functional sequences. We need what Abel calls “configurable switches”. Constrained sequences are no good for that.

    That’s why both language and software and proteins are more similar to random sequences than to ordered sequences (although, obviously, they exhibit some forms of regularity, as you certainly know well). But they can never be generated by simple algorithms (which is the distinguishing feature of ordered sequences).

  71. 71
    Piotr says:

    But, if we are sure that the coin is fair, and that the system is truly random, then we will never see 500 heads.

    This “never” is still approximate, not absolute. Otherwise, by the same token, we should never see any of the following:

    …HHHHHHHHHHHHHHHHHHHHHHHHHHHT
    …HHHHHHHHHHHHHHHHHHHHHHHHHHTH
    …HHHHHHHHHHHHHHHHHHHHHHHHHHTT
    …HHHHHHHHHHHHHHHHHHHHHHHHHTHH
    …HHHHHHHHHHHHHHHHHHHHHHHHHTHT
    ………
    …HTHTHTHTHTHTHTHTHTHTHHTHTHTH
    ………
    …TTTTTTTTTTTTTTTTTTTTTTTTTTHT
    …TTTTTTTTTTTTTTTTTTTTTTTTTTTH
    …TTTTTTTTTTTTTTTTTTTTTTTTTTTT

    … because each of them is fully specified and therefore hyperastronomically unlikely (with an a priori probability of 2^(-500) = 3.055*10^(-151)). And yet we shall see one of them if we flip the coin 500 times.

  72. 72
    gpuccio says:

    Piotr at #66:

    Just to be clear, I will anticipate some basic concepts about the design inference.

    a) The design inference by dFSCI is a procedure with absolute specificity (100%, if the threshold is well chosen) and low sensitivity.

    b) The two main reasons for the low sensitivity are:

    b1) If an object is designed, but its specification is simple, it will not be possible to infer design for it. False negative type one.

    b2) Evne if the object is specified and complex, we as observers may not be able to racognize the specification (for example, the function). False negative type two.

    I have no idea if the nucleotide sequence you offered has any function. And at present I have no means (and no desire) to find out. So, I will not infer design for it.

    Now, two scenarios are possible:

    1) The sequence is not designed and my non inference of design is a true negative.

    2) The sequence is designed and my inference of non design is a false negative.

    No problem in either case.

    If you want to falsify the procedure, you have to show that it gives false positives, and therefore its specificity is not 100%.

    False negatives are routine.

  73. 73
    gpuccio says:

    Piotr at #71:

    I am not sure I understand what you are saying here. Could you please explain better what kind of specified sequence we will see flipping the coin? And why?

  74. 74
    gpuccio says:

    Piotr:

    “Never” is empirically absolute, even if logically possible. We will never see it.

  75. 75
    gpuccio says:

    Piotr:

    I understand you are probably in Poland. I am in Italy. It’s late.

    Shall we leave it for tomorrow? 🙂

  76. 76
    Joe says:

    Piotr, If you flip a coin the odds you will get some pattern of heads and tails is exactly 1.

  77. 77
    Piotr says:

    By “fully specified” I mean a concrete unique sequence of Hs and/or Ts. A unique sequence, not a class of sequences. I leave aside the question whether the sequence is “designed” or not. Nobody can tell that in the general case, anyway, even if they think they can. If you think you can, please tell me if the sequence in post #66 is “designed”, and if it is, how much “functional information” it contains.

  78. 78
    Piotr says:

    gpuccio:

    I understand you are probably in Poland. I am in Italy. It’s late.

    Of course, we are in the same time zone and it’s bedtime here as well. See you tomorrow.

  79. 79
    Piotr says:

    Piotr, If you flip a coin the odds you will get some pattern of heads and tails is exactly 1.

    Thanks for the information.

  80. 80
    rhampton7 says:

    #69,

    Yes design is there, but so too a materialist explanation of the physical processes. It’s not either-or, but both.

  81. 81
    kairosfocus says:

    GP:

    Excellent work as usual.

    It’s a bit of a pity that I have so many irons in so many Caribbean fires just now. (And BTW, many of them pivot on the difference between recessions and stagflations with creative destruction at work. I have had to be brushing off some economics. And some thermodynamics [for Geothermal energy development — looks like so far 2 MW potential identified here], a bit of mechanical analogue computing [fascinating subject, led me to glance at gunnery at Jutland and Dreyer vs Argo . . . ] and and and . . .)

    It never rains but pours. At UD too.

    A few quick points:

    1 –> I note that dFSCI is WLOG, as complex functionally specific organisation . . . think 3-D exploded view type nodes and arcs as was looked at years back in the early ID founds posts . . . can be reduced to strings of coded digits. As in AutoCAD etc.

    2 –> The issue is local isolation of islands of function in the space of configs. If deep enough, a solar system or observed cosmos scope blind search is maximally implausible as a good explanation compared with design.

    3 –> Of course, you are the source for that Islands terminology, at least for me. Though it seems WmAD used it waaaaay back.

    4 –> Protein groups in AA possibility space is a good example of the issue.

    5 –> A version on Hamming distance as a metric of sequence dissimilarity can be used to construct an abstract space.

    6 –> The point then is, first get to a functioning cell in a pond. That stretches the space to organic chem structures, leading to functionally co-ordinated clusters. Star wars poly life architecture scenarios don’t get us away from the point that with the FSCO/I involved EVERY cluster is deeply isolated. (Do we understand the gamut of the space of chemical possibilities, the energetics and where it points?)

    7 –> Onward novel function must fit with core cell life function and must be reproducible. Again, local isolation is a killer.

    8 –> In addition, there is a very good reason why we only actually observe FSCO/I and especially dFSCI beyond say 500 bits arising by deliberate action. The seas of non-function are vastly beyond. BTW, just as while there are countably infinite rational no’s, the continuum of all numbers utterly dwarfs them. The transcendentals rule! (And, a search of the space of 500 coins by the 10^57 solar system atoms for its lifespan, would sample of the space as a 1 straw size sample to a cubical haystack 1,000 LY across. If superposed on our galactic neighbourhood, such would turn up as straw with all but certainty, on the standard results for blind, random samples.)

    9 –> So, we see analysis on search challenge and empirical observation mutually reinforcing.

    KF

  82. 82
    kairosfocus says:

    P: If I came across a line of 500 ordinary coins, all H, I would for good reason tied to the relative statistical weights of the all 1 state vs the dominant cluster of near 50-50 in no particular order, I would with empirical certainty conclude design. And for excellent reason. The cases relevant to design put this toy case — only 3.27*10^150 possibilities for 500 coins — on steroids. And BTW if a maze required 500 turns in a specific and singular pattern, a rat that ran it with all but certainty is not doing so by blind trial and error. I would suspect a scent trail. KF

  83. 83
    Mung says:

    Piotr:

    I would treat such as result as proof that the coin isn’t fair (and I’d hypothesise that it most likely has Heads on either side).

    I would challenge the hypothesis that the coin was tossed at all. 🙂

    What difference does it make if the coin is fair if it’s not being tossed?

  84. 84
    kairosfocus says:

    Mung, not being fair includes ye olde 2-header. KF

  85. 85
    Mung says:

    kf @ 82, exactumly, or approximately precisely that, anyways.

    In any sequence consisting of two symbols there only two possible in which all H or all T appear.

    Assuming each symbol is equi-probable, as the length of the sequence increases the probability of the sequence being (all H or all T) decreases. logarithmically?

    We can then create the following specifications:

    All H or all T save x.

    eg.

    all H or all T except one
    all H or all T except two
    all H or all T except three
    all H or all T except four

    etc.

    It’s far more likely that you will get something closer to the middle of that curve than toward the ends.

    Take two huge 250-sided die, each face of equal dimensions. Inscribe each face with a number from 1 through 250. Tossing each die individually 250,000 times appear to indicate that no number is more likely to appear than any other.

    then toss the dice together and they come up 1,1 or 250,250.

    Well SOMETHING had to come up, right?

  86. 86
    kairosfocus says:

    Mung, Binomial, sharp peak near evens. BtW that is the first big example in L K Nash’s excellent intro to Stat Mech. Hate to say it but the chemist did a better job than all the physicists! KF

  87. 87
    kairosfocus says:

    PS: A state near 50-50, no particular order has vastly more statistical weight than all-H and is vastly more likely. The valid form of law of averages. KF

  88. 88
    Mung says:

    kf,

    I have a link here somewhere to that Nash text. I shall have to shell out the dollars! (not that it’s all that expensive)

    Thank you for bringing it to my attention.

    God bless you my friend!

  89. 89
    Eric Anderson says:

    Piotr @71:

    Just to make sure I understand where you’re coming from, are you saying there is nothing unique about any of the possible sequences? Nothing that would cause us to pause and question its origin? Nothing that would give us reason to think that something else might be in play besides pure random draw?

    Just want to make sure I understand your position.

    —–

    Incidentally, gpuccio has answered spot on with respect to #66.

  90. 90
    Piotr says:

    Eric Anderson @89

    Each single one of them is unique. Some are “special” in the sense that they are regular and could be generated by a relatively simple algorithm. Humans see them as special because we are particularly good at detecting patterns and regularities in our anvironment. When we see a regularity we suspect (often with good reason, though with many false positives) that there’s something more than blind chance at work. But (as we have already seen) regular patterns in nature don’t demonstrate “design” by an intelligent agent. There’s usually a prosaic explanation. I’d actually be less surpsised to see something like HHHHHHHHHHHH… (fake coin?) or HHHHTHHHTHHH… (unfair coin?) than HTHTHTHTHTHT… (trick or miracle?).

  91. 91
    Piotr says:

    PS I disagree with Gpuccio, but have to run to work now, so I’ll reply later.

  92. 92
    gpuccio says:

    Piotr:

    I will wait for your return… 🙂

    In the meantime, I will try to clarify where we are with your last comment, IMO:

    By “fully specified” I mean a concrete unique sequence of Hs and/or Ts. A unique sequence, not a class of sequences. I leave aside the question whether the sequence is “designed” or not. Nobody can tell that in the general case, anyway, even if they think they can. If you think you can, please tell me if the sequence in post #66 is “designed”, and if it is, how much “functional information” it contains.

    What do you mean? When we compute a probability of one event, the first thing we must do is defining well the event. There is no difference if the event is one sequence or a class of sequences.

    Let’s stick to our 500 coin flips (OK Mung, let’s say we know they were flipped! 🙂 ).

    So, you can define the “event” for which you compute the probability as:

    a) “This specific sequence”. That’s OK, but you must write the sequence in advance. That is pre-specification. You cannot use this post-hoc.

    b) A class of sequences, defined by some formal property.

    So, if the formal property is “all heads”, the class includes only one sequence, and the probability in one flip is 1:2^500.

    If the formal property is “any kind of sequence”, the probability is 1.

    If the formal property is “a sequence of the same symbol”, the probability is 2:2^500

    And so on.

    KF and Mung have given excellent explanations of how we can generalize to well defined levels of order.

    It is obvious that in a random 500 bit sequence, some parts will look “ordered”: there will be short repetitions or alternations, for example. Indeed, it is extremely likely that some of that will be there. As you certainly know. the complete lack of some repetition would be, again, a special form of order, and would make the sequence extremely unlikely: that kind of sequence is, again, peculiar and you will never see it.

    But, for each well defined class of events, we can compute a probability and a binomial probability distribution (success – non success) for repeated attempts.

    The simple fact is, for very large search spaces, you will never get peculiar sequences that belong to extremely unlikely classes. You will always get non peculiar sequences, which become peculiar only if you pre-specify them by giving explicitly, bit by bit, all or great part of the information in the sequence (see a) ).

    IOWs, for large search spaces you never get ordered, largely compressible results by chance. You can obviously get them by necessity, but I have already discussed that.

    I suggest that you carefully consider the interventions of KF and Mung in the previous few posts.

    Finally, I have answered your “nucleotide sequence challenge” in my post #72. I think we have to start form that, for further discussion on this point.

    Please, take all the time you need to answer (if you like, obviously 🙂 ). Work has its priorities, like sleep…

  93. 93
    gpuccio says:

    KF:

    Thank you for your excellent intervention, in spite of all your other duties. I really appreciate it. Very good thoughts, and very useful in the specific context (is your post designed? 🙂 )

    Very good work, as usual!

  94. 94
    gpuccio says:

    Mung:

    Thank you to you, too. Excellent contributions. I appreciate them very much.

  95. 95
    gpuccio says:

    Piotr:

    You post #90 is quite fair.

    Just a couple of comments:

    “many false positives” is true only if the improbability is not so great. For a 500 H sequence, there never will be, empirically, a false positive. It will always be explained by some necessity or design explanation.

    “But (as we have already seen) regular patterns in nature don’t demonstrate “design” by an intelligent agent.”

    Well, if we can safely exclude algorithmic explanations, they do demonstrate design. I agree that, for regular patterns, it is more difficult to exclude algorithmic explanations. But that is very easy when meaning and function, rather than order, are the specifying rule.

    “Humans see them as special because we are particularly good at detecting patterns and regularities in our environment.”

    That is true: you always need a conscious intelligent agent to detect meanings, and patterns are a special form of meaning. But that does not mean that the functionality for being detected as a pattern (or as a meaning, or as a function) is not objectively in the object (see my initial distinction in the OP: I knew it would come useful sooner or later! 🙂 )

  96. 96
    kairosfocus says:

    GP: Popped back by, thanks. I hope this thread helps the others out there understand the significance of the islands of funciton challenge and why it makes FSCO/I and dFSCI so relvant to seeing why the design inference is analytically well grounded and empirically plausible. Though there is none so blind as one who will not see. KF

    PS: You may need to note you use a comma for the decimal marker. (Us anglophones use a dot, perhaps raised. My HP 50 gives the choice of course.)

    PPS: Mapou, yes, transfinite nos — infinities — are all over modern math, and you may want to look at the recent rise of nonstandard analysis which builds on and regularises ideas in Newton etc regarding calculus foundations. I think it is more intuitive than the limits formulation, and just as rigorous now. What we cannot do is instantiate a transfinite, step by step, e.g. count up to aleph-null.

  97. 97
    gpuccio says:

    KF:

    Yes, the comma/dot inversion is a real nuisance for us italians! I usually try to remember, but it is easy to err.
    We use the comma as decimal marker, and the dot as thousands separator! 🙂

  98. 98
    Joe says:

    Piotr, HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH wrt a coin flip is not a “regular pattern”. And the explanatory filter takes care of regular patterns in nature.

    By “fully specified” I mean a concrete unique sequence of Hs and/or Ts.

    That isn’t what anyone else calls a “fully specified” sequence. Specify the sequence before hand and then flip a coin to match it. Tell us how long it takes you.

  99. 99
    Piotr says:

    Gpuccio:

    Before I tackle your reply to #66, let me add a small comment to my post #90 (by way of introduction). If, in the case of a coin flipped 500 times, I would regard a result like HTHTHTHT… more puzzling than HHHHHHHH… it isn’t because of any intrinsic property of those strings but because in this particular experimental situation it’s easier to imagine a mechanism that would produce “Heads” only (e.g. a fake coin with two identical sides) than an alternating sequence. This is true of a physical coin flipped in the usual way. In a different setting (real-world context) a rhythmically alternating sequence could be trivially easy to explain (there’s no shortage of rotating, orbiting or oscillating things in the Universe). It follows that the sequence in itself cannot be classified as “natural” or “artificial”. You have to know its context.

  100. 100
    Piotr says:

    Joe:

    That isn’t what anyone else calls a “fully specified” sequence. Specify the sequence before hand and then flip a coin to match it. Tell us how long it takes you.

    That’s exactly what I mean. Any sequence specified beforehand (any exact prediction of the 500 throws) is equally unlikely. It doesn’t matter in the least how “designed-looking” the sequence is. Lotto players practically never bet on sequences like (1, 2, 3, 4, 5, 6); they go to great pains to make the bet as random-looking as possible, e.g. (2, 9, 13, 20, 44, 46) in the false hope that a “non-designed” single sequence is more likely to win, whereas in reality the odds are exactly the same (1/13,983,816) for any 6 numbers out of 49.

    PS

    And I beg to differ: HHHHHHHHH… is not only regular but extremely regular.

  101. 101
    gpuccio says:

    Piotr:

    I completely agree with what you say in #99. You are absolutely right.

    You may have noticed that I always state that we have to refer to a system. In particular:

    a) The search space must be defined.

    b) The functional (or other) specification must be explicitly defined, and also how to measure it, and a threshold to assess it as present or absent. Remember, the specification must generate a binary partition in the search space.

    c) The physical system we are analyzing must be well specified. What are we speaking of? Flipping coins? Mutations in existing genomes? A good understanding of the system is fundamental to evaluate what algorithmic mechanisms may be included in its starting state. Foe example, if we are evaluating OOL, reproducing beings are not a part of the initial system. But if we are explaning evolution of species after OOL, we can consider reproduction as an already existing algorithm, and accept it as part of the starting condition of the system.

    d) The time span must be well defined. The system starts at time 0, and we analyze the events that can happen (or happen) in the system from time 0 to time t. That is important to evaluate the probabilistic resources of the system.

    e) The probabilistic resources of the system must be computed. They depend on the time span and the number of states tested in the system per unit of time. They represent the number of different states (number of attempts) that the system can reach in the time span, and for a random system with a uniform probability distribution of the states, they are important to establish the threshold of complexity (in order to reject the null hypothesis if a random origin of what we observe).

    All these components are fundamental parts of the reasoning. Some of them were not introduced in the OP because the purpose of the OP was limited to the definition of functional information, and it did not deal with the whole procedure of design inference.

  102. 102
    gpuccio says:

    Piotr at #100:

    OK, any specification which specifies a single sequence generates the same partition, and has the same probability. That’s OK. And so?

  103. 103
    Piotr says:

    Gpuccio, @101

    OK, we know where we stand. Sorry, but I again have other things to do. I’ll be back in a few hours.

  104. 104
    Joe says:

    Piotr:

    And I beg to differ: HHHHHHHHH… is not only regular but extremely regular.

    Not with respect to flipping coins. If it were regukar then it would occur quite often. Yet it never does.

  105. 105
    Eric Anderson says:

    Piotr @90:

    Humans see them as special because we are particularly good at detecting patterns and regularities in our anvironment. When we see a regularity we suspect (often with good reason, though with many false positives) that there’s something more than blind chance at work.

    It is certainly debatable whether we are simply imposing meaning or whether it objectively exists. But we don’t need to go there.

    Given that we are capable of recognizing “special” arrangements, when we then discover such an arrangement in our environment, are we not justified in stopping to ask ourselves how it came about, in inquiring what is the most likely explanation for its existence?

    —–

    BTW, gpuccio has already addressed the false positives issue. If you mean “many false positives” by people’s gut reactions in daily life, then perhaps yes. If you mean that the explanatory filter for intelligent design produces “many false positives” then that is simply not true. That is a large part of the reason for the explanatory filter, to eliminate false positives.

  106. 106
    SteRusJon says:

    Joe & Piotr,

    HHHHHHHHH…. is an “extremely regular pattern” but it is not a “regularly occurring pattern.”

    Are you two talking past each other?

    Stephen

  107. 107
    SteRusJon says:

    gpuccio,

    Interesting discussion. I applaud your effort to frame the question of “functional information” with some sort of rigor.

    I really wish we could use a different word than “information” since it has so many facets to its meanings and uses. “Information” is ripe for confusion and, even, equivocation.

  108. 108
    gpuccio says:

    SteRusJon:

    I really wish we could use a different word than “information” since it has so many facets to its meanings and uses. “Information” is ripe for confusion and, even, equivocation.

    Exactly! That’s why I try to avoid any incursion in the semantic problems caused by the word and the related concepts. They are interesting, but they are not really pertinent for the empirical reasoning that I want to pursue.

    However, just as an aside, I would say that the word originates from the greek “morfé” and the latin “informare”, and is therefore strictly connected to the concept of form.

    Now, everything has form, but probably the most common use of the word is to mean that we give form to something, or transmit a form, and idea. In that sense, information is a message between conscious beings, and its transmission happens by giving a form to some material object (the vehicle of information). In that strict sense, all information is designed.

    Shannon’s theory (which is not about information, but about the transmission of it) is a wonderful achievement, but it has certainly involuntarily added to the ambiguity. Shannon is interested essentially in the signal – noise relationship, but he does not deal with the nature of the signal (IOWs with what is meaning or function).

    ID does. And, by defining the relationship between specified / functional information and the search space, it has provided the best example of a design specific pattern, which can be used to infer design when it is not observed directly. That is a fundamental achievement, and the scientific world will have to acknowledge that simple fact, sooner or later.

  109. 109
    Upright BiPed says:

    Hi GP,

    Great work as always. I too applaud your efforts to clarify information.

    May I throw something on the pile? This is from my upcoming website, discussing “representations”:

    Through the arrangment of a material representation, a contingent and incomplete abstraction of a thing is instantiated as “information”, and in the presence of a capacity to decode that material representation, an effect is produced that has a relationship to that thing. In this process, information is the contingent and incomplete abstraction being represented, but in common conversation we refer to the material representation itself as the information. As the only observable manifestation that information, this common usage of the term is entirely natural.

  110. 110
    Eric Anderson says:

    SteRusJon:

    Are you two talking past each other?

    Yes. The disconnect is the following:

    Piotr is talking about coming across the pattern of 500 H in a row and what we might initially presume. Namely, that it was the result of a law-like process, such as an unfair coin. He is exactly right, that this would be the first and correct place to start.

    Joe is talking about the pattern of 500 H and what we might suspect, after we have eliminated the possibility of a law-like process; in other words, after having confirmed the coin is fair, has been fairly flipped, etc. Then, at that stage of the game, Joe is right that we would be suspicious and would not likely ascribe the event to chance.

    They are talking past each other because they are focusing on different time slices of the explanatory filter.

    —–

    Incidentally, this is part of the reason a highly repetitive pattern (like 500 H in a row), is a poor example for design detection. I wish Sal had never brought it up or got people thinking along those lines. It would be much less confusing to use an example that is not readily amenable to explanation from a law-like process. Rather than 500 H in a row, it would be more helpful to think of examples like the coins being flipped to form a binary representation of the digits of pi or the first verse of a Shakespearean sonnet, or the first prime numbers in order, etc.

  111. 111
    Eric Anderson says:

    gpuccio:

    Shannon’s theory (which is not about information, but about the transmission of it) is a wonderful achievement, but it has certainly involuntarily added to the ambiguity.

    Exactly.

    The whole world would be a better place 🙂 if the Shannon measurement of information carrying capacity had never been called “Shannon information,” but instead the “Shannon metric” or the”Shannon measurement.”

    Much confusion, weeping, wailing and gnashing of teeth could have been avoided.

    May the perpetrator who first unleashed that confounded term on the unsuspecting world be tormented by their conscience for eternity . . . or for as long as appropriate. 🙂

  112. 112
    gpuccio says:

    UB:

    Very good contribution, thank you. Please, let us know when your website is ready! 🙂

  113. 113
    gpuccio says:

    Eric:

    Trying to reconcile Piotr and Joe? I really admire you! 🙂

    Incidentally, this is part of the reason a highly repetitive pattern (like 500 H in a row), is a poor example for design detection. I wish Sal had never brought it up or got people thinking along those lines. It would be much less confusing to use an example that is not readily amenable to explanation from a law-like process. Rather than 500 H in a row, it would be more helpful to think of examples like the coins being flipped to form a binary representation of the digits of pi or the first verse of a Shakespearean sonnet, or the first prime numbers in order, etc.

    I absolutely agree, even if Sal has all the reason to insist on the 500 heads: if correctly understood, that is a good example of specification by order, and after all even Dembski seems to be focused on that aspect, for some reason. I suspect that many prefer order because they want to avoid dealing with the concepts of meaning and function.

    But we are not in that group! 🙂

    Seriously, there is an important advantage in dealing with meaning and especially function for the specification. Sequences which code for function are usually “pseudorandom”. They have the formal properties of a random sequence (to a certain point), but they are designed. Their functional value in no way can be generated algorithmically, because it implies understanding, complex links with different contexts, you name it.

    Designing a true working protein algorithmically is so difficult that we still cannot do that, not even with all our “intelligence”. And even if we could, the algorithm would be infinitely more complex than the final sequence.

    But that’s another story. Let’s wait for Piotr’s input, and then we’ll see if it is worthwhile to deepen the discussion about this last concept (when to use Kolmogorov complexity instead of total complexity).

    May the perpetrator who first unleashed that confounded term on the unsuspecting world be tormented by their conscience for eternity . . . or for as long as appropriate. 🙂

    You are truly a compassionate guy. 🙂

  114. 114
    Piotr says:

    Rather than 500 H in a row, it would be more helpful to think of examples like the coins being flipped to form a binary representation of the digits of pi or the first verse of a Shakespearean sonnet, or the first prime numbers in order, etc.

    Be careful with π. If (as seems possible) it’s a normal number, then every finite sequence of digits will occur at some place in its binary representation. Not once, but again and again, and again and again and again. In particular, it will contain every sonnet by Shakespeare encoded in UTF-8.

  115. 115
    Piotr says:

    Gpuccio @101

    Here’s Dembski’s one-million-dollar question:

    Can objects, even if nothing is known about how they arose, exhibit features that reliably signal the action of an intelligent cause?

    [emphasis added]

    Some objects can. If I find a watch in the field, I can be sure it’s an artifact, but my certainty is based on my earlier experience with watches and other man-made devices. Even if I don’t know how this particular watch arose, I know how watches in general arise. But what about things nobody has ever seen being designed, and so their design has to be inferred?

    You agree that in order to decide whether an object “has a specific function” or not we need to have a good understanding of the context in which it occurs. The examination of the object itself does not yield reliable conclusions.

    For example, a relatively simple nondeterministic algorithm can easily produce something that superficially imitates a real language: it has a plausible distribution of vowels and consonants, contains the right number of repetitions, and is ostensibly divided into words and sentences of variable but reasonable length. Unless you know which language it’s supposed to come from, how do you decide whether it is a meaningless string generated by a dumb machine or a text with a deep meaning in a human language? Look at this:

    Biniba boncianla den diani yali n den tieni tisiga ni. Bin den diani ke li ta yemma leni yabi n den la leni binuni hali micilima n den wani ti mama gi go twa tipo bimawanggikaba.

    Real or fake? And how do you know, honestly?

    The problem is that “the explanatory filter” is quite helpless unless I inform you first where this pattern came from — how it arose and what function it really plays. Once you know that, you won’t get a false positive, but it’s no big deal if you know the answer in advance.

  116. 116
    Piotr says:

    Designing a true working protein algorithmically is so difficult that we still cannot do that, not even with all our “intelligence”. And even if we could, the algorithm would be infinitely more complex than the final sequence.

    ‘You sure?

    https://en.wikipedia.org/wiki/Protein_design#Applications_and_examples_of_designed_proteins

  117. 117
    Upright BiPed says:

    Piotr,

    Try this one:

    – – – – – – – – – – –

    GTC = add Valine next
    TCG = add Serine next
    CGT = add Arginine next
    CTG = add Leucine next
    GCT = add Alanine next
    TGC = add Cystein next
    – – – – – – – – – – – –

    Real or fake?

  118. 118
    Joe says:

    Piotr:

    Biniba boncianla den diani yali n den tieni tisiga ni. Bin den diani ke li ta yemma leni yabi n den la leni binuni hali micilima n den wani ti mama gi go twa tipo bimawanggikaba.

    Real or fake? And how do you know, honestly?

    Context is important. Seeing that on a cave wall I would immediately infer some agency put it there and it was not the result of necessity and chance. The explanatory filter would flow very fast- almost suddenly.

    That is why context matters in the case pf 500 heads in a row. That is not a regular pattern, in that context.

    To me Piotr was saying that 500 heads in a row is regular because it is repetitive. Taken in context, highly repetitive patterns are not regular.

    And, Eric, a coin with heads on both sides would be evidence for design due to the fact the initial conditions were designed such that said outcome was gauranteed- see “Nature, Design and Science” by Del Ratzsch.

  119. 119
    Eric Anderson says:

    The question is not whether every sequence has the same statistical probability of arising through random means, though some would like to assert that this is a key issue.

    The question is: “Given a functional meaningful sequence, what is the most likely explanation for its origin?”

    So I ask yet again, the third time:

    Given that we are capable of recognizing “special” arrangements, when we then discover such an arrangement in our environment, are we not justified in stopping to ask ourselves how it came about, in inquiring what is the most likely explanation for its existence?

    —–

    Piotr:

    The problem is that “the explanatory filter” is quite helpless unless I inform you first where this pattern came from — how it arose and what function it really plays. Once you know that, you won’t get a false positive, but it’s no big deal if you know the answer in advance.

    That is simply false. And is based on conflation of two different things.

    You use the explanatory filter every day, as does everyone else, whether they know it or not. And we do not need to know beforehand where the artifact came from.

    Yes, we need to recognize it as an artifact. In certain cases we might even need to know something basic about its function in order to decide the artifact is something worth studying.

    However, and this is key:

    The explanatory filter is not primarily geared toward identifying whether something is an artifact worth studying. It is not even in the business of determining function.

    The explanatory filter is geared toward inferring the most likely origin of the artifact. You quoted Dembski. He focuses, rightly, on the question of origin. Then you conflated that question with questions about whether we are dealing with an artifact in the first place or whether we know what function it plays.

    And so I ask, yet the fourth time 🙂 . . .

    Given that we are capable of recognizing “special” arrangements, when we then discover such an arrangement in our environment, are we not justified in stopping to ask ourselves how it came about, in inquiring what is the most likely explanation for its existence?

  120. 120
    Piotr says:

    UB, @117

    As I was saying, it’s an easy game if you know the triplet representation of amino acids in advance. Still, for a given sequence (see #66) you can’t decide if it’s designed or not. There’s no way you can resolve this question unless somebody tells you whether it is part of coding DNA (it could be many other things, from a regulatory sequence to random junk), how the reading frame should be adjusted for the proper identification of codons, and whether the resulting amino acid sequence could be a fragment of a kind of protein known to be functional is some way. Once you have that information, you can feed it into your “explanatory filter” and — hurrah! — it says DESIGNED. In my opinion, Gpuccio’s target space is not definable even in principle, since it’s impossible to predict all possible “biological functions”.

  121. 121
    Joe says:

    Piotr- your comment in 66 is moot. We observe DNA in living organisms. We observe it being replicated. We observe it being transcribed. We observe mRNA get processed, edited and spliced. We observe functionality, that is structures doing work, ie providing a function.

    As for DNA, well there isn’t any evidence that necessity and chance can produce it from scratch (without existing DNA), no matter how short or non-functional the sequence is. Spontaneous generation of DNA appears to be a no go.

  122. 122
    bornagain77 says:

    Eric at 111, in regards to Shannon’s work, although the term Shannon ‘information’ has been a bit of a nuisance, there is something useful that Shannon’s work tells us about codes. Namely that the first Genetic code had to be at least as complex as to current one since ‘Shannon channel capacity’ prohibits the changing of a code once it is in place:

    “Because of Shannon channel capacity that previous (first) codon alphabet had to be at least as complex as the current codon alphabet (DNA code), otherwise transferring the information from the simpler alphabet into the current alphabet would have been mathematically impossible”
    Donald E. Johnson – Bioinformatics: The Information in Life

    Shannon Information – Channel Capacity – Perry Marshall –
    http://www.metacafe.com/watch/5457552/

    And the genetic code, despite its inability to evolve once it is in place, is found to be optimal:

    Biophysicist Hubert Yockey determined that natural selection would have to explore 1.40 x 10^70 different genetic codes to discover the optimal universal genetic code that is found in nature. The maximum amount of time available for it to originate is 6.3 x 10^15 seconds. Natural selection would have to evaluate roughly 10^55 codes per second to find the one that is optimal. Put simply, natural selection lacks the time necessary to find the optimal universal genetic code we find in nature. (Fazale Rana, -The Cell’s Design – 2008 – page 177)

    “The genetic code’s error-minimization properties are far more dramatic than these (one in a million) results indicate. When the researchers calculated the error-minimization capacity of the one million randomly generated genetic codes, they discovered that the error-minimization values formed a distribution. Researchers estimate the existence of 10^18 possible genetic codes possessing the same type and degree of redundancy as the universal genetic code. All of these codes fall within the error-minimization distribution. This means of 10^18 codes few, if any have an error-minimization capacity that approaches the code found universally throughout nature.”
    Fazale Rana – From page 175; ‘The Cell’s Design’

    Even Dawkins agrees that it is impossible to change a code once it is in place

    Venter vs. Dawkins on the Tree of Life – and Another Dawkins Whopper – March 2011
    Excerpt:,,, But first, let’s look at the reason Dawkins gives for why the code must be universal:
    “The reason is interesting. Any mutation in the genetic code itself (as opposed to mutations in the genes that it encodes) would have an instantly catastrophic effect, not just in one place but throughout the whole organism. If any word in the 64-word dictionary changed its meaning, so that it came to specify a different amino acid, just about every protein in the body would instantaneously change, probably in many places along its length. Unlike an ordinary mutation…this would spell disaster.” (2009, p. 409-10)
    OK. Keep Dawkins’ claim of universality in mind, along with his argument for why the code must be universal, and then go here (linked site listing 23 variants of the genetic code).
    Simple counting question: does “one or two” equal 23? That’s the number of known variant genetic codes compiled by the National Center for Biotechnology Information. By any measure, Dawkins is off by an order of magnitude, times a factor of two.
    http://www.evolutionnews.org/2.....44681.html

    Moreover, if that was not bad enough for the Darwinist, there are found to be overlapping codes:

    “In the last ten years, at least 20 different natural information codes were discovered in life, each operating to arbitrary conventions (not determined by law or physicality). Examples include protein address codes [Ber08B], acetylation codes [Kni06], RNA codes [Fai07], metabolic codes [Bru07], cytoskeleton codes [Gim08], histone codes [Jen01], and alternative splicing codes [Bar10].
    Donald E. Johnson – Programming of Life – pg.51 – 2010

    Second, third, fourth… genetic codes – One spectacular case of code crowding – Edward N. Trifonov – video
    https://vimeo.com/81930637

    In the preceding video, Trifonov elucidates codes that are, simultaneously, in the same sequence, coding for DNA curvature, Chromatin Code, Amphipathic helices, and NF kappaB. In fact, at the 58:00 minute mark he states,

    “Reading only one message, one gets three more, practically GRATIS!”.

    As well, alternative splicing codes are found to be ‘species specific’, which, since Shannon channel capacity prevents the changing of a code once it is in place, means humans and chimps have had two different origins for their species specific alternative splicing code:

    Evolution by Splicing – Comparing gene transcripts from different species reveals surprising splicing diversity. – Ruth Williams – December 20, 2012
    Excerpt: A major question in vertebrate evolutionary biology is “how do physical and behavioral differences arise if we have a very similar set of genes to that of the mouse, chicken, or frog?”,,,
    A commonly discussed mechanism was variable levels of gene expression, but both Blencowe and Chris Burge,,, found that gene expression is relatively conserved among species.
    On the other hand, the papers show that most alternative splicing events differ widely between even closely related species. “The alternative splicing patterns are very different even between humans and chimpanzees,” said Blencowe.,,,
    http://www.the-scientist.com/?.....plicing%2F

    Deciphering the splicing code – May 2010
    Excerpt: Here we describe the assembly of a ‘splicing code’, which uses combinations of hundreds of RNA features to predict tissue-dependent changes in alternative splicing for thousands of exons. The code determines new classes of splicing patterns, identifies distinct regulatory programs in different tissues, and identifies mutation-verified regulatory sequences.,,,
    http://www.ecs.umass.edu/~mett.....g-code.pdf

    Breakthrough: Second Genetic Code Revealed – May 2010
    Excerpt: The paper is a triumph of information science that sounds reminiscent of the days of the World War II codebreakers. Their methods included algebra, geometry, probability theory, vector calculus, information theory, code optimization, and other advanced methods. One thing they had no need of was evolutionary theory,,,
    http://crev.info/content/break.....e_revealed

  123. 123
    Piotr says:

    Eric Anderson:

    A DNA sequence isn’t particularly “functional” per se, except that is serves as a matrix (a kind of read-only memory) for producing other things, guaranteeing that the replication cycle is (nearly) faithful. A non-functional DNA sequence is hardly distinguishable from a functional one. A single point-mutation may disable a gene and turn it into junk, though the rest of the sequence looks exactly like it did before. DNA may yield a functional product — an RNA or a protein that actually does something useful (in terms of reproductive success). It may also yield a useless product (e.g. an accidental transcript which isn’t used for anything) or something harmful. How do you recognise that an arrangement is “special” without being told what results from it and what exactly the product is used for?

    Given that we are capable of recognizing “special” arrangements, when we then discover such an arrangement in our environment, are we not justified in stopping to ask ourselves how it came about, in inquiring what is the most likely explanation for its existence?

    If the explanation is “it was designed”, you needn’t inquire any further. Just sit back and contemplate the design. The alternative is to inquire how it really evolved. 😉

  124. 124
    Upright BiPed says:

    Piotr,

    As I was saying, it’s an easy game if you know the triplet representation of amino acids in advance.

    Your answer is rather disconnected to the issue I raise in #117.

    This thread is about clarifying the concept of functional information. The current sub-topic on the table is how a given sequence can bear an observable and reliable inference to design.

    In comment #115, your questions and challenge deal with the issues of functionality and sequence structure. My response presents the actual representations in question (which effectively subsumes both of your questions, and renders them moot).

  125. 125
    SteRusJon says:

    piotr,

    The problem is that “the explanatory filter” is quite helpless unless I inform you first where this pattern came from — how it arose and what function it really plays.

    Can you justify for me the three aspects, (which I) highlighted, in your statement?

    How do your justifications square with the experience of the first person to chance upon a crop circle? Was he wrong to infer design even though no one informed him as to how it arose and he had no idea what its function was?

    Stephen

  126. 126
    gpuccio says:

    Piotr at #115:

    First of all, let’s leave Dembski (he is not here to defend his positions) and speak about what you and I are saying.

    That said, I have listed many things that we need to know to make a design inference.

    But you say:

    You agree that in order to decide whether an object “has a specific function” or not we need to have a good understanding of the context in which it occurs. The examination of the object itself does not yield reliable conclusions.

    No. I have never said that. The context is important for the design inference, not to define a function for the object.

    It should be clear from all that I have said here that an observer can define any function for the object he observes, and the context in which the object arose is not necessary for that.

    Probably, what you mean is that sometimes observing the object in its environment can help to recognize a possible function for it. That is true. If I study a protein in its cellular context, I can have indications of what it does. I could probably understand what it does even by a patient research in the lab, but direct experiment on a cellular environment can often be a more direct way.

    But you are equivocating, when you say that “to decide whether an object “has a specific function” or not we need to have a good understanding of the context in which it occurs”. That is not true. In my simple example of the beach, I have no need to know anything of the context to understand that I can use certain stones to chop food. And even with proteins or protein genes, there are many ways to understand the function.

    If I find an english sonnet on a sheet of paper, the only thing I need to understand its meaning is that I understand english. As our understanding of the biochemical properties of proteins increases, we may be able to understand the functions of even a new protein with a top down approach.

    So, you are equivocating here.

    You say:

    If I find a watch in the field, I can be sure it’s an artifact, but my certainty is based on my earlier experience with watches and other man-made devices. Even if I don’t know how this particular watch arose, I know how watches in general arise. But what about things nobody has ever seen being designed, and so their design has to be inferred?

    Wrong again. Imagine I find an object on Mars, and I have no idea of how it works, and even its inner stricture is completely mysterious to me, but I can see that it is made of many parts connected in patterns. And I see that it has a display, and the display shows symbols that I don’t understand, but which are compatible with numbers, and they change cyclically in time, in accord with Mars’astronomical rotation. Is it so difficult to hypothesize that what I have found is some kind of designed tool to measure time? Would that hypothesis be “based on my earlier experience with watches and other man-made devices”? No, it would be based on my understanding that it is useful to measure time for intelligent conscious beings. It’s not the same thing.

    This is a fundamental point. Our “experiences” with man made artifacts do indeed tell us a lot: they, together with the subjective experiences that accompany them, inform us about how a conscious intelligent being uses his faculties creatively to design things. That experience is really basic to understand design, indeed even to define it.

    If we recognize a function, we recognize it. It just means that we realize that the object can be used to obtain some result. Certainly, we must understand how the object must be used. For a protein coding gene, we must be aware of the genetic code. If we don’t know the protein, we have to synthesize it and experiment with it to understand what it can do. Maybe in many cases we will not understand the function. But in many others we will.

    That’s all that is necessary. The cases where we recognize the function, and can measure its complexity, will be cases of true positives. The cases where we cannot recognize the function (which is indeed there) will be false negatives. The cases where we recognize no function because there is none will be true negatives. Anyway, there will be no false positive, if we apply correctly the procedure.

    More in next post.

  127. 127
    gpuccio says:

    Piotr:

    For example, a relatively simple nondeterministic algorithm can easily produce something that superficially imitates a real language: it has a plausible distribution of vowels and consonants, contains the right number of repetitions, and is ostensibly divided into words and sentences of variable but reasonable length. Unless you know which language it’s supposed to come from, how do you decide whether it is a meaningless string generated by a dumb machine or a text with a deep meaning in a human language? Look at this:

    Biniba boncianla den diani yali n den tieni tisiga ni. Bin den diani ke li ta yemma leni yabi n den la leni binuni hali micilima n den wani ti mama gi go twa tipo bimawanggikaba.

    Real or fake? And how do you know, honestly?

    I don’t know, honestly. That’s why, honestly, I don’t infer design.

    Was that sequence some language I don’t know of? OK, my non inference of design is a false negative.

    Was it a fake, generated randomly? OK, my non inference is a true negative?

    How do I decide which it is? I don’t decide. You can decide, because you know how that sequence originated. But I am not interested in knowing if my negatives are true or false, because i know that my procedure is not sensitive, and there will be a lot of false negatives anyway. Therefore, I will never use my procedure to exclude design in objects. That’s not the purpose for which it was designed.

    More in next post.

  128. 128
    gpuccio says:

    Piotr:

    Now, let’s do another experiment. Look at this sequence:

    Why is my verse so barren of new pride,
    So far from variation or quick change?
    Why with the time do I not glance aside
    To new-found methods, and to compounds strange?
    Why write I still all one, ever the same,
    And keep invention in a noted weed,
    That every word doth almost tell my name,
    Showing their birth, and where they did proceed?
    O! know sweet love I always write of you,
    And you and love are still my argument;
    So all my best is dressing old words new,
    Spending again what is already spent:
    For as the sun is daily new and old,
    So is my love still telling what is told.

    Now, let’s forget that we know it is one of Shakespeare’s sonnets. Let’s forget its beauty (it’s my personal favourite 🙂 ). Let’s pretend this is the first time we read it.

    But we understand english. Nothing else is needed to understand the meaning. A remarkable meaning, I would add.

    So, this sequence is specified by meaning. In english.

    What is the total complexity of the sequence? The length is 576 characters (including spaces). Let’s assume an alphabet of 30 characters (approximately, with spaces and at least commas, and periods and question marks). The search space is more than 2800 bits.

    What is the target space? I don’t know. Durston’s method for proteins cannot be applied to language. But, according to some simple reasoning I have applied to language some time ago, I am absolutely confident that, with a search space of 2800 bits, the functional complexity of a sequence in good english is certainly more than 500 bits.

    So, I will risk: I infer design for the sequence.

    So, this is a positive. And as we know independently from other sources, it is a true positive.

    This is the purpose of the procedure. To find true positives, without false positives.

    More in next post.

  129. 129
    gpuccio says:

    Piotr:

    The problem is that “the explanatory filter” is quite helpless unless I inform you first where this pattern came from — how it arose and what function it really plays. Once you know that, you won’t get a false positive, but it’s no big deal if you know the answer in advance.

    Simply false. I don’t need to know how the pattern originated. I need to know, as I have already stated clearly:

    The search space, which for sequences can be easily computed.

    The physical system, the time span and the probabilistic resource of the system: but that is necessary not to define the function, but simply to evaluate the null hypothesis that the object originated by chance.

    Let’s make an example. I have a protein of a certain length, and I observe / define its biological function. OK? I am not asking “how it arose”. Not at all. That is the answer I want to find.

    Now, you suggest that the protein originated by chance /the null hypothesis). And I ask: “OK, let’s evaluate your null hypothesis. But I need to know where the proteins originated (the system), in what time span, and what are the random variations which can take place in that system in the time span (the probabilistic resources). Please note, I am not asking “how it arose”. I am asking: “how do you think it arose by chance?” IOWs, I am clarifying the context of the null hypothesis according to what we know and what you assume. The only purpose is to evaluate if the null hypothesis can be rejected. In no way I am asking “how it arose”. In no way I am trying to “know the answer in advance”. That is completely false.

    And again, I am not asking “what function it really plays”. I can try to understand that by myself. Or you can say that to me, if you know it. It does not matter.

    If I recognize a function, by myself or with your help, I will try to compute its complexity and, if the complexity is high enough to reject the null hypothesis, I will reject it. If no algorithmic explanation of the sequence in the system is known, or even plausible, I will infer design. And believe me, I will have no false positives.

    But I never asked “how it arose”.

    More in next post.

  130. 130
    gpuccio says:

    Piotr at #116:

    Please, don’t misunderstand me. I am well aware that protein engineering, both top down and bottom up, has made great progress. I am aware of those small results. And I am sure that, in time, we will be able to engineer proteins very well. In no way I am trying to diminish the capabilities of humans to design proteins, which are indeed a very good argument for the design theory.

    If I wrote:

    “Designing a true working protein algorithmically is so difficult that we still cannot do that, not even with all our “intelligence”. And even if we could, the algorithm would be infinitely more complex than the final sequence.”

    it’s because I think that describes well our present state. Please note that I said “Designing a true working protein”. The results listed in the Wikipedia page are important, but are really far form what we usually mean by “a true working protein”.

    For example, the first paper referenced by wikipedia concludes:

    “Although our results demonstrate that novel enzyme activities can be designed from scratch and indicate the catalytic strategies that are most accessible to nascent enzymes, there is still a significant gap between the activities of our designed catalysts and those of naturally occurring enzymes. Narrowing this gap presents an exciting prospect for future work”

    Again, I am not trying to underestimates these results. And I see no potential limitations to our protein engineering abilities. We just need more time.

    But my point was different. My point was:

    “And even if we could, the algorithm would be infinitely more complex than the final sequence.”

    That remains true even if we engineer perfect proteins. The algorithm will be extremely complex, it will require a lot of intelligent premises and a lot of highly directed computational power. It will not be a “compression” of the sequence complexity, in any sense.

    OK, I think that’s enough for now. Time for sleep.

  131. 131
    Dionisio says:

    gpuccio @ 129

    More in next post.

    I look forward to reading your next post on this highly interesting subject. Good job!
    Mile grazie mio caro amico.

  132. 132
    Dionisio says:

    Piotr,

    gpuccio napisa? ze mieszkasz w Polsce? Ja mieszkam w Gda?sku i na Florydzie. Troch? tam, troch? tu. Gdzie w Polsce mieszkasz? Polski nie jest mój pierwszy j?zyk.

  133. 133
    Piotr says:

    Gpuccio:

    It’s too late for long replies, so just one small thing before I go to sleep:

    Now, you suggest that the protein originated by chance /the null hypothesis).

    Nope. I don’t suggest that proteins normally originate as completely random amino acid sequences that serendipitously acquire a function (though chance surely plays a role in the process). First, old proteins evolve and undergo selection, and selection is not random. Even de novo proteins do not have to be entirely random. After all, a good proportion of our junk DNA consists of former functional sequences (like decaying pseudogenes, disabled and fragmented ex-genes that used to encode for viral proteins, etc.). I am not an expert, but it seems intuitively possible that this genetic flotsam and jetsam, although generally non-functional, is full of “cryptic functionality” (meaning that its easier to recycle than truly random sequences). That, after all, is why we call it “junk”, not “garbage”.

    You may ask about the very first proteins, at the beginning of life as we know it. I have no idea how they originated, but totally random self-assembly is not a likely solution, and no modern OOL hypothesis known to me takes such a possibility seriously. It’s a topic for a different discussion, anyway, perhaps in a new thread. Once we get life working and evolving, nothing originates from scratch any more. New structures are built on pre-existing ones. Calculating the probability of the formation of functional proteins as if they had no history is absurd. Purely random origin is not so much the null hypothesis as a straw man.

  134. 134
    Piotr says:

    Hej, Dionisio, mi?o mi ci? spotka?. Mieszkam w Poznaniu i pracuj? na Uniwersytecie Adama Mickiewicza. [let’s see if Polish diacritics work here]

  135. 135
    gpuccio says:

    Piotr:

    You have misunderstood me! I was not suggesting that you are a strict neutralist. 🙂

    Perhaps I have expressed myself badly. I was only making a reasoning, and I was “dramatizing” between “you” and “me” (which were rather impersonal actor) the hypothesis testing process.

    So, I assigned to “you” the role of “supporter” of the null hypothesis (the effect we observe is due to chance). I apologize for coopting you in my reasoning! 🙂

    Seriously, I am perfectly aware of the role of NS in the neo darwinian model.

    I quote from my post #57 here:

    You may be aware that excluding a necessity (algorithmic) explanation is an integral part of ID from the beginning, it’s already there in Dembski’s explanatory filter.

    Complexity due to order is often (but not always) generate by algorithms. That is not true of complexity due to function (prescriptive information) or to meaning (descriptive information). Those types of complexity are scarcely compressible, and cannot be generated by simple algorithms.

    I have not dealt with this part in detail, in this thread, but it is an important part. It includes explaining why protein sequences can never be generated by NS acting on RV.

    Well, it seems that I have to deal with this part in detail. 🙂

    In brief, my reasoning for the design detection by dFSCI is only an application of the principles of Dembski’s explanatory filter. Beware, now I will only give a brief outline of the reasoning. In this post:

    a)I am not giving all the details of the process

    b)I am not explaining the empirical verification of why it is 100% specific.

    We can do those two things later. Let’s proceed one step at a time.

    So, the outline:

    1) We observe some object with some digital content (I will stick to digital information, but the concepts can be applied also to analog information). We don’t know directly if it is the product of design or not. For my definition of what design is, please see here:

    http://www.uncommondescent.com.....ng-design/

    2) We recognize / observe a function for the object, in particular for its digital sequence, and we define it objectively, and define objectively how to measure / assess it.

    3) Considering what we know of the system where the object arose, the time span in which it arose, and the probabilistic resources of that system, and we (no more treacherous cooption of innocent bystanders! 🙂 ) formulate the null hypothesis that the object and its particular sequence originated in the system randomly.

    4) Analyzing what we know of the system, time span and probabilistic resources, we set an appropriate threshold of functional complexity for that system. If we don’t know better, we can always use Dembski’s UPB of 500 bits, which is appropriate for our whole universe and its whole time span.

    5) We try to make an assessment (usually by some indirect method) of the dFSI for that function. If it is higher than our threshold, we say that the object exhibits dFSCI for that system.

    6) If our conclusion is yes, we must still do one thing. We observe carefully the object and what we know of the system, and we ask if there is any known and credible algorithmic explanation of the sequence in that system. Usually, that is easily done by excluding regularity, which is easily done for functional specification. However, as in the particular case of functional proteins a special algorithm has been proposed, neo darwininism, which is intended to explain non regular functional sequences by a mix of chance and regularity, for this special case we must show that such an explanation is not credible, and that it is not supported by facts. That is a part which I have not yet discussed in detail here. The necessity part of the algorithm (NS) is not analyzed by dFSCI alone, but by other approaches and considerations. dFSCI is essential to evaluate the random part of the algorithm (RV). However, the short conclusion is that neo darwinism is not a known and credible algorithm which can explain the origin of even one protein superfamily. It is neither known nor credible. And I am not aware of any other algorithm ever proposed to explain (without design) the origin of functional, non regular sequences.

    7) If we have assessed that the object exhibits dFSCI in that system, and that there is no known and credible algorithm in that system which can explain its functional sequence, we make a design inference for the origin of that object’s functional information in that system. That means that as far as we know design is the best scientific explanation of what we observe.

    So, to sum up, dFSCI is necessary to evaluate and eventually reject the role of RV, both as the only cause of what we observe and as part of the specific neo darwinian algorithm. dFSCI alone cannot be used to reject the proposed role of NS. Other considerations are needed for that.

    Well, this is the brief outline. 🙂

    Now, let’s discuss it.

    There are other aspects of your last posts which I want to discuss, obviously, but I wanted first to give you a complete scenario of what we are debating here.

  136. 136
    Piotr says:

    However, the short conclusion is that neo darwinism is not a known and credible algorithm which can explain the origin of even one protein superfamily. It is neither known nor credible. And I am not aware of any other algorithm ever proposed to explain (without design) the origin of functional, non regular sequences.

    Leaving for a moment the question whether my own views can be described as “neo-darwinian” (I don’t think so), let me just briefly note, for the record, that “origin by design” (performed by a basically unknown but probably supernatural and practically omnipotent intelligent entity) is not an “algorithm” at all. Design does not explain anything because it’s a nebulous, undefinable and untestable solution. It’s a synonym of our ignorance: we don’t know the details of the process, therefore design.

  137. 137
    Dionisio says:

    Piotr,
    Apparently Polish language-specific characters are not recognized by the text processor here.
    But that’s fine, because this is a serious blog, where you scientists and other science-lovers discuss serious issues mainly in English, though when I read what gpuccio, you and others wrote in this thread, I wonder if that’s really English, because the used terminology sometimes flies high over my poor ignorant mind 😉
    Anyway, I’m not as interested in the OOL discussion as I’m in the detailed description of currently existing processes, so that I can represent them in a 4D simulation software (in silico) for interactive education.
    Currently, for example, I’m trying to focus in on the mechanisms behind the cell fate determination, differentiation, migration, that take place during human development, from fertilization to birth. Also, the mechanisms behind the genotype-phenotype association. Also the mechanisms behind neurological processes. Also, the detailed mechanisms behind physiological processes.
    This software development project requires accuracy in the descriptions, because it’s for writing the detailed programming specs. Is this something you or someone you know could provide helpful information or point to sources? Dzieki!
    P.S. obviously, if y’all here can also provide a coherent explanation on how those processes came to be, I wouldn’t mind to read it too, but that’s not required for my software project.
    Wszystkiego najlepszego!
    Serdecznie pozdrawiam.

  138. 138
    Joe says:

    Piotr:

    Design does not explain anything because it’s a nebulous, undefinable and untestable solution.

    Yet IDists have said how to test for design and other design-centric venues have shown us the importance of determining design is present.

    It’s a synonym of our ignorance: we don’t know the details of the process, therefore design.

    Now THAT is your ignorance showing. Design is based on our KNOWLEDGE of cause and effect relationships. OTOH darwinian and neo-darwinian evolution are based on our ignorance.

  139. 139
    Dionisio says:

    Piotr,
    Please, don’t ask me, as someone else did in another thread, to Google it, because I’ve done gazillion Goodling to no avail. I want detailed coherent comprehensive step-by-step descriptions. In software development I can’t get away with missing links.
    Next time you visit Gdansk, stop by for herbata or kawa. Zapraszam serdecznie.

  140. 140
    gpuccio says:

    Piotr:

    Where did I say that “origin by design” is an algorithm?

    “Origin by design” means only one thing: that the specific form we observe, with its order, or meaning, or functionality, was first represented subjectively in the consciousness of a conscious being, and then outputted to the material object. The only algorithmic part is the chronological and most probably causal, relationship between the conscious representation and the form in the material object. Again, you can find the details in my post about design:

    http://www.uncommondescent.com.....ng-design/

    We infer design because:

    a) A random origin of the pattern is rejected by the observation of dFSCI

    b) No known credible algorithm can explain the origin of the pattern in the system.

    c) The only known origin of dFSCI is a design process (this is the part I have not detailed yet, at least in this thread).

    It’s as simple as that.

  141. 141
    gpuccio says:

    Piotr:

    Let’s go to other aspects of your reasoning:

    Design does not explain anything because it’s a nebulous, undefinable and untestable solution. It’s a synonym of our ignorance: we don’t know the details of the process, therefore design.

    Not at all. The origin of dFSCI from conscious agents, and only from conscious agents, is absolutely grounded in innumerable empirical observations. We have not yet debated this aspect here, but we certainly will, before the end of it. The design inference is a strong, positive empirical inference.

    Gpuccio’s target space is not definable even in principle, since it’s impossible to predict all possible “biological functions”.

    This is the usual “any possible function” objection. For a simple answer, please look at my post #23, part of which I paste here for your convenience:

    “For the moment, I want to specify:

    a) That my definiton is relative to some specified function, not to any possible function. I will deal with the “any possible function” perspective, often raised by darwinists, when I will discuss the design inference for proteins. The FSI value is the improbability of getting that function in that system and in that search space, by one attempt and with a uniform probability distribution.
    I can anticipate that the “any possible function” argument is not valid, because in a neodarwinian perspective what we need is:

    – a function which is useful in the complex context of the existing cell

    – a function which is coordinated (in terms of quantity, sequence and location and regulation) with the complex context of the existing cell

    – a function which is so useful that it confers detectable reproductive advantage, and can be expanded and fixed by NS.

    That reduces the space of candidate functions a lot.

    Now, just consider that almost 4 billion years of evolution, whatever the causal mechanism, have found about 2000 basic functional structures (superfamilies) in the huge search space of protein sequences. And that new superfamilies appear at a constantly slower rate.

    We will see, when we debate the design inference for proteins, that even if many new complex functions were potentially available in a specific context, the result would not change much.

    For example, let’s say that 100 new protein structures of about 150 AAs are potentially useful in a cellular context (which, IMO, is highly unlikely), and that each of them has a functional complexity of 300 bits, and therefore a probability of being found of 1e-90. So, we have a search space of 1e195 (20^150), and we are assuming a target space of about 1e105. Let’s say that we want the probability of finding one of the 100 functional proteins, instead of the probability of finding one specific protein. We have to sum the 100 target spaces, while the search space remains the same. So, the total target space will be 1e105*10^2=1e107.
    So, the probability of finding one of the useful proteins has changed of only two orders of magnitude, and it is now 1e-88. Not a great problem, for the design inference.”

    More in next post.

  142. 142
    Dionisio says:

    Piotr,
    [Off topic]
    gpuccio and other folks in this blog have graciously given me useful suggestions and provided links to sources of information I’ve started to use. But more info is still required, hence any help is highly welcome and appreciated. Since you’re a scientist who works at a university, I assume you or someone within your professional network could provide some assistance. Dzieki!
    And please, don’t forget my invitation ‘na herbate albo kawe!’ next time you go to Gdansk. You may contact me at dshared@ymail.com to coordinate details ‘po polsku’ (Polish language characters work fine on emails).

  143. 143
    kairosfocus says:

    P: Pardon, but kindly cf. here — and yes, that is notoriously materialistic Wiki speaking against interest. If you have to try to argue that design is so vague it can be dismissed speaks volumes. Just as a quick clue, every comment in this thread manifests dFSCI, and that is instantly recognisable. KF

  144. 144
    kairosfocus says:

    PS: As another quick note, as indicated already, all that is required, BTW, for the design inference, is LOCAL isolation of islands of function in the config space, as that brings up fine tuning beyond the search capacity of relevant resources; cf. John Leslie’s lone fly on a stretch of wall swatted by a bullet point, where that elsewhere there may be portions carpeted with flies (what an ugly picture . . . ) that pose no fine tuning issue. BTW, too, that speaks to cosmological fine tuning, and to just what it takes to set up a tack-driver of a rifle and a shooter able to make good use of it. At 500 bits, Solar system is overwhelmed [a 1 straw sample to a 1,000 LY cubical haystack], at 1,000 observed cosmos is simply drowned out to effectively zero — no time to smoke a calculator on the calc this morning. The presence of ever so many singleton proteins and the isolation between fold domains fits right in here. Sorry to be so short, gotta go now, back to G-T power and T-s diagrams, binary vs flash plants etc.

  145. 145
    Piotr says:

    Gpuccio:

    Is the sampling of the genetic pool from from generation to generation, by a combination of selection and drift, an algorithm? Are mutations, recombination, linkage, the history of the genome reflected in its structure, inbreeding, migration, environmental variation, etc. part of that algorithm? You can use a stochastic algorithm to model simple things like the distribution of competing alleles in an idealised population, but there’s no easy way to estimate the probability that the complex and messy process we call evolution will produce something functional in the timescales available to it.

    The numbers you toss about — like “let’s say 100 proteins” — are based on your intuitive judgement and represent nothing else than your private opinion. Why 100 rather that 10^10, or 10^90, or 10^180, or any other number? Where did the number come from? The universe of aperiodic polymers (and their potential functions) is vast.

    You can also try to see if an artificial genetic algorithm can produce functional complexity — of a kind neither designed nor predicted, by the programmer — under selective pressure. It can, as has been demonstrated, and the functionality achieved in this way is like that found in nature but not in human products: highly economic and dispersed in the system in a way that makes it hard to analyse and divide into discrete modules. It isn’t the way intelligent designers of the only kind known to me (humans) do their job.

  146. 146
    Piotr says:

    Dionisio, @142

    Sorry, but I am no expert in biochemistry or developmental biology, so I can’t provide you with a detailed description of the kind you need. I teach linguistics, and my opinions expressed here are those of a dilettante interested in biology. But this blog is visited from time to time by professionals who would probably be able to help you.

    Gdansk is a wonderful place — one of my favourite cities. Next time I go there we can try to fix a meeting.

  147. 147
    Eric Anderson says:

    Piotr @120:

    There’s no way you can resolve this question unless somebody tells you whether it is part of coding DNA (it could be many other things, from a regulatory sequence to random junk), how the reading frame should be adjusted for the proper identification of codons, and whether the resulting amino acid sequence could be a fragment of a kind of protein known to be functional is some way. Once you have that information, you can feed it into your “explanatory filter” and — hurrah! — it says DESIGNED.

    Let’s assume, for sake of argument, that your description is correct. Let’s assume that before we apply the explanatory filter we need to have some objective — empirical — assessment of the object in question.

    Why do you think the explanatory filter would kick out “DESIGNED”? (It would, but I’m asking you to think through why it would.)

    Here is the key, I repeat yet again, that you seem to be missing or glossing over:

    The explanatory filter is not primarily in the business of determining whether we have function. It is interested in inferring the likely origin. Function is often either self-evident, or empirically observable, or can be gleaned after some study and research. Then the question is: “How did this function arise? What is the most likely explanation for its origin?”

    You recognize and acknowledge that the explanatory filter will produce an answer of “designed” if we are dealing with a complex functional system. Great. That’s all it is intended to do. It is performing its task properly. Welcome aboard!

    You are absolutely right that if we discover (or are told about) a complex, functional system, then we can infer design. That is the whole point. It is very simple, almost a “Well, Duh!” or a “hurrah!” as you have expressed it. It is so obvious that most of the time in our lives we don’t even think through the specifics of the explanatory filter. So when we see such complex functional systems in living organisms, the correct inference — the “hurrah!” as you rightly point out — is “DESIGNED.”

  148. 148
    gpuccio says:

    Piotr at #145:

    I find this post rather vague.

    Your “complex and messy process ” can and must be analyzed in its components, if we want to understand it. It’s strange how non design theorists (including you) recur to the vague idea of a “complex and messy process” any time design theorists (including me) try to understand and model the process.

    OK, let’s see.

    a) All kind of random variation are random. Mutations, recombinations, frameshifts, deletions, inversions, you name it. The result of random variation is that new states appear. The probabilistic resource of RV can well be describes as the total numeber of new states that can be generated in a system, in a time span. As I have tried to do. There is nothing messy in that.

    b) Drift is an algorithm which acts randomly on random variation. It expands algorithmic some new state, but it is completely random in the “selection” of which new state expands. So, it does not change the probabilities. Each new state still has the same probabilities to expand, There is no relationship with function. There is nothing messy in that.

    c) NS is the supposed process according to which new states which confer a reproductive advantage (versus the old states) are preferentially expanded and fixed. While deleterious new states are preferentially eliminated. This kind of process is algorithmic in relation to the function of the new state (it depends on it). But it can act only on those variations (new states) which confer a reproductive advantage (or disadvantage). For all the rest of the “new states” only random factors apply.

    d) The only examples really observed of positive NS are those few cases of microevolution where the variation is minimal (1-2 AAs), it is usually at the expense of an existing function, and confers an advantage only because of extreme environmental pressure. Simple anitibiotic resistance is a good example.

    e) No case of macroevolution (evolution of a complex function by RV + NS) has ever been observed.

    f) Complex functions are not deconstructable into simpler, functional, additive steps. That is not true for complex language (which depends on the meaning to be expressed), and it is not true for complex functionalities (which sepend on the function to be expressed). Least of all it is true for proteins, which are separated in isolated islands of sequences and structures (as can be seen in the SCOP classification), and cannot be deconstructed into simpler additive steps which are individually not only functional , but also naturally selectable.

    g) The number I toss about are based on what we know of biology, of proteins and of cells. They are based on the work of Behe and Axe. They are based on the SCOP classification of proteins. They are based on papers like the rugged landscape paper:

    “Experimental Rugged Fitness Landscape in Protein Sequence Space”

    http://www.plosone.org/article.....ne.0000096

    which clearly shows the limits of NS and the properties of the functional landscape of proteins:

    “The question remains regarding how large a population is required to reach the fitness of the wild-type phage. The relative fitness of the wild-type phage, or rather the native D2 domain, is almost equivalent to the global peak of the fitness landscape. By extrapolation, we estimated that adaptive walking requires a library size of 10^70 with 35 substitutions to reach comparable fitness. Such a huge search is impractical and implies that evolution of the wild-type phage must have involved not only random substitutions but also other mechanisms”

    IOWs, they are based on science.

    Finally, I don’t understand your last paragraph:

    You can also try to see if an artificial genetic algorithm can produce functional complexity — of a kind neither designed nor predicted, by the programmer — under selective pressure. It can, as has been demonstrated, and the functionality achieved in this way is like that found in nature but not in human products: highly economic and dispersed in the system in a way that makes it hard to analyse and divide into discrete modules. It isn’t the way intelligent designers of the only kind known to me (humans) do their job.

    Could you please clarify to what you are referring here?

  149. 149
    Piotr says:

    Could you please clarify to what you are referring here?

    Things like Adrian Thompson’s evolvable voice-discriminating circuit:
    http://classes.yale.edu/fracta.....rcuit.html
    http://www.damninteresting.com.....-circuits/

    Thompson, A., P. Layzell, and R.S. Zebulum. 1999. Explorations in design space: unconventional electronics design through artificial evolution. IEEE Transactions on Evolutionary Computation 3: 167-196.

  150. 150
    Joe says:

    Yes Piotr, that is evolution by design.

  151. 151
    gpuccio says:

    Piotr:

    Let’s be very clear: Joe is perfectly right.

    The application of RV followed by intelligent selection (IS) is a design strategy. And it is very efficient!

    That’s how the best results in protein engineering are obtained: bottom up engineering.

    That’s how antibody affinity increases in a few months after the first immunological response.

    That’s how Szostac “evolved” his (completely useless) ATP binding protein starting with a random sequence with a minimal capacity of binding ATP and applying rounds of random variation followed by intelligent separation to it.

    Intelligent selection is very powerful. It starts from a clear knowledge of what function is desired, and applies RV to some suitable starting state, and measures repeatedly the desired function with very sensitive methods, so that it may be detected even in minimal form, and then selects and applies variation rounds to the selected results, each time amplifying exponentially the selected, desired improvements.

    Yes, RV + IS is a very powerful design strategy to obtain the desired result.

  152. 152
    Piotr says:

    Gpuccio:

    The “rugged landscape” paper says nothing about the estimated proportion of functional proteins in the search space. You quote-mine it by truncating the final sentence in your quotation and omitting the explanation that follows. And of course the general tone of the article is far from pessimistic.

    There’s randomness and randomness. Mutations, recombinations, frameshifts, deletions, inversions, etc. are “random” with regard to the adaptive value of their consequences. But they are not equally probable. Besides, the structure of the genome reflects its history in ways that may lead to a pro-functionality bias.

    Let’s imagine that a point mutation disables a functional gene and turns it into a pseudogene — one type of “junk DNA”. A reverse point mutation (which is not astronomically unlikely) may then restore its functionality, “creating” a complete gene out of junk (but not random junk). Such latent functionality is invisible to natural selection, but is important if you want to calculate the likelihood of the emergence of function. It may increase the odds of getting something functional by God knows how many orders of magnitude.

    An algorithm is a step-by-step computation procedure. Neither drift nor selection are “algorithms” in the ordinary sense of the word. They are aspects of the evolution of populations, which is not an algorithm either. It can be modelled algorithmically (to an approximation), which justifies the metaphor but doesn’t make the evolutionary process a sequence of calculations. The orbital motions of planets can also be so modelled, but nobody calls them algorithms.

    Drift can affect the emergence of functions by allowing populations (especially small ones) to “escape” from local peaks of fitness.

    Who says that proteins evolve only through tiny local “improvements”, and that the effect of such minimal changes must be modest? The relationship between DNA sequence and protein function is non-linear.

    For example, small changes in the phylogenetically old and highly conserved FOXP2 gene are believed to have contributed importantly to the development of speech in humans. The FOXP2 protein regulates the expression of numerous other important genes (which is precisely the reason why it’s so conserved). We differ from chimps by two amino acids in the protein, due to two non-synonymous substitutions in our lineage. We share one of those point mutations with Carnivora; only the other is really unique to humans (including neanderthals and denisovans), but I wouldn’t describe the effect as minor.

    If a gene gets duplicated, and one copy is free to drift away from its original role, the effect can be quite dramatic. We and our primate relatives owe our trichromatic vision to a rather trivial duplication event followed by divergence between the original gene and its copy. I hope you don’t deny the possibility of such a process. I mentioned in one of the earlier posts internal duplications, producing a protein that may retain its original functions while developing a potential for secondary ones — not unlike gene duplications.

  153. 153
    Piotr says:

    That’s how Szostac “evolved” his (completely useless) ATP binding protein starting with a random sequence with a minimal capacity of binding ATP and applying rounds of random variation followed by intelligent separation to it.

    Szostak had no ambition to evolve a protein that really does something in a living cell, but one that does something specified in advance (just one concrete function, not any function). An experimental setting is of course artificial because the purpose of an experiment is not to replicate reality but to understand how things happen by artificially controlling the number of variables.

    Proton beam collisions in the LHC are also artificial. So are the observed Higgs boson events. It doesn’t mean that the Higgs exists only at CERN.

  154. 154
    Piotr says:

    Yes Piotr, that is evolution by design.

    O no, Joe, no, Joe, no, Joe, no.

    It’s artificial evolution, but the solution found by the genetic algorithm was:

    (1) unexpected,
    (2) baffling (the experimenters themselves had problems understanding the evolved functions (such as self-timing, compensating for the absence of a clock signal),
    (2) not of the kind a human designer would even think of (one part of the circuit was disconnected and yet essential for its functioning.

  155. 155
    Piotr says:

    The last (2) should be (3), of course. Press “Post” in haste, repent at leisure.

  156. 156
    rhampton7 says:

    e) No case of macroevolution (evolution of a complex function by RV + NS) has ever been observed.

    gpuccio,
    You’ve offered a different way of thinking about the difference between macro- and micro- evolution, and that has some implications. Traditionally macroevolution is shorthand for the dividing line between species and genus. For example the Canidae family can be divided into 11 different genera. In turn the genus Canis can be divided into 6 different species, of which the domesticated dog is considered to be a sub-species of the gray wolf.

    Your definition implies that there must be at least one complex functional difference that separates Canis from any other related genus, like Vulpes. Further, there must not be even one complex functional difference between related species, like the gray wolf and the coyote, let alone between dog breeds.

    Personally, it wouldn’t surprise me if there happened to be a lone complex functional difference between certain dog breeds. If so, then this would be a case of RV originating new information (though artificial selection was critical to the creation of a sub-species population).

    Do you know if there is any genetic evidence to support your concept of macroevolution to the application of Biological classification?

  157. 157
    Joe says:

    Piotr, That is evolution by design regardless of what was expected, what occurred and what humans can or cannot do. Artificial = designed.

    It definitely has nothing to do with unguided evolution, including natural selection.

  158. 158
    gpuccio says:

    Piotr:

    The “rugged landscape” paper says nothing about the estimated proportion of functional proteins in the search space. You quote-mine it by truncating the final sentence in your quotation and omitting the explanation that follows. And of course the general tone of the article is far from pessimistic.

    It’s not quote mining. It’s deliberate non inclusion of a statement which is not an explanation and which has nothing to do with the data in the paper.

    Here is what I “truncated”:

    “The question remains regarding how large a population is required to reach the fitness of the wild-type phage. The relative fitness of the wild-type phage, or rather the native D2 domain, is almost equivalent to the global peak of the fitness landscape. By extrapolation, we estimated that adaptive walking requires a library size of 10^70 with 35 substitutions to reach comparable fitness. Such a huge search is impractical and implies that evolution of the wild-type phage must have involved not only random substitutions but also other mechanisms, such as homologous recombination. Recombination among neutral or surviving entities may suppress negative mutations and thus escape from mutation-selection-drift balance. Although the importance of recombination or DNA shuffling has been suggested [30], we did not include such mechanisms for the sake of simplicity. However, the obtained landscape structure is unaffected by the involvement of recombination mutation although it may affect the speed of search in the sequence space.

    The second part has absolutely no justification in the data of the paper, so I simply omitted it. And it is no “explanation” at all. What does it explain? With phrases such as “may suppress”, “escape from mutation-selection-drift balance”, “has been suggested”, “we did not include such mechanisms for the sake of simplicity”, “it may affect”? Good “explanations” indeed!

    And the “rugged landscape” paper says a lot about the structure of the protein functional landscape, and it says that the functional island of the wild type protein was not found, and could never be found with reasonable resources by random libraries and natural selection, not even NS in its most favorable context.

    More in next post.

  159. 159
    gpuccio says:

    Piotr:

    There’s randomness and randomness. Mutations, recombinations, frameshifts, deletions, inversions, etc. are “random” with regard to the adaptive value of their consequences. But they are not equally probable. Besides, the structure of the genome reflects its history in ways that may lead to a pro-functionality bias.

    There’s discourse and discourse. There are discourse which are clear and try to express truth, and there are discourses which are vague, confusing and obfuscating. I don’t know why, but the tome of your dioscourses seems definitely worse in your last posts.

    “There’s randomness and randomness.”??? What does that mean?

    I offer you a simple definition of a random system: a system is random if we cannot describe its evolution by necessity laws, but still we can describe it to a certain point by probability distributions. That is simple and clear.

    “Mutations, recombinations, frameshifts, deletions, inversions, etc. are “random” with regard to the adaptive value of their consequences.”??? What does that mean?

    Mutations are random because we have no way to describe deterministically how and when they happen. But we can describe the general trend of their occurrence probabilistically. That’s all. The “adaptive value of their consequences” has nothing to do with that. The same is true for “recombinations, frameshifts, deletions, inversions, etc.”.

    “But they are not equally probable.” And so? Unequal probabilities do not make a random system less random. This is an error made by many who do not understand the basics of statistics. Only in systems with an uniform probability distribution the events have the same probability. If the system is described by other types of probability distributions, the probability of the events will be very different (see, for instance, the many natural systems well described by the normal distribution). But random systems they are, just the same.

    “Besides, the structure of the genome reflects its history in ways that may lead to a pro-functionality bias.” I could excuse this statement if it were in Polish, which I do not understand. But in english? What does it mean?

    More in next post.

  160. 160
    gpuccio says:

    Piotr:

    Let’s imagine that a point mutation disables a functional gene and turns it into a pseudogene — one type of “junk DNA”. A reverse point mutation (which is not astronomically unlikely) may then restore its functionality, “creating” a complete gene out of junk (but not random junk). Such latent functionality is invisible to natural selection, but is important if you want to calculate the likelihood of the emergence of function. It may increase the odds of getting something functional by God knows how many orders of magnitude.

    This is really funny. It is simply important to calculate the likelihood of the reactivation of an existing function, not certainly the emergence of a new function.

    You see, “such latent functionality” would be “invisible to natural selection”, but not to science. We would easily find an extremely high homology between the pseudogene and the existing functional gene in the general proteome. That’s exactly how we say that a pseudogene is a pseudogene, and not generically another kind of non coding DNA.

    Or are you suggesting that all the functional genes which emerged after OOL were already present at OOL, but became inactive pseudogenes in all species, only to be reactivated occasionally in a new species?

    Unfortunately, such a bizarre and ad hoc theory cannot be true, because the non coding regions which generate new protein coding genes have no homologue not only in coding DNS, but also in non coding DNA of distant species. They appear in direct ancestors (for example, in primates for new human genes) and become ORFs in the final species.

    Moreover, you should then explain how at OOL not only the 800 – 900 superfamilies which were already present in LUCA and have persisted up to now were generated, but also how the other 800 – 900 superfamilies which appear in the rest of natural history were generated at OOL, then disappeared, then occasionally reappeared by a single aminoacid mutation (form what?)…

    If that is the meaning of: “Besides, the structure of the genome reflects its history in ways that may lead to a pro-functionality bias.”, then now I understand why I did not understand.

    More in next post.

  161. 161
    gpuccio says:

    Piotr:

    An algorithm is a step-by-step computation procedure. Neither drift nor selection are “algorithms” in the ordinary sense of the word. They are aspects of the evolution of populations, which is not an algorithm either. It can be modelled algorithmically (to an approximation), which justifies the metaphor but doesn’t make the evolutionary process a sequence of calculations. The orbital motions of planets can also be so modelled, but nobody calls them algorithms.

    I don’t understand. If you can compute something, you can do it by a computer, automatically. And you do that by algorithms.

    If you can model drift, NS, or the orbit of planets by a computer program, you can do that by algorithms.

    What do you mean here?

    Algorithms can include random processes, and model them by the laws of probability. But they use laws of necessity to compute the probabilities.

    Drift is an algorithm because it explains (and computes) how a population will evolve in some circumstances, and making some assumptions. What a model of drift cannot tell you is which gene exactly will be fixed, and which will not. That’s because the particular gene which is fixed by drift is “selected” randomly. But the process of fixation is mostly algorithmic, and follows the laws of necessity, mathematical laws.

    The same is true, even more, for NS. NS can be modeled, and is modeled, by certain assumptions. The difference with drift is that which gene will be fixed, in a NS model, is not random, but depends critically on the ability of the gene to contribute to reproduction (or to be a hindrance to it). Therefore, the relationship between the process of fixation and the selection of the gene to which the process applies is not random, in NS, but follows mathematical rules. Even if probabilistic variables can add to the final result, the cause effect relationship between the gene which is fixed and it reproductive advantage is well defined and measured in the model. It is a strong necessity relationship, modified by other variables.

    In drift, on the other hand, we have no idea of which particular gene will be fixed. That is the difference.

  162. 162
    gpuccio says:

    Piotr:

    Drift can affect the emergence of functions by allowing populations (especially small ones) to “escape” from local peaks of fitness.

    That is irrelevant. Inactivated pseudogenes have no fitness value at all. They can go wherever they like. Non coding DNA, if at least in part it is non functional, has no fitness value at all. It can go wherever it likes.

    But the probabilistic barriers exclude that a sequence which can “go wherever it likes” will ever reach some place useful (in a complex way).

    Only functional genes are destined to remain in “peaks of fitness” (which should be more correctly be called “holes of fitness”), as the rugged landscape paper tells us. And the same paper tells us that no drift can help them to get out of the hole, once they have fallen there.

  163. 163
    gpuccio says:

    Piotr:

    For example, small changes in the phylogenetically old and highly conserved FOXP2 gene are believed to have contributed importantly to the development of speech in humans. The FOXP2 protein regulates the expression of numerous other important genes (which is precisely the reason why it’s so conserved). We differ from chimps by two amino acids in the protein, due to two non-synonymous substitutions in our lineage. We share one of those point mutations with Carnivora; only the other is really unique to humans (including neanderthals and denisovans), but I wouldn’t describe the effect as minor.

    You are making a huge error here. Yoiu start saying:

    “For example, small changes in the phylogenetically old and highly conserved FOXP2 gene are believed to have contributed importantly to the development of speech in humans.”

    In what sense they “are believed”?

    From Wikipedia:

    “Some researchers have speculated that the two amino acid differences between chimps and humans led to the evolution of language in humans.[13] Others, however, have been unable to find a clear association between species with learned vocalizations and similar mutations in FOXP2.[27][28] Insertion of both human mutations into mice, whose version of FOXP2 otherwise differs from the human and chimpanzee versions in only one additional base pair, causes changes in vocalizations as well as other behavioral changes, such as a reduction in exploratory tendencies; a reduction in dopamine levels and changes in the morphology of certain nerve cells are also observed.[15] It may also be, based on general observations of development and songbird results, that any difference between humans and non-humans would be due to regulatory sequence divergence (affecting where and when FOXP2 is expressed) rather than the two amino acid differences mentioned above.”

    Now, don’t say that I am quote mining because I don’t quote the whole article. My point is simply that what is believed on this point is very controversial.

    Why?. Because the whole methodology is wrong. FOXP2 is a transcription factor. It has, certainly, important regulatory functions, and it is implied in speech regulation. That’s OK. In different species, those regulatory functions will vary, and that can easily explain the differences in humans, and the fact that they are conserved and functional.

    But how can you leap from that “to amino acid differences between chimps and humans led to the evolution of language in humans”? This is completely unwarranted. Humans have a different brain, and language is primarily an abstract function of the brain. Huge differences between the human brain and the chimp brain can explain the simple fact that humans develop an abstract language, and chimps don’t.

    An error that is made often is that, if one can prove that a final effector is implied in a complex process, for example by showing that a knockout of that effector compromises the process, that one feel authorized that the final effector is the cause of the whole process.

    That is obviously not true.

    Transcription factors are key final effectors of the transcription regulation. But the true question is: what regulates the regulators?

    A complex process must be regulated by complex procedures. You seem to believe that two aminoacids can evolve language and abstract thought.

    The effect is not minor. But you are wrong about the cause.

  164. 164
    gpuccio says:

    Piotr:

    If a gene gets duplicated, and one copy is free to drift away from its original role, the effect can be quite dramatic.

    So, let’s talk about duplicated genes.

    What do you mean here? A gene duplicated and inactivated? Or a gene duplicated which goes on with its function?

    If you mean the inactivated gene, it is not different from any other non coding region. Any mutation is neutral by definition. It is probably no more translated. It can “go wherever it likes”. That is, nowhere complex and useful.

    The only effect is neutral variation in a non coding region. IOWs, random sequences, which remain non coding and useless. I can see no drama here.

    If you mean a gene which is not functional, the situation is even worse. Either the second gene is really useful, and then it is subject to negative selection: it will remain in iots “hole”.

    Or the second gene is not useful, and it can change its sequence. Then, it will lose its original functionalities very early (a single stop codon will be enough), and become like the inactivated gene.

    End of the story. No drama.

    Proteins are isolated functional islands. You cannot go from one island to the other. You will be immediately lost in the ocean of non functionality.

    It’s not a case that we have no single example of the transition from one protein superfamily to another one, from one structure and function to another completely different structure and function.

  165. 165
    gpuccio says:

    Piotr:

    From Wikipedia:

    Evolution of color vision in primates

    Hypotheses
    Some evolutionary biologists believe that the L and M photopigments of New World and Old World primates had a common evolutionary origin; molecular studies demonstrate that the spectral tuning (response of a photopigment to a specific wavelength of light) of the three pigments in both sub-orders is the same.[7] There are two popular hypotheses that explain the evolution of the primate vision differences from this common origin.

    Polymorphism
    The first hypothesis is that the two-gene (M and L) system of the catarrhine primates evolved from a crossing-over mechanism. Unequal crossing over between the chromosomes carrying alleles for L and M variants could have resulted in a separate L and M gene located on a single X chromosome.[5] This hypothesis requires that the evolution of the polymorphic system of the platyrrhine pre-dates the separation of the Old World and New World monkeys.[8]

    This hypothesis proposes that this crossing-over event occurred in a heterozygous catarrhine female sometime after the platyrrhine/catarrhine divergence.[4] Following the crossing-over, any male and female progeny receiving at least one X chromosome with both M and L genes would be trichromats. Single M or L gene X chromosomes would subsequently be lost from the catarrhine gene pool, assuring routine trichromacy.

    Gene duplication
    The alternate hypothesis is that opsin polymorphism arose in platyrrhines after they diverged from catarrhines. By this hypothesis, a single X-opsin allele was duplicated in catarrhines and catarrhine M and L opsins diverged later by mutations affecting one gene duplicate but not the other. Platyrrhine M and L opsins would have evolved by a parallel process, acting on the single opsin gene present to create multiple alleles. Geneticists use the “molecular clocks” technique to determine an evolutionary sequence of events. It deduces elapsed time from a number of minor differences in DNA sequences.[9][10] Nucleotide sequencing of opsin genes suggests that the genetic divergence between New World primate opsin alleles (2.6%) is considerably smaller than the divergence between Old World primate genes (6.1%).[8] Hence, the New World primate color vision alleles are likely to have arisen after Old World gene duplication.[4] It is also proposed that the polymorphism in the opsin gene might have arisen independently through point mutation on one or more occasions,[4] and that the spectral tuning similarities are due to convergent evolution.Despite the homogenization of genes in the New World monkeys, there has been a preservation of trichromacy in the heterozygous females suggesting that the critical amino acid that define these alleles have been maintained.[11]

    Your statement:

    “We and our primate relatives owe our trichromatic vision to a rather trivial duplication event followed by divergence between the original gene and its copy. I hope you don’t deny the possibility of such a process. ”

    Is it really necessary to “deny” anything? Especially a “possibility”? This is wishful thinking. Even is parts of these hypotheses were true, there is no rigorous eveluation of the mechanisms, of the complexity of the supposed transitions, of the paths, and so on.

    It’s not my habit to deny or not deny the “possibility” of vague explanations.

  166. 166
    gpuccio says:

    Piotr:

    You have not understood my objection to Szostac’s paper. Here is the abstract

    Functional primordial proteins presumably originated from random sequences, but it is not known how frequently functional, or even folded, proteins occur in collections of random sequences. Here we have used in vitro selection of messenger RNA displayed proteins, in which each protein is covalently linked through its carboxy terminus to the 3′ end of its encoding mRNA1, to sample a large number of distinct random sequences. Starting from a library of 6 times 1012 proteins each containing 80 contiguous random amino acids, we selected functional proteins by enriching for those that bind to ATP. This selection yielded four new ATP-binding proteins that appear to be unrelated to each other or to anything found in the current databases of biological proteins. The frequency of occurrence of functional proteins in random-sequence libraries appears to be similar to that observed for equivalent RNA libraries2, 3.

    The fact that his final protein was not really biologically functional (least of all naturally selectable) is just an aside.

    The real problem is that the final protein, the so called “functional protein”, was not in the original random library. It was evolved by intelligent selection, by a design process.

    From the paper:

    Because protein sequences with speci®c functions are expected to be quite rare in protein sequence space, we prepared a DNA library of 4 * 10^14 independently generated random sequences. This DNA library was specifically constructed to avoid stop codons and frameshift mutations4, and was designed for use in mRNA display selections. This DNA library was then used to generate 6 * 10^12 puri®ed non-redundant random proteins that were used as the input into the first selection step.

    Successive rounds of in vitro selection and ampli®cation were performed starting with this random-sequence library. In each round the mRNA-displayed proteins were incubated with immobilized ATP, washed and eluted with free ATP. The eluted fractions were collected and ampli®ed by polymerase chain reaction (PCR); this DNA was then used to generate a new library of mRNAdisplayed proteins, enriched in sequences that bind ATP, for input into the next round of selection.

    We cloned and sequenced 24 individual library members, which showed that the population was now dominated by 4 families of ATP-binding proteins (Fig. 3a). These families show no sequence relationship to each other or to any known biological protein. The members of each family are closely related, indicating that each family is descended from a single ancestral molecule, which was one of the original random sequences.

    One possible explanation for this low level of ATP-binding is conformational heterogeneity, possibly reflecting inefficient folding of these primordial protein sequences.
    In an effort to increase the proportion of these proteins that fold into an ATP-binding conformation, we mutagenized the library and carried out further rounds of in vitro selection and amplification.

    Emphasis mine.

    IOWs, they organized a process of artificial, intelligent evolution and selection to transform original sequences with low level ATP-binding into a final protein with strong ATP binding.

    So, the final “functional” protein /which was after all not really functional) was not in the original random library. It was engineered, exploiting some low ATP binding capacity (which can be considered more a biochemical property which is not surprising in a few sequences of a vast random library) that a function, however useless.

    So, the only legitimate conclusion we can get from that paper is that, if “Functional primordial proteins presumably originated from random sequences”, as the abstract states, they did it through a process of intelligent design, including intentional mutation and selection.

  167. 167
    gpuccio says:

    rhampton7:

    “Do you know if there is any genetic evidence to support your concept of macroevolution to the application of Biological classification?”

    My approach is entirely molecular. I am not an expert of biological classifications. I don’t believe that the simple observation of the phenotype can help us in understanding the mechanisms of generation of functional information. Information is in the molecules, not in the phenotype.

    I don’t think that my use of “macroevolution” is so different form the usual. “Microevolution” is the term for those few cases where a small molecular difference (1-2 AAs) explains a reproductive advantage under very selective pressure (see again, for example, antibiotic resitance in its simple forms, or the emergence of nylonase).

    “Macroevolution, at the molecular level, is therefore the emergence of a complex function by a complex sequence variation.

    I believe that probably the emergence of new species, of new body plans, of different organs or systems, almost always need the emergence of many coordinated new proteins, and of a lot of new regulatory procedures. We have good examples of that. For example, the emergence of the adaptive immune system in jawed vertebrates requires a lot of new molecular tools, first of all the very complex RAG1 and RAG2 proteins.

    So, there is no true difference between the two approaches, but true reasonings about the causal mechanism of the transitions are possible only at the molecular level.

  168. 168
    Piotr says:

    Gpuccio:

    Or are you suggesting that all the functional genes which emerged after OOL were already present at OOL, but became inactive pseudogenes in all species, only to be reactivated occasionally in a new species?

    No, I gave an extreme example to show that “junk” can be recycled. I was only talking about bias in favour of potentially functional products, not about a universal mechanism generating all de novo genes.

    Sooner or later pseudogenes and other kinds of ex-functional DNA (e.g. retroviral sequences) decay beyond recognition, but at least those pseudogenised recently can be recruited for some tasks thanks to their residual, potentially functional features.

    Unfortunately, such a bizarre and ad hoc theory cannot be true, because the non coding regions which generate new protein coding genes have no homologue not only in coding DNS, but also in non coding DNA of distant species. They appear in direct ancestors (for example, in primates for new human genes) and become ORFs in the final species.

    It’s enough if de novo genes have clear non-coding orthologues (primarily, unexpressed small ORFs) in closely related species. It shows that they were not magically created by the designer out of thin air.

    http://www.sciencemag.org/content/343/6172/769

    ORFs can originate in various ways. I never said they had to have homologues in more distant relatives (such homologues, even if they existed, would be hard to recognise anyway, given the rather small size of those “proto-genes”).

    Moreover, you should then explain how at OOL not only the 800 – 900 superfamilies which were already present in LUCA and have persisted up to now were generated, but also how the other 800 – 900 superfamilies which appear in the rest of natural history were generated at OOL, then disappeared, then occasionally reappeared by a single aminoacid mutation (form what?)…

    Now this is getting really bizarre. The ancestry of a few hundred superfamilies can be traced back to LUCA, which doesn’t mean that they were present in LUCA as superfamilies.

    LUCA was not the first living thing on Earth but the last universal common ancestor, itself the product of a long prehistory — presumably hundreds of millions of years — which can’t be reconstructed by comparing the genomes of its descendants. It was already pretty “modern” in terms of its genomic status. I have no idea how its genes originated. Saying, without a shred of positive evidence, that “the designer did it” solves no problems. It’s God of the Gaps, as usual.

  169. 169
    rhampton7 says:

    gpuccio,

    It seems to me there ought to be a way to scan through published genomes and identify regions that are 1) unique to specific genera and/or species and that 2) are at least X bits (presumably 500) in length. Granted, that wouldn’t tell you anything about functionality, but it would substantially narrow the information to be examined.

    I suggest starting with Canidae since the genomes of many members have already been assembled. The results could be used to create an ID-based cladogram demonstrating where micro-evolution could have been responsible for changes within Canidae and where design was required. While being accessible to the laymen, this experiment would provide ID a means to test its predictions about random variation (and possible natural selection).

    For example, if such an examination found a complex, functional region of the genome in bloundhounds, but not in gray wolves, then it would refute a premise about the abilities of RV. On the other hand, if complex, functional regions were found in only some of the genera currently defined by science, then it would revolutionize the methods used and the linkages assigned within biological classification. Quite a coup for ID.

    Best of all, this task should be well within the capabilities of the ID community to quickly accomplish at minimal expense.

  170. 170
    Piotr says:

    A complex process must be regulated by complex procedures. You seem to believe that two aminoacids can evolve language and abstract thought.

    No, I don’t buy the idea of “the language gene”; I’m not that naive. You tend to read too much into what I say. “Importantly contributed to X” is a totally different thing from “was solely responsible for X”. I said nothing about abstract thought or language processing. The linguistically relevant effect of the “human variant” of FOXP2 more likely consisted in improving the neuromuscular control of the organs of speech in archaic humans. Still, pretty dramatic if you compare the degree of control humans have over their active articulators with that in chimps.

  171. 171
    Piotr says:

    #164: There’s so much wrong there that I’ll have to leave it till some time tomorrow.

    #165: The controversy is not about whether the genes encoding for the L and M opsins have a common origin but whether trichromacy arose once or independently twice in catarrhines and platyrrhines.

  172. 172
    Mung says:

    “Design” doesn’t explain anything but “faulty design” sure explains alot!

  173. 173
    Mung says:

    Piotr:

    The universe of aperiodic polymers (and their potential functions) is vast.

    And the ability to sample that vast universe so small.

    It isn’t the way intelligent designers of the only kind known to me (humans) do their job.

    Precisely the point!

  174. 174
    Mung says:

    So to expand further on my comment @173.

    The universe of possibilities is incredibly immense.

    The ability to sample that universe of possibilities is absolutely miniscule in comparison.

    In spite of these facts we have functional proteins.

    So the sampling process must be miraculous, finding function in a sea of non-function.

    OR

    Function must be ubiquitous, yet another miracle.

    Pick your poison.

    Neither can be explained by materialist theories.

  175. 175
    rhampton7 says:

    gpuccio,

    As a follow-up to my last post. I came across the Comparative Genomics Lab (Tomas Marques-Bonet), and he is investigating Canid evolution among other lines of research. He co-authored the paper, Genome Sequencing Highlights Genes Under Selection and the Dynamic Early History of Dogs, in which “high-quality genome sequences from three gray wolves, one from each of the three putative centers of dog domestication, two basal dog lineages (Basenji and Dingo) and a golden jackal” were compared. The results were used to reconstruct their evolutionary history.

    A common criticism of ID is that such an endeavor starts with the unchallenged assumption that evolution (RV + NS) must have been responsible for these changes. It’s precisely this assumption that can be tested with the kind of experiment I have suggested.

  176. 176
    gpuccio says:

    Piotr:

    First of all, I want to say that I appreciate very much your contributions here. As I have already said, you are a very good adversary, and you have given me many chances to detail important aspects of what I think. I thank you for that.

    So, please don’t consider the vehemence of intellectual confrontation (which I really like) with any lack of respect for you and your ideas.

    That said, I must also say, unfortunately, that it is true, for what it’s worth, that I have noticed some worsening of your arguments in your last posts. If you allow me the joke, it seems that the quality of your arguments is “decaying beyond recognition”, like some unlucky pseudogene. 🙂

    For example, frankly I would not have expected, from you, the backpedaling to the God of the gaps “argument”. I will not comment on that. I suppose that’s what happens when intelligent persons are for some reason committed to defend not so intelligent ideas. However, this thread, and the good discussion we have had here, should be answer enough.

    So, let’s go back to vehement (and interesting, I hope) intellectual confrontation, and let’s discuss what can be discussed. There is not much of that, but it’s better than nothing.

    In next thread.

    (By the way, I am not intentionally trying to increase the number of comments in my thread by fragmenting my answers. Not too much, at least. After all, some of my answers here are still very long. Let’s say that the shorter ones, like this one, can be considered “de novo posts”. 🙂 )

  177. 177
    gpuccio says:

    Piotr:

    No, I gave an extreme example to show that “junk” can be recycled. I was only talking about bias in favour of potentially functional products, not about a universal mechanism generating all de novo genes.

    And:

    No, I don’t buy the idea of “the language gene”; I’m not that naive. You tend to read too much into what I say.

    Well, I tend to read, in what you say, arguments against my arguments. I am happy to know you were only digressing. 🙂

  178. 178
    gpuccio says:

    Piotr:

    It’s enough if de novo genes have clear non-coding orthologues (primarily, unexpressed small ORFs) in closely related species. It shows that they were not magically created by the designer out of thin air.

    As you should have understood (and have understood), I don’t think that the designer creates things magically out of thin air. I have clarified many times, even to you, that IMO the designer guides the evolution of sequences adding functional information, probably mainly through guided mutations and guided transposon activity. What has it to do with “creating things magically out of thin air”?

    And, as I have explained, that view is not only perfectly compatible with de novo genes having homologies with previous non coding regions, but indeed supported by it.

  179. 179
    gpuccio says:

    Piotr:

    ORFs can originate in various ways. I never said they had to have homologues in more distant relatives (such homologues, even if they existed, would be hard to recognise anyway, given the rather small size of those “proto-genes”).

    If they were old genes inactivated and only slightly changed, like in your “extreme” example, they should have those homologues.

  180. 180
    gpuccio says:

    Piotr:

    Now this is getting really bizarre. The ancestry of a few hundred superfamilies can be traced back to LUCA, which doesn’t mean that they were present in LUCA as superfamilies.

    Wait a moment. If disfferent proteins in different species are part of the same superfamily, that means that they share sequence homologies, similar structure and similar function.

    If the superfamily is among those which were in LUCA, it means that those homologies, structure and function are already observable both in acrhea and in bacteria (and therefore precede the archea bacteria divergence).

    That means that the sequence, the structure and the function (therefore, the superfamily) were already in LUCA.

    What am I missing?

  181. 181
    gpuccio says:

    Piotr:

    LUCA was not the first living thing on Earth but the last universal common ancestor, itself the product of a long prehistory — presumably hundreds of millions of years — which can’t be reconstructed by comparing the genomes of its descendants. It was already pretty “modern” in terms of its genomic status. I have no idea how its genes originated.

    I agree with you. You have no idea.

    The simple point is that the facts we observe suggest that LUCA is also FUCA. Ideology, and only ideology, suggests otherwise.

    From Wikipedia:

    “The LUA is estimated to have lived some 3.5 to 3.8 billion years ago (sometime in the Paleoarchean era).[3][4] The earliest evidences for life on Earth are graphite found to be biogenic in 3.7 billion-year-old metasedimentary rocks discovered in Western Greenland[5] and microbial mat fossils found in 3.48 billion-year-old sandstone discovered in Western Australia.[6][7]”

    From Wikipedia:

    “The age of the Earth is 4.54 ± 0.05 billion year”

    “4100–3800 Ma Late Heavy Bombardment: extended barrage of impact events upon the inner planets by meteoroids. Thermal flux from widespread hydrothermal activity during the LHB may have been conducive to life’s emergence and early diversification.[5]

    3900–2500 Ma Cells resembling prokaryotes appear.[6] These first organisms are chemoautotrophs: they use carbon dioxide as a carbon source and oxidize inorganic materials to extract energy. Later, prokaryotes evolve glycolysis, a set of chemical reactions that free the energy of organic molecules such as glucose and store it in the chemical bonds of ATP. Glycolysis (and ATP) continue to be used in almost all organisms, unchanged, to this day.[7][8]”

    So, if those estimates are credible, the window ofr “OOL before LUCA”, if it ever existed, is really small.

    In that window (let’s say 200 – 300 Ma at best) not only OOL must have taken place, by some magical mechanism out of thin air, but also about half pf protein superfamilies must have appeared, with their sequence, structure and function (see previous post).

    For OOL we have no non design theory which even starts to be credible. For the origin of superfamiles, both at OOL and after it, we have no credible non design theory.

    Ah, but I forgot. These are God of the gaps arguments, not scientific reasoning.

  182. 182
    gpuccio says:

    Piotr:

    The controversy is not about whether the genes encoding for the L and M opsins have a common origin but whether trichromacy arose once or independently twice in catarrhines and platyrrhines.

    Let’s admit that the genes have a common origin (I should check the homologies, but I have not the time now).

    And so? That would simply be an argument about common descent, which I accept and defend. It tells us nothing about the mechanism, unless we analyze the complexity of the functional transition. Which I have not the time to do now, but can certainly be done.

  183. 183
    gpuccio says:

    rhampton7:

    Thank you for the contributions and the links. I will look at them, and cone back to you.

  184. 184
    Piotr says:

    Gpuccio:

    Wait a moment. If disfferent proteins in different species are part of the same superfamily, that means that they share sequence homologies, similar structure and similar function.

    Ranea et al. 2006:

    “However, even though there may be conservation of very general functional or molecular mechanisms (see Todd et al. 2001), some ancestral superfamily domains show such high functional diversification that it is difficult to define a concrete function for them. For example, the ATP-loop superfamily has representatives in 230 different orthologue clusters divided into 19 different COG functional subcategories. Although the ATP-loop domain is mainly represented in metabolic pathways, this domain is also involved in disparate functional roles.”

    Gpuccio:

    If the superfamily is among those which were in LUCA, it means that those homologies, structure and function are already observable both in acrhea and in bacteria (and therefore precede the archea bacteria divergence).

    That means that the sequence, the structure and the function (therefore, the superfamily) were already in LUCA.

    What am I missing?

    The simple fact that the homologies are between members of the same superfamily, not between bacterial and archeal superfamilies themselves. Its the common ancestor of the whole superfamily that can be traced back to Luca, not the individal proteins.

    More later.

  185. 185
    Piotr says:

    Gpuccio @181

    The simple point is that the facts we observe suggest that LUCA is also FUCA. Ideology, and only ideology, suggests otherwise.

    LUCA is nothing of the kind. It’s just the point in the past where all the genealogies of modern gene families finally coalesce. It was no more the first organism than “mtEve” was the first female. It wasn’t the first prokaryotic cellular organism either, or the only form of life on young Earth. If we ignore horizontal transfer, LUCA is technically the most recent common ancestor of Bacteria and Archaea, but since HT was surely widespread among early prokaryotes, the actual point of coalescence must be a bit deeper.

    From Wikipedia:

    “The LUA is estimated to have lived some 3.5 to 3.8 billion years ago (sometime in the Paleoarchean era).[3][4] The earliest evidences for life on Earth are graphite found to be biogenic in 3.7 billion-year-old metasedimentary rocks discovered in Western Greenland[5] and microbial mat fossils found in 3.48 billion-year-old sandstone discovered in Western Australia.[6][7]”

    Some of those fossil traces of life (if their interpretation is correct may well be older than LUCA.

    So, if those estimates are credible, the window ofr “OOL before LUCA”, if it ever existed, is really small.

    In that window (let’s say 200 – 300 Ma at best) not only OOL must have taken place, by some magical mechanism out of thin air, but also about half pf protein superfamilies must have appeared, with their sequence, structure and function (see previous post).

    I wouldn’t say that the 3.5 Ga estimate of the age of LUCA is impossible (though I’ve seen more modest estimates, of the order of 2.9 Ga, in recent literature). It still gives us a few hundred million years for the first chemical replicators to evolve into prokaryotic life more or less as we know it. It’s an interval roughly equal to that between the end of the Carboniferous and now.

    You seem to think that for a few billion years the “designer” has not really been creating anything out of thin air. He’s only been using small-scale magic to add some intelligent organisation to elements already present, like when he turns small ORFs into genes in fruit flies. He must have a soft spot for fruit flies; he’s still churning out orphan genes by the hundred for the 1500 Drosphila species, at such a rate that many of them are still segregating in D. melanogaster, for example. Perhaps the designer is the Lord of the Flies?

    But when we get to the root of life, you have to assume the magical creation of a complete LUCA out of thin air. The designer even had to create “superfamilies of genes” looking as if they consisted of homologues (but they can’t be true homologues if LUCA was Generation Zero; the designer simply made them look related).

  186. 186
    Piotr says:

    Gpuccio, @164:

    So, let’s talk about duplicated genes.

    What do you mean here? A gene duplicated and inactivated? Or a gene duplicated which goes on with its function?

    For simplicity, let’s restrict our discussion to a gene whose paralogue is initially identical to the original and remains “functional” (that is, gets transcribed and translated into a functional product). Of course in organisms with vast effective population (especially prokaryotes) the cost of maintaining a redundant copy may lead to counterselection. If, however, the effective population is relatively small, redundancy may be (nearly) neutral and duplicated genes may be retained in the genetic pool for a long time. Another possibility is that duplication itself is beneficial (like that multiplied amylase gene in domestic dogs, see Rhampton7 @175), in which case it will be maintained by positive selection. I’d like to concentrate on those cases when duplication is practically neutral.

    If you mean a gene which is not functional, the situation is even worse. Either the second gene is really useful, and then it is subject to negative selection: it will remain in iots “hole”.

    ??? — I do not understand this paragraph as it stands. Did you mean “a gene which is functional”? And what exactly is the second sentence trying to convey? Why “negative selection”? Under the standard meaning of the term, it isn’t something that affects “really useful” genes. I can only guess that you are indirectly (and confusingly) referring to “Ohno’s dilemma”: if the retention of both copies is beneficial, it restricts their ability to diverge. If that’s what you mean, I agree.

    Or the second gene is not useful, and it can change its sequence. Then, it will lose its original functionalities very early (a single stop codon will be enough), and become like the inactivated gene.

    Nope. You have smuggled in a false tacit assumption (after Behe?): gene = protein = function. It’s actually gene -> protein(s) and protein -> {function_1, function_2, … function_n}. The consequences of a mutation may damage one of the functions while leaving others unaffected. This opens many interesting possibilities.

    Proteins are isolated functional islands. You cannot go from one island to the other. You will be immediately lost in the ocean of non functionality.

    This is a myth.

    It’s not a case that we have no single example of the transition from one protein superfamily to another one, from one structure and function to another completely different structure and function.

    When interpreted literally, it seems to mean that have examples of such transitions. Which is of course just fine as far as I’m concerned, but I suspect that the sentence has mutated via double negation into the opposite of what youy had intended to say.

  187. 187
    gpuccio says:

    Piotr:

    OK, you are a fighter. I like that. And your arguments are better, again. More technical, more interesting. And they can be discussed.

    So, let’s fight! One point at a time.

    Let’s start with this bizarre statement (at #184). Ti my question (what am I missing?) you answer:

    The simple fact that the homologies are between members of the same superfamily, not between bacterial and archeal superfamilies themselves. Its the common ancestor of the whole superfamily that can be traced back to Luca, not the individal proteins.

    But that is simply not true.

    I will give you facts.

    Let’s take again our old friend, the beta subunit of ATP synthase. I have blasted the E. coli protein against the form in Methanosarcina barkeri, an archea that produces methane.

    This is the result:

    E. coli: length 460 AAs.

    Methanosarcina barkeri:

    Identities: 225/455(49%)

    Positives: 313/455(68%)

    Expect: 1e-153

    Now, these are not abstractions. They are not myths. They are real proteins, indeed protein subunits of one of the most important and complex molecular machine we know of.

    Most of the moleculte (approximately AAs 74 – 345) represents a single domain which is part of the RecA-like NTPases.

    Now, as you can see:

    a) these two real proteins share a very high homology osf sequence, structure and function between archaea and bacteria. The sequence is mainly the same, as is the structure and function. Half of the sequence is identical.

    How do you explain that? It is simpple: this molecule was already there in LUCA, and it had similar sequence, and the same structure and function, in LUCA.

    So, why do you say: “the homologies are between members of the same superfamily, not between bacterial and archeal superfamilies themselves”?

    It is simply not true.

    The 900 – 1000 superfamilies which were already in LUCA were already in LUCA. That nmeans that the proteins which are part of those superfamilies share high homology, and similar structure and function, not only among themselves in in species, but also between archea and bacteria. That’s how we know that they were already present in LUCA.

    Please, look at this very good paper:

    “The Evolutionary History of Protein Domains Viewed by Species Phylogeny”

    http://www.plosone.org/article.....ne.0008378

    A quote:

    “Table 1 lists the predicted number of domains and domain combinations originated in the major lineages of the tree of life. 1984 domains (at the family level) are predicted to be in the root of the tree (with the ratio Rhgt = 12), accounting for more than half of the total domains (3464 families in SCOP 1.73).”

  188. 188
    gpuccio says:

    Piotr:

    You quote the following paper:

    “Protein superfamily evolution and the last universal common ancestor (LUCA).”

    You are very kind. Here is the abstract:

    By exploiting three-dimensional structure comparison, which is more sensitive than conventional sequence-based methods for detecting remote homology, we have identified a set of 140 ancestral protein domains using very restrictive criteria to minimize the potential error introduced by horizontal gene transfer. These domains are highly likely to have been present in the Last Universal Common Ancestor (LUCA) based on their universality in almost all of 114 completed prokaryotic (Bacteria and Archaea) and eukaryotic genomes. Functional analysis of these ancestral domains reveals a genetically complex LUCA with practically all the essential functional systems present in extant organisms, supporting the theory that life achieved its modern cellular status much before the main kingdom separation (Doolittle 2000). In addition, we have calculated different estimations of the genetic and functional versatility of all the superfamilies and functional groups in the prokaryote subsample. These estimations reveal that some ancestral superfamilies have been more versatile than others during evolution allowing more genetic and functional variation. Furthermore, the differences in genetic versatility between protein families are more attributable to their functional nature rather than the time that they have been evolving. These differences in tolerance to mutation suggest that some protein families have eroded their phylogenetic signal faster than others, hiding in many cases, their ancestral origin and suggesting that the calculation of 140 ancestral domains is probably an underestimate.

    Emphasis mine.

    No comment. Please, quote that kind of paper more often. 🙂

  189. 189
    gpuccio says:

    Piotr:

    You quote:

    ““However, even though there may be conservation of very general functional or molecular mechanisms (see Todd et al. 2001), some ancestral superfamily domains show such high functional diversification that it is difficult to define a concrete function for them. For example, the ATP-loop superfamily has representatives in 230 different orthologue clusters divided into 19 different COG functional subcategories. Although the ATP-loop domain is mainly represented in metabolic pathways, this domain is also involved in disparate functional roles.””

    And so? That just means that some superfamilies include a lot of different families and proteins, with diversification of function. And so? How does that help your reasoning?

    The superfamily is a very high order grouping, second only to folding. It is normal that some superfamilies include diverse families and proteins, while others are more homogeneous. And so?

  190. 190
    gpuccio says:

    Piotr:

    You say:

    LUCA is nothing of the kind. It’s just the point in the past where all the genealogies of modern gene families finally coalesce. It was no more the first organism than “mtEve” was the first female. It wasn’t the first prokaryotic cellular organism either, or the only form of life on young Earth. If we ignore horizontal transfer, LUCA is technically the most recent common ancestor of Bacteria and Archaea, but since HT was surely widespread among early prokaryotes, the actual point of coalescence must be a bit deeper.

    You make a seiries of statements that have no empirical support. They may be true or false. Nobody knows, not even you.

    I list them here for you:

    a) “It was no more the first organism than “mtEve” was the first female.”

    Comment: Can you show any empirical evidence for other organisms before LUCA and different from it?

    b) “It wasn’t the first prokaryotic cellular organism either,”

    Comment: Can you show any empirical evidence for other prokaryotic cellular organisms before LUCA and different from it?

    c) “or the only form of life on young Earth.”

    Comment: Can you show any empirical evidence for other forms of life on young Earth?

    OK, I am waiting.

    My initial statement was, in comparison, much humbler:

    “The simple point is that the facts we observe suggest that LUCA is also FUCA. Ideology, and only ideology, suggests otherwise.”

  191. 191
    wd400 says:

    “The simple point is that the facts we observe suggest that LUCA is also FUCA</i?

    Can you show any empirical evidence to support this conclusion? It seems a bizarre thing to claim.

  192. 192
    gpuccio says:

    Piotr:

    Some of those fossil traces of life (if their interpretation is correct may well be older than LUCA.

    How do you know that they are not of LUCA, that they are different from it?

    I wouldn’t say that the 3.5 Ga estimate of the age of LUCA is impossible (though I’ve seen more modest estimates, of the order of 2.9 Ga, in recent literature). It still gives us a few hundred million years for the first chemical replicators to evolve into prokaryotic life more or less as we know it. It’s an interval roughly equal to that between the end of the Carboniferous and now.

    Remember that for a long time the planet was not compatible with any form of life. But I don’t want to quarrel for a few hundred million years! The “first chemical replicators” would not have had the time “to evolve into prokaryotic life more or less as we know it” even if our planet were tens of thousand years old. 🙂

  193. 193
    gpuccio says:

    Piotr:

    You seem to think that for a few billion years the “designer” has not really been creating anything out of thin air. He’s only been using small-scale magic to add some intelligent organisation to elements already present, like when he turns small ORFs into genes in fruit flies. He must have a soft spot for fruit flies; he’s still churning out orphan genes by the hundred for the 1500 Drosphila species, at such a rate that many of them are still segregating in D. melanogaster, for example. Perhaps the designer is the Lord of the Flies?

    We are again at silly arguments. The designer desings. It is no magic, small scale or big scale. It is the input of functional information into objects.

    And why do you hate so much fruit flies? Each living being is marvelous.

    But when we get to the root of life, you have to assume the magical creation of a complete LUCA out of thin air. The designer even had to create “superfamilies of genes” looking as if they consisted of homologues (but they can’t be true homologues if LUCA was Generation Zero; the designer simply made them look related).

    Why magics again? And the thin air? Maybe the designer used his own dust, to quote a famous joke.

    And yes, he had to engineer many superfamilies of genes at the beginning, because they were necessary to start life.

    The final statement is really pointless. We obviously don’t know in what times and what steps the first prokaryotes were engineered. That is true both for a design theory and for a non design theory. However, when you design a software, you can well implement basic objects and then derive similar functional objects from them. It’s what happens routinely in human Object Oriented Programming. And it is possible that the first living beings came into existence only when the global plan was implemented. We don’t know. Maybe one day we will.

  194. 194
    gpuccio says:

    wd400 at #191:

    Yes.

    We know that LUCA was a prokaryote. The simplest autonomous living beings ever observed are prokaryotes. There is no evidence at all that autonomous living being simpler than prokaryotes even exist.

    LUCA was there in a window of time from the origin of our planet and from when it became compatible with life that, while not known with certainty, is certainly rather “narrow” in terms of natural history of our planet.

    The information gap between non living matter and prokaryotes is certainly much bigger than all other information gaps in the history of life, including the generation of eukaryotes and the Cambrian explosion. There is no credible theory for that rather sudden emergence of such a huge quantity of functional information, out of design.

    There is no evidence at all that some FUCA different from LUCA, and simpler, ever existed.

    Therefore, it is perfectly legitimate, and reasonable, to hypothesize that what we call LUCA, a prokaryote predating the archaea – bacteria divergence, was the first form of life on our planet (FUCA).

  195. 195
    Piotr says:

    The 900 – 1000 superfamilies which were already in LUCA were already in LUCA. That nmeans that the proteins which are part of those superfamilies share high homology, and similar structure and function, not only among themselves in in species, but also between archea and bacteria. That’s how we know that they were already present in LUCA.

    Nope. The article argues that a large number of domains making up complex proteins can be traced back to common ancestors in LUCA. Domains are not protein superfamilies.

    A protein found in Bacteria may be homologous to a protein found in Archaea. Even better, the same bacterial protein may have numerous paralogues in the same bacterial genome, a vast number of homologues in other Bacteria and Archaea, etc. More often it will be a conserved domain rather than a complete complex protein. If we can rule out horizontal transfer, we conclude that we are dealing with a family reducible to a single common ancestor present in LUCA. Over the next millions and billions of years LUCA’s proteins (or at least their domains, combined and recombined in the course of evolution) have diverged into today’s superfamilies.

    What a pity you read good articles so selectively. How about this?

    This combined evolution of domains, and combinations thereof, suggests that once protein domains have been generated and inherited in genomes, biological organisms tend to create new proteins and functions through duplication and recombination of existing domains, rather than create new domains de novo, in accordance with the general trend of genome evolution by means of duplication and recombination.

  196. 196
    Piotr says:

    Gpuccio:

    Remember that for a long time the planet was not compatible with any form of life. But I don’t want to quarrel for a few hundred million years! The “first chemical replicators” would not have had the time “to evolve into prokaryotic life more or less as we know it” even if our planet were tens of thousand years old.

    Please show me you calculations regarding the time necessary for cellularity to evolve. 300 million years is not enough? Why? Some bacteria may produce 100 generations a day in favourable conditions. Protobiotic replication cycles are likely to have been still shorter. How many trillions or quadrillions of cycles would satisfy you?

  197. 197
    gpuccio says:

    Piotr at #186:

    For simplicity, let’s restrict our discussion to a gene whose paralogue is initially identical to the original and remains “functional” (that is, gets transcribed and translated into a functional product).

    OK.

    I’d like to concentrate on those cases when duplication is practically neutral.

    OK.

    ??? — I do not understand this paragraph as it stands. Did you mean “a gene which is functional”? And what exactly is the second sentence trying to convey? Why “negative selection”? Under the standard meaning of the term, it isn’t something that affects “really useful” genes. I can only guess that you are indirectly (and confusingly) referring to “Ohno’s dilemma”: if the retention of both copies is beneficial, it restricts their ability to diverge. If that’s what you mean, I agree.

    My typo. It was obviously “a gene which is functional”.

    And negative selection is “something that affects “really useful” genes”, when they mutate and lose their function. From Wikipedia:

    “In natural selection, negative selection[1] or purifying selection is the selective removal of alleles that are deleterious. This can result in stabilizing selection through the purging of deleterious variations that arise.”

    Negative selection is the same as purifying selection. It’s the reason why functional sequences cannot change much and are conserved, while non functional sequences can vary more.

    So yes, we agree on that.

    Nope. You have smuggled in a false tacit assumption (after Behe?): gene = protein = function. It’s actually gene -> protein(s) and protein -> {function_1, function_2, … function_n}. The consequences of a mutation may damage one of the functions while leaving others unaffected. This opens many interesting possibilities.

    This deserves more discussion. It is true that a protein can have many functions. There are many reasons for that.

    One of them is that very complex proteins have often different domains, and each domain has different biochemical functions.

    Another reason is that the basic biochemical function (the “local” function) can have different roles in a higher level context.

    However, there is no doubt that proteins are first of all biochemical machines. The individual domains have a specific biochemical activity, which depends on the sequence and the structure. If that biochemical activity is lost or damaged, any higher function is lost or damaged.

    Moreover, many proteins, like enzymes, have a rather straightforward biochemical function, which can be easily identified.

    I can’t see which “interesting possibilities” you see, or imagine, from that. If a duplicated protein gene is neutral, as you assumed, then its sequence can change freely. It is not different from a non coding, non functional gene. Even if it retains other functions, for example in different domains, how can that help you? The functional parts will be conserved, the non functional parts will change inexorably and randomly.

    This is a myth.

    No. It is a fact.

    Let’s look again at the SCOP calssification.

    There is a tool, called ASTRAL, which allows us to ask for the grouping of all the domains in the database according to a “lower than n%” identity, or “greater than n” E value.

    I have done that as follows:

    Subsets with lower than 10% identity: 6400

    Subsets with greater than 0.05 E value: 7181

    What does that mean? It means that, if we group the protein records in the database so that each group has less than 10% identity with all other groups, IOWs an identity which can be expected by chance (E value higher tha, 0.05), than we get 6000 – 7000 separated groupings (that corresponds more or less to the number of families, which is 4496).

    Those are isolated islands of function in the sequence space. It is a fact.

    Even adding structural and functional similarities to group in larger subsets, we still get the 2000 superfamilies.

    I usually use the superfamily level of classification in my reasoning because of my old bad habit of being too generous with the enemy! 🙂

    When interpreted literally, it seems to mean that have examples of such transitions. Which is of course just fine as far as I’m concerned, but I suspect that the sentence has mutated via double negation into the opposite of what youy had intended to say.

    You suspect correctly. A slip of my English, I suppose. What I meant was:

    “It’s not a case that we have not even a single example (IOWs no example at all) of the transition from one protein superfamily to another one, from one structure and function to another completely different structure and function.”

    And I still mean it.

    The moral? Never mess with a linguist! 🙂

  198. 198
    wd400 says:

    None of that is empirical evidence that the LUCA had no predecessors. No scientist thinks LUCA arose at once, so to simply assume away precursors to LUCA is hardly fairly dealing scientific claims.

  199. 199
    Piotr says:

    We are again at silly arguments. The designer desings. It is no magic, small scale or big scale. It is the input of functional information into objects.

    He not only “designs” but also implements his “design” physically. What method does he use to inject his functional information into the genomes of germline cells of selected individuals? Note that he must be doing it all the time, to all species, not just to cause an occasional evolutionary breakthrough, but every time a dubiously functional orphan gene emerges in a bloody fruit fly. And he’s been at it for almost four billion years (the first two billion must have been pretty boring!).

    I won’t even try to enquire why he should be playing such a complex game, but I’m interested in the physical aspect of this “input of functional information”. In all cases known to me the transfer of information absolutely requires a physical signal. Can we detect it somehow? Or it pure spoonbending psychokinetic magic after all?

  200. 200
    gpuccio says:

    Piotr at #195:

    Nope. The article argues that a large number of domains making up complex proteins can be traced back to common ancestors in LUCA. Domains are not protein superfamilies.

    It’s the same thing. They focus on the domain level of classification, and analyze 3464 domains, which corresponds to the 2000 superfamilies. The number of single domains os higher, because many superfamilies are multi-domain (class e in SCOP).

    If you look at Table 1, you will see that 1984 domains (more than half) were present in LUCA, that means about half of the superfamilies or families. That should be very clear form the part I have quoted, and I quote it again here for your convenience:

    “Table 1 lists the predicted number of domains and domain combinations originated in the major lineages of the tree of life. 1984 domains (at the family level) are predicted to be in the root of the tree (with the ratio Rhgt = 12), accounting for more than half of the total domains (3464 families in SCOP 1.73).”

    What is your problem?

    What a pity you read good articles so selectively. How about this?

    Nothing. It is true that the paper analyzes also the emergence of new domain combinations. And it is true that domain combinations tend to increase in their emergence in the course of natural history.

    But I focused on the emergence of simple domains, which also continue to emerge throughout natural history, although at a decreasing rate.

    Table 1 shows both the emergence of single domains (column 2) and of combinations (column 3).

    Why do I focus on the single domains? It’s simple. As I am discussing the computation of digital functional complexity, I am interested more in sequences, and single domains represent new sequences.

    Combinations are certainly interesting and important, but more difficult to analyze. We should consider the space of possible combinations, and of functional ones. It can certainly be done, but at this stage I prefer to stick to individual domains. It’s more than enough for my purpose.

    I don’t think that I read articles selectively. I read and quote what is pertinent and important for my argument. The data about combination are absolutely compatible with my argument, and I don’t see how they can favor yours, but they were not pertinent to the discourse I was doing about sequence functionality. In recombinations, existing sequences are reused in new forms. There is functional novelty, but it is not so much in the sequences, but rather in how they are rearranged and combined.

  201. 201
    gpuccio says:

    Piotr:

    Please show me you calculations regarding the time necessary for cellularity to evolve. 300 million years is not enough? Why? Some bacteria may produce 100 generations a day in favourable conditions. Protobiotic replication cycles are likely to have been still shorter. How many trillions or quadrillions of cycles would satisfy you?

    At this point, you should already know what I think. Without design, cellularity cannot ever evolve. Period.

    But my point was, even if we believed it can, 300 million years is a joke.

    You are entitled to believe differently.

  202. 202
    gpuccio says:

    Piotr:

    He not only “designs” but also implements his “design” physically. What method does he use to inject his functional information into the genomes of germline cells of selected individuals? Note that he must be doing it all the time, to all species, not just to cause an occasional evolutionary breakthrough, but every time a dubiously functional orphan gene emerges in a bloody fruit fly. And he’s been at it for almost four billion years (the first two billion must have been pretty boring!).

    I won’t even try to enquire why he should be playing such a complex game, but I’m interested in the physical aspect of this “input of functional information”. In all cases known to me the transfer of information absolutely requires a physical signal. Can we detect it somehow? Or it pure spoonbending psychokinetic magic after all?

    Very good question. I have debated that aspect many times in the past, but in this thread it is the first time it is mentioned.

    OK. I am ready to deal with that again.

    But it’s late. Let’s leave it for tomorrow. Have a good night! 🙂

  203. 203
    gpuccio says:

    wd400:

    None of that is empirical evidence that the LUCA had no predecessors. No scientist thinks LUCA arose at once, so to simply assume away precursors to LUCA is hardly fairly dealing scientific claims.

    Well, there is even less empirical evidence that LUCA had predecessors. Can you deny that?

    I am well aware that most scientists (I would not be sure of the “no scientist”) thinks that. You may believe that what scientists believe is the standard for what is good science. I think differently.

    You may have noticed that I, like many others in ID, believe that scientific academy has been very biased about a couple of things, in the last decades.

  204. 204
    Piotr says:

    “It’s not a case that we have not even a single example (IOWs no example at all) of the transition from one protein superfamily to another one, from one structure and function to another completely different structure and function.”

    And I still mean it.

    Hey, so you still mean the double negation? I’m beginning to suspect a Freudian slip: you realise you are wrong and you’re unconsciously trying to contradict yourself. Be careful, or I’ll take you at your word. 🙂

    OK, what about transition from one protein to another one, with a different function but within the same superfamily? You realise, don’t you, that (super)families are called (super)families because they are defined on the basis of homologies (in other words, shared ancestry, not shared functionalities, which may well be convergent).

  205. 205
    wd400 says:

    Well, there is even less empirical evidence that LUCA had predecessors. Can you deny that?

    Yes. I don’t think there is any empirical evidence either way. Requiring such is to play a silly game, and pretending you can conclude anything after assuming away precursors LUCA would be too.

  206. 206
    jerry says:

    What method does he use to inject his functional information into the genomes of germline cells of selected individuals?

    Oh, how did the designer do it argument! From a few years ago since this comes up all the time

    http://www.uncommondescent.com.....ent-305339

    Someone actually wants the laboratory techniques used 3.8 billion years ago. You talk about bizarre. I say a thousand as hyperbole and Mark in all seriousness says there is probably only a dozen. Mark wants the actual technique used a few billion years ago.

    Mark, I got word from the designer a few weeks ago and he said the original lab and blue prints were subducted under what was to become the African plate 3.4 billion years ago but by then they were mostly rubble anyway. The original cells were relatively simple but still very complex. Subsequent plants/labs went the same way and unfortunately all holograph videos of it are now in hyper space and haven’t been looked at for at least 3 million years. So to answer one of your questions, no further work has been done for quite awhile and the designer expects future work to be done by the latest design itself. The designer travels via hyper space between his home and our area of the universe when it is necessary.

    The designer said the techniques used were much more sophisticated than anything dreamed of by current synthetic biologist crowd but in a couple million years they may get up to speed and understand how it was actually done. The designer said it is actually a lot more difficult than people think especially since this was a new technique and he had to invent the DNA/RNA/protein process from scratch but amazingly they had the right chemical properties. His comment was “Thank God for that” or else he doesn’t think he wouldn’t have been able to do it. It took him about 200,000 of our years just experimenting with amino acid combinations to get usable proteins. He said it will be easier for current scientists since they will have a template to work off.

    As far as it being boring:

    And he’s been at it for almost four billion years (the first two billion must have been pretty boring!)

    Actually with a 100 billion planets in this universe and and an untold number of universes for which the designer is responsible, it gets pretty busy and never boring. There is a competition going on between designers on who can create the most interesting universe. With an infinite number of designers at it, the competition is pretty intense.

    The next silly objection will probably be the theodicy argument.

  207. 207
    Piotr says:

    If you look at Table 1, you will see that 1984 domains (more than half) were present in LUCA, that means about half of the superfamilies or families.

    No. The ancestors of their building blocks were present in LUCA. What you are saying is like claiming that the variation seen in today’s mammals and, parallelly, in today’s birds, must have been present in their common ancestor 300+ million years ago. A penguin’s flippers are homologous to a sparrow’s wings, a dolphin’s flippers are homologous to a bat’s wings, and avian forelimbs in general are homologous to mammalian forelimbs. Therefore, the common ancestor must have had both wings and flippers (homologous to each other). Or perhaps, since there are ca. 6,000 species of mammals and 10,000 species of birds, the common ancestor was a collective of a few thousand rather different species.

    More tomorow. Buona notte!

  208. 208
    Piotr says:

    jerry:

    The next silly objection will probably be the theodicy argument.

    “How it happens” is a ridiculous question only to people who have no clue how to answer it and can’t think of a better evasive tactic.

  209. 209
    Mung says:

    In my email today:

    What is Verification by Multiplicity? » Learn about the statistical technique that NASA scientists used to winnow out so many planets from the bulk data.

  210. 210
    jerry says:

    “How it happens” is a ridiculous question only to people who have no clue how to answer it and can’t think of a better evasive tactic.

    It is a ridiculous question. The only people who ask it are ones trying to evade the obvious.

  211. 211
    Mung says:

    Resources for finding globular domains with determined tertiary structures include SCOP (fold leve), ASTRAL (domains from SCOP), SUPERFAMILY (hidden Markov models of SCOP domains), and CATH (architecture level). However, these resources are confined to the structural knowledge base PDB. Therefore, only a subset of the total fold and structure space is described; the remaining domains are to a certain extent described in Pfam and SMART. – Modular Protein Domains

  212. 212
    Dionisio says:

    Want to see abundant examples of complex specified purpose-oriented functional information processing mechanisms in action?
    Just look at the elaborate mechanisms that produce and operate the spindle apparatus that plays such an important role in the intrinsic asymmetric divisions during embryonic development. Also look at the sophisticated choreographies and orchestrations that produce and operate the genotype-phenotype association. Pay attention at the details that lead to relatively consistent proportions of the different cell types. Observe carefully the timing for the start of the different developmental phases. Enjoy the increasing availability of data coming out of the research labs, which shed more light on all those wonderful systems.
    That’s why so many engineers and computer scientists are fascinated by all this. These are exciting days to look at science.

  213. 213
    Dionisio says:

    But note in the post 212 that there’s no mention of the origin of all those elaborate mechanisms. Just looking at the currently existing state of affairs is sufficient to excite some of us and keep us busy (scratching our heads), trying to understand it well.
    The OOL discussion, with all the references to statistics and probabilities, is too difficult, and sometimes very abstract. It’s easier to stick to basic simplicity.
    Have fun!

  214. 214
    gpuccio says:

    Piotr:

    No. The ancestors of their building blocks were present in LUCA.

    No. You are wrong again. Most of the superfamilies are single domain. Just look again at the beta subunit of the ATP synthase. The superfamily is (in the NCBI classification):

    “RecA-like NTPases.

    This family includes the NTP binding domain of F1 and V1 H+ATPases, DnaB and related helicases as well as bacterial RecA and related eukaryotic and archaeal recombinases. This group also includes bacterial conjugation proteins and related DNA transfer proteins involved in type II and type IV secretion.”

    For clarity, the name for the same superfamily in SCOP is P-loop containing nucleoside triphosphate hydrolases.

    IOWs, the superfamily is a superfamily which groups many different domains, with similar structure. That’s why we have 6000 -7000 independent groupings at sequence level, and only 2000 superfamilies.

    What I have blasted is a specific protein in the superfamily, the beta subunit of ATP synthase, of which that particular domain (and therefore that superfamily) is the main component, the central domain (I have also specified which AAs are of the domain: approximately AAs 74 – 345).

    So, I have blasted the same protein as it is found in archaea and bacteria, not a protein with other members of the same superfamily, and I have found a very high homology. That means simply that the protein, that specific protein (and therefore the superfamily in which its main domain is classified) was already present in LUCA, practically the same as it is in archaea, in bacteria, and even in humans today.

    On the contrary, the homology between members of the same superfamily in the same species can be much lower. For example, if we BLAST the beta subunit of ATP synthase and RecA (the protein which gives the name to the superfamily in the NCBI classification) we find only three short alignments, none of them significant:

    1) Identities: 7/18(39%) Positives: 10/18(55%)
    Expect: 1.5

    2) Identities: 6/19(32%) Positives: 11/19(57%)
    Expect: 9.1

    3) Identities: 4/8(50%) Positives: 8/8(100%)
    Expect: 10.0

    What does it mean? It means that those two proteins, even if grouped in the same superfamily for similarities of structure and function, are completely different at the sequence level. Indeed, in the SCOP classification they belong to the same superfamily, P-loop containing nucleoside triphosphate hydrolases, and even to the same family, RecA protein-like (ATPase-domain). But they are completely different at sequence level.

    The grouping in superfamilies and families is based on structural and large functional similarities, and it can include proteins completely different at sequence level. Like in this case.

    What about Rec A? Is it conserved between archaea and bacteria? Was it already in LUCA, as an individual protein?

    The answer is yes. Here is the BLAST of Rec A in coli and in one archea (comnpare it with the BLAST I gave for ATP synthase subunit beta in post #187):

    Protein Rec A.

    E. coli: length 353 AAs.

    Euryarchaeote SCGC AAA261-G15: length 346 AAs

    Identities: 203/322(63%)

    Positives: 269/322(83%)

    Expect: 2e-151

    Therefore, the two proteins are almost identical in bacteria and archea. And this particular protein is single domain: the whole protein is made of the domain P-loop containing nucleoside triphosphate hydrolases, which in the beta subunit of ATP synthase represents only the central (and main) domain..

    To sum up:

    a) The superfamily P-loop containing nucleoside triphosphate hydrolases is presnt in cacteria and archea with at least two (indeed, with many more) different proteins which are calssified in it: The beta subunit of ATP synthase (central domain) and Rec A.

    b) Each of those two protein is almost the same at sequence level in archaea and bacteria, therefore it was present in LUCA mainly as it is now .

    c) The two proteins are completely different at sequence level in the same organisms (for example, in E. coli).

    d) Therefore, it is clear that not only the superfamily was already present in LUCA, but that it was already diversified at least in these two different proteins, always in LUCA.

    Which is exactly the opposite of what you were saying.

    Excuse me if I have been a little fastidious on this subject, but it is a fundamental point, and you were clearly understanding it in the wrong way.

  215. 215
    gpuccio says:

    Piotr:

    Hey, so you still mean the double negation? I’m beginning to suspect a Freudian slip: you realise you are wrong and you’re unconsciously trying to contradict yourself. Be careful, or I’ll take you at your word.

    Maybe. But in italian the phrase works that way! We are probably less precise about double negations, italians are compliant people. 🙂

    OK, what about transition from one protein to another one, with a different function but within the same superfamily? You realise, don’t you, that (super)families are called (super)families because they are defined on the basis of homologies (in other words, shared ancestry, not shared functionalities, which may well be convergent).

    Well, as I have shown in my previous post, different proteins of the same superfamily are in some cases already present in LUCA.

    In many other cases, obviously, they appear later.

    What about it? First of all, even if the function changes, very often the structure remains very similar. For example, shifts in function can happen with small variation at the active site. Consider the example of nylonase. It is derived form penicillinase by a couple (if I remember well) of substitutions at the active site. Both proteins are esterases, and they share the same structure and sequence. But the substrate is a different kind of ester (nylon versus penicillin), and the higher level function is therefore very different. But the local biochemical function is quite similar.

    Such transitions can be darwinian, because they are simple enough.

    In other cases even the shift inside families is too complex to be easily explained in darwinisn terms. Axe has debated this aspect, and he suggest about 5 AAs transitions as a threshold, if I remember well. I can agree with that concept.

    So, each functional transition must be judged individually, according to its functional complexity. That’s exactly what dFSCI is meant to do.

    Well, I suppose that the discussion about how the designer could act on the material plane will have to wait until later.

  216. 216
    gpuccio says:

    wd400:

    Yes. I don’t think there is any empirical evidence either way. Requiring such is to play a silly game, and pretending you can conclude anything after assuming away precursors LUCA would be too.

    I require nothing and I pretend nothing. We have few facts, and as you say they are not “empirical evidence” of nothing, because they are not enough.

    My point is that my hypothesis (LUCA is also FUCA) explains the little we know better, and it is simpler and more straightforward, given those few facts.

    As new facts become known (and they will), we can see what happens. Consider my hypothesis as a prediction.

  217. 217
    Piotr says:

    Therefore, it is clear that not only the superfamily was already present in LUCA, but that it was already diversified at least in these two different proteins, always in LUCA.

    It depends on how you define LUCA. It you take only vertical descent of organisms into account, LUCA = the last common ancestor of Bacteria and Archaea. If you look at the lineages of genes instead and do not ignore horizontal transfer, LUCA will be older (it will be the hypothetical organism in which the lineages of genes finally coalesce). Modelling the evolution of prokaryotes as a neat family tree is unrealistic — the actual genealogies form a “tangled bush”, and there will be frequent mismatches between family trees of genes and organism (not to mention complications introduced by endosymbiosis). You are partly confusing the two notions of shared ancestry yourself. Note that you say that related genes had diverged “already in LUCA”. That means that LUCA had an ancestor in which both genes had a single source. I want to make the distinction clear to avoid quibbling about terminology.

  218. 218
    bornagain77 says:

    I’m amazed that Darwinists still argue over the probabilities of a novel protein forming by chance.

    Stephen Meyer Critiques Richard Dawkins’s “Mount Improbable” Illustration – video
    https://www.youtube.com/watch?v=7rgainpMXa8

    Estimating the prevalence of protein sequences adopting functional enzyme folds: Doug Axe:
    Excerpt: The prevalence of low-level function in four such experiments indicates that roughly one in 10^64 signature-consistent sequences forms a working domain. Combined with the estimated prevalence of plausible hydropathic patterns (for any fold) and of relevant folds for particular functions, this implies the overall prevalence of sequences performing a specific function by any domain-sized fold may be as low as 1 in 10^77, adding to the body of evidence that functional folds require highly extraordinary sequences.
    http://www.toriah.org/articles/axe-2004.pdf

    The Case Against a Darwinian Origin of Protein Folds – Douglas Axe – 2010
    Excerpt Pg. 11: “Based on analysis of the genomes of 447 bacterial species, the projected number of different domain structures per species averages 991. Comparing this to the number of pathways by which metabolic processes are carried out, which is around 263 for E. coli, provides a rough figure of three or four new domain folds being needed, on average, for every new metabolic pathway. In order to accomplish this successfully, an evolutionary search would need to be capable of locating sequences that amount to anything from one in 10^159 to one in 10^308 possibilities, something the neo-Darwinian model falls short of by a very wide margin.”
    http://bio-complexity.org/ojs/.....O-C.2010.1

    The Case Against a Darwinian Origin of Protein Folds – Douglas Axe, Jay Richards – audio
    http://intelligentdesign.podom.....9_03-07_00

    Biologist Douglas Axe on evolution’s ability to produce new functions – video
    https://www.youtube.com/watch?v=8ZiLsXO-dYo

    “It turns out once you get above the number six [changes in amino acids] — and even at lower numbers actually — but once you get above the number six you can pretty decisively rule out an evolutionary transition because it would take far more time than there is on planet Earth and larger populations than there are on planet Earth.”
    Douglas Axe

    The Evolutionary Accessibility of New Enzyme Functions: A Case Study from the Biotin Pathway – Ann K. Gauger and Douglas D. Axe – April 2011
    Excerpt: We infer from the mutants examined that successful functional conversion would in this case require seven or more nucleotide substitutions. But evolutionary innovations requiring that many changes would be extraordinarily rare, becoming probable only on timescales much longer than the age of life on earth.
    http://bio-complexity.org/ojs/.....O-C.2011.1

  219. 219
    gpuccio says:

    Piotr:

    Very good. I am a great fan of clear definitions (as anybody can see from the titles of my 2 OPs). So, I am grateful that you ask me to define better my terms.

    Let’s try.

    Premise: the divergence between archaea and bacteria is the first one we can detect from the existing proteomes. At present, we can infer nothing about what happened before from the observation of the existing proteomes. OK?

    a) LUCA. We call LUCA the living beings that existed immediately before that divergence (let’s assume 3 billion years ago), and from which that divergence happened.

    b) What we don’t know about LUCA. We don’t know for how long it existed. If it was a single species or a pool of different organisms. If there were simpler ancestors. And so on.

    c) What we know about LUCA. It was more or less a prokaryote. It had a lot of the basic functions of a prokaryote, functions which are shared between archaea and bacteria.

    d) HGT is certainly a complication, but not to the point that the above facts can be doubted.

    e) Now, let’s call protein information in LUCA all the information that is shared between archea and bacteria.

    f) In particular, if some protein, like those two I have cited, still present high homology today between archaea and bacteria, like our two examples, we can be rather certain that that protein was already in LUCA as an ancestor of both the bacterial and the archaeal form. In particular, if the homology is still very high, like in our two examples, we can be rather certain that the LUCA ancestor was essentially the same thing as the modern proteins in the modern proteome, and the differences can be easily explained as the effect of neutral evolution with conserved structure and function.

    g) What can we say if two proteins, of the same superfamily, but completely different between themselves, were both present in LUCA? This is the case of Rec A and the beta subunit of ATP synthase.

    You object that:

    “You are partly confusing the two notions of shared ancestry yourself. Note that you say that related genes had diverged “already in LUCA”. That means that LUCA had an ancestor in which both genes had a single source. I want to make the distinction clear to avoid quibbling about terminology.”

    That’s OK. But in reality I said that:

    “Therefore, it is clear that not only the superfamily was already present in LUCA, but that it was already diversified at least in these two different proteins, always in LUCA.”

    Emphasis mine. I did not really mention “divergence”.

    However, this is a good occasion to clarify:

    1) The first divergence we observe is the archaea bacteria divergence.

    2) Were there divergences before? That is part of what we don’t know. Maybe. But it is at least strange that, if there was an evolutionary history of OOL, and then an evolutionary history from FUCA to LUCA, no earlier divergences can be observed today. THat is ib itself an argument in favor of my hypothesis that LUCA is FUCA. If one does not accept that, the lack of any detectable earlier divergence can be explained only in two ways:

    1a) A long and complex evolutionary history (which generated life and then brought form FUCA to LUCA) happened without any divergence at all (very strange).

    2a) There were divergences, but they are no more detectable. Even stranger, if you consider that we clearly detect the divergence between bacteria and archaea, which took place 3 billion years ago. Previous divergences should have already been cancelled in LUCA, because otherwise they should be still detectable (unless you think that nature selectively cancels divergences 3.2 billion years old, and respetcs divergences 3 billion years old). But is those divergences were alredy cancelled in LUCA, then they were created and canceled in a window of a few hundred million years. Why?

    3) What can we say of Rec A and the beta subunit of ATP synthase? THat they are two different proteins, of the same superfamily, with no sequence homology, and that they were both in LUCA.

    Frankly, the explanation that they diverged form a single ancestor does not seem very promising. Looking at their complete sequence separation, I would prefer an explanation based on independent design. The structural and functional affinity, which is the reason for the classification in the same superfamily, would then be the consequence of functional constraints in the design.

    The problem, however, is open to enquiry and discussion.

  220. 220
    bornagain77 says:

    Moreover, proteins are far more complicated, and antagonistic to Darwinian claims, than most Darwinists imagine, or would prefer, them to be:

    Acrobatic Protein Stars in Two Gymnastic Events – July 2012
    Excerpt: “We showed that RfaH refolds, which is a big enough deal already. You would think this is impossible. That’s what you’re told in school,” says Ohio State microbiologist Irina Artsimovitch,,, Though the process happens in seconds, Artsimovitch likened the refolding (of a single protein to a completely different fold pattern) to “having a knitted sweater that you rip out and then knit into a sweater with a different pattern.”
    http://www.evolutionnews.org/2.....62541.html

    The Gene Myth, Part II – August 2010
    Excerpt: “It was long believed that a protein molecule’s three-dimensional shape, on which its function depends, is uniquely determined by its amino acid sequence. But we now know that this is not always true – the rate at which a protein is synthesized, which depends on factors internal and external to the cell, affects the order in which its different portions fold. So even with the same sequence a given protein can have different shapes and functions. Furthermore, many proteins have no intrinsic shape, taking on different roles in different molecular contexts. So even though genes specify protein sequences they have only a tenuous (very weak or slight) influence over their functions.
    ,,,,So, to reiterate, the genes do not uniquely determine what is in the cell, but what is in the cell determines how the genes get used. Only if the pie were to rise up, take hold of the recipe book and rewrite the instructions for its own production, would this popular analogy for the role of genes be pertinent.
    Stuart A. Newman, Ph.D. – Professor of Cell Biology and Anatomy
    http://darwins-god.blogspot.co.....rt-ii.html

    Physicists Discover Quantum Law of Protein Folding – February 22, 2011
    Quantum mechanics finally explains why protein folding depends on temperature in such a strange way.
    Excerpt: First, a little background on protein folding. Proteins are long chains of amino acids that become biologically active only when they fold into specific, highly complex shapes. The puzzle is how proteins do this so quickly when they have so many possible configurations to choose from.
    To put this in perspective, a relatively small protein of only 100 amino acids can take some 10^100 different configurations. If it tried these shapes at the rate of 100 billion a second, it would take longer than the age of the universe to find the correct one. Just how these molecules do the job in nanoseconds, nobody knows.,,,
    Their astonishing result is that this quantum transition model fits the folding curves of 15 different proteins and even explains the difference in folding and unfolding rates of the same proteins.
    That’s a significant breakthrough. Luo and Lo’s equations amount to the first universal laws of protein folding. That’s the equivalent in biology to something like the thermodynamic laws in physics.
    http://www.technologyreview.co.....f-protein/

    Watching a protein as it functions – March 15, 2013
    Excerpt: When it comes to understanding how proteins perform their amazing cellular feats, it is often the case that the more one knows the less one realizes they know. For decades, biochemists and biophysicists have worked to reveal the relationship between protein structural complexity and function, only to discover more complexity.,,,
    A signaling protein usually responds to a messenger or trigger, such as heat or light, by changing its shape, which initiates a regulatory response in the cell. Signaling proteins are all-important to the proper functioning of biological systems, yet the rapid sequence of events, occurring in picoseconds, had, until now, meant that only an approximate idea of what was actually occurring could be obtained.,,
    The team identified four major intermediates in the photoisomerization cycle. ,,,
    By tracking structurally the PYP photocycle with near-atomic resolution, the team provided a foundation for understanding the general process of signal transduction in proteins at nearly the lightning speed in which they are actually happening.
    http://phys.org/news/2013-03-p.....tions.html

  221. 221
    gpuccio says:

    BA:

    Thank you for your contributions. A lot of interesting stuff there.

  222. 222
    Dionisio says:

    gpuccio @ 215

    Maybe. But in italian the phrase works that way! We are probably less precise about double negations, italians are compliant people. 🙂

    un italiano vero! eccellente!

    Keep writing mio caro amico, you do it very well. I’m learning quite a bit from your OPs and the follow-up comments.

    May God bless you, doctor.

    P.S. back to my head-scratching study sessions, trying to understand things you already know well. BTW, got a good amount of helpful information from the links you provided. They were quite a boost! Mile grazie!!!
    Now reviewing the description of the spindle apparatus mechanisms operating on the intrinsic asymmetric divisions. The more I look at this, the more it seems like science fiction. What a fascinating story! Anyway, can’t make much progress on the software development project until I get the story main scenario and choreography clear. This is fun!

  223. 223
    gpuccio says:

    Piotr:

    Profiting of a moment of calmness, I will try to give you a brief outline of what I think about the physical implementation of biological design. Please, consider that this issue is at present highly speculative, but potentially open to many empirical approaches.

    a) ID is about the inference of design, in particular for biological information. It is perfectly true that, to infer design, it is not necessary to know any details about the designer (nature, purposes, times and modalities of implementation), because the design inference is independent from all that, and depends only on the observation of complex functional information and on its empirical connection with the process of design. If we infer design, we are only inferring that the specified form in the observed object was inputted into the object from the conscious purposeful representations of a conscious being. In particular, what we know of the process of design is derived from the observation of human design.

    b) That said, it is equally true that, if we infer design, even tentatively, as an explanation for biological information, things do not stop there. There are a lot of legitimate question that arise, and that must be scientifically addressed, as far as it is possible. The most obvious questions are:

    – Who is the designer
    – One or many designers?
    – What is the purpose of the design process?
    – When was the design implemented?
    – How was the design implemented?
    – What are the design strategies used?
    – Is the design process slow and gradual, or “punctuated”?

    Some of these questions are easier, some are really difficult.

    I would say that the most empirically approachable is: when was the design implemented? Given the type of inference we have defined here for design (inference from complex functional information) there is a simple procedure to identify the times of design: whenever we have appearance of new complex functional information, we can infer an act of design.

    From all the discussions we have had here, you can therefore understand that I believe that at least every time a new basic protein domain, or superfamily, appears in natural history, I infer design. Obviously, OOL and the appearance of eukaryotes, and the cambrian explosion are examples of huge inputs of new complex functional information in a relatively small window of time. But my approach is to infer design also for less amazing events, according to the procedure I have detailed.

    I would like to consider now the obvious problem: who is the designer and how does he design things?

    The only things which are really requested of the designer are:

    1) To be a conscious, intelligent, purposeful being. That is necessary because design always originates from conscious, meaningful, purposeful representations.

    2) To be able to output those representations to material objects.

    Note that in point 1 there is no implication that the biological designer must be God, or a god, or that he must be omnipotent, or good, or any other connotation. When I say that ID is scientific, and not religious, I really mean that.

    However, as I have said, our model of design is human design. Except for bizarre scenarios, which I will not consider, nobody really thinks that humans were the biological designers.

    The hypothesis of aliens, instead, is perfectly reasonable, and compatible with ID. I don’t like that hypothesis, and it has an obvious limit (does not explain the origin of the aliens), but it is a valid ID scenario. However, I will not deal with that, for the moment. It is not my scenario, and probably not yours.

    So, we are left with a simple question: what kind of conscious being can the biological designer be?

    I have always frankly admitted here at UD that the most reasonable hypothesis is: a conscious intelligent purposeful being who is not physical. That is the minimal credible requirement, because indeed if physical designers had been around throughout natural history, we would probably have some physical trace of that fact.

    What about conscious non physical beings? Well here is the central point of the ideological war that has been built around ID. Today’s culture is strongly biased in favor of a reductionist materialist worldview. I have nothing against that (everybody can choose the worldview he likes), but it is only a philosophical position: it cannot be the foundation for scientific inquiry. Instead, that specific worldview has become dogma, and is considered as the necessary standard for science. See, for example, the ad hoc concept of “methodological naturalism”.

    I reject that position. Science is the search for truth about empirical observations, and cannot be bound to a specific philosophy.

    Moreover, the reductionist materialist philosophy is recent, unsupported by specific facts, not shared by the majority of human beings, not shared by the majority of past thinkers, scientists, and philosophers. My point is: there is no reason to accept it simply because the scientific academy of the last few decades has made a religion out of it.

    I believe, like many others today and in the past, that consciousness is not generated by material configurations of matter, and is not necessary linked to the. IOWs, I completely reject the position usually called “strong AI theory”.

    More in next post.

  224. 224
    Piotr says:

    @Gpuccio:

    Re: superfamilies

    This is the definition of “superfamily” from Wikipedia:

    A protein superfamily is the largest grouping (clade) of proteins for which common ancestry can be inferred (see homology). Usually this common ancestry is based on structural alignment and mechanistic similarity even though no sequence similarity is evident.

    I wonder to what extent standard classifications stand up to the ideal declared in the first sentence. If two extremely well-conserved proteins have a similar structure and function, but the homology is not supported by the sequence analyses, convergence is at least a distinct possibility. If so, they are not really members of the same superfamily despite being “officially” regarded as such for classificatory convenience. It’s again a terminological question. If you demand that a superfamily should be a clade, sequential evidence should be decisive. Top be sure, the use of BLAST to disprove homology is risky (after all, homology doesn’t equal similarity); cladistic analyses taking into account other members of the putative superfamily would be necessary. I have no idea if they nave been conducted. If not, the classification must be taken with a grain of salt.

    (Linguists have similar problems too. Traditional classification of languages into families often confuse genetic groupings with typological or even geographical ones. We have a hard time sorting out the resulting confusion.)

  225. 225
    gpuccio says:

    Piotr:

    So, that was just a premise, to get to the point: let’s assume that non physical conscious beings can exist, that it is not correct to exclude them a priori, and that they could be considered as the designer(s) of biological information.

    Then, we can address the important question which you yourself suggested: how can a non physical conscious being design material things? Does he need magic?

    To answer that, let’s consider again our favorite model: human beings and human design.

    I have said that I reject strong AI theory. However, I have no reasons to impose my personal worldview. So, let’s try to remain empirical as much as possible. Let’s say that we accept consciousness and its representations as a fact, and we don’t try to explain it and them. We just accept that subjective representations exist, and that they are linked to the process of design.

    At the same time, we know that in humans subjective representations are linked to the physical world, in both senses: as perceptions of the outer world, and as actions which reach the outer world. Design is based on the second type of connection, but it certainly uses also the first type (as when we draw something that we are observing and therefore representing in our consciousness).

    Now, my point is: of we understand how our conscious representations are outputted to the material object in the process of human design, that can be a good model for biological design, at least as a starting point.

    That brings us to very old problems: the hard problem of consciousness (Chalmers), the problem of free will, and so on. Old stuff, important stuff.

    Now, I just want to express my model, without pretending to solve those problems (provided that you too don’t pretend to solve them). 🙂

    As I believe in free will, true libertarian free will, not the parody of compatibilism, I think that we must ask ourselves (as many have done): does the existence of free will violate mechanical deterministic laws?

    And the answer is: not necessarily.

    You may be aware of models of the mind-brain interface which are based on quantum mechanics.

    The idea is simple, and extremely similar to ID considerations.

    We know from physics that the universe must not be necessarily considered as wholly deterministic (unless you are a die hard Einsteinian). Quantum wave function collapse (at least in most interpretations of quantum mechanics) is a true example of intrinsic probabilistic realities. The probabilities in quantum mechanics are not just a way to describe deterministic systems with too many variables, like in conventional statistics. They are an intrinsic property of reality at that level.

    But quantum probabilities are random systems. They cannot generate order and functional information, as we have discussed.

    Unless they are guided. To achieve specific configurations (Abel’s “configurable switches”), according to conscious representations. Without violating deterministic laws (no magic, no miracle). Without apparently violating probabilistic laws (the functional result is the range of possibilities, after all), and at the same time strongly violating them (the functional result is so improbable that it would never happen without the guidance of the conscious being). This violation without violation, this miracle without miracles, is at the core of a quantum theory of the mind. It’s ID all the way.

    In humans, that would happen mainly in neuronal cells. Small quantum deviations from utter randomness can well explain guided neuronal function. The outputs of the mind to the brain are no more deterministic: they follow quantum patterns guided by consciousness.

    In biological design, the same thing may happen. The consciousness of the designer can interact with biological matter at quantum level, guiding events, like mutations, which are intrinsically random, and therefore are an optimal interface for conscious intervention.

    Why do you think that I am such a great fan of transposons, and of genes modeled by transposon activity?

    Well, I think that can be enough, for the moment.

  226. 226
    gpuccio says:

    Piotr at #224:

    I agree with you. The superfamily grouping is probably too large. Indeed, the SCOP definition explicitly acknowledges that, much more than the Wikipedia page:

    The different major levels in the hierarchy are:

    Family: Clear evolutionarily relationship
    Proteins clustered together into families are clearly evolutionarily related. Generally, this means that pairwise residue identities between the proteins are 30% and greater. However, in some cases similar functions and structures provide definitive evidence of common descent in the absense of high sequence identity; for example, many globins form a family though some members have sequence identities of only 15%.

    Superfamily: Probable common evolutionary origin
    Proteins that have low sequence identities, but whose structural and functional features suggest that a common evolutionary origin is probable are placed together in superfamilies. For example, actin, the ATPase domain of the heat shock protein, and hexakinase together form a superfamily.

    Fold: Major structural similarity
    Proteins are defined as having a common fold if they have the same major secondary structures in the same arrangement and with the same topological connections. Different proteins with the same fold often have peripheral elements of secondary structure and turn regions that differ in size and conformation. In some cases, these differing peripheral regions may comprise half the structure. Proteins placed together in the same fold category may not have a common evolutionary origin: the structural similarities could arise just from the physics and chemistry of proteins favoring certain packing arrangements and chain topologies.

    I use the superfamily concept just to be fair versus darwinists.

    The problem is that, if there is structural and functional similarity, one could always argue that sequence homology has been eroded in time by neutral variation. However, I cannot believe that in extreme cases like Rec A and the beta subunit of ATP synthase, because the homology is completely absent, while the two proteins are strongly conserved individually in time.

    So yes, in that case I would speak of design convergence. 🙂

  227. 227
    Dionisio says:

    gpuccio @ 223

    Science is the search for truth about empirical observations, and cannot be bound to a specific philosophy.

    Eccellente!!! Mile grazie.

  228. 228
    bornagain77 says:

    gpuccio, you may appreciate this:

    chart – This is the biosynthesis pathway for the 20 standard amino acids . They had to exist before LUCA was there. How could natural mechanisms explain the origin of amino acids, the building blocks of life ?
    http://genomebiology.com/2008/9/6/R95/figure/F1

    In the following video, Dr. Axe discusses his ‘conversion experience’ after studying the biosynthetic pathways necessary to make the tryptophan amino acid

    Nothing In Molecular Biology Is Gradual – Doug Axe PhD. – video
    http://www.metacafe.com/watch/5347797/

  229. 229
    gpuccio says:

    BA:

    A simple chart indeed! Thank you.

    It reminds me of a chart I used once for a presentation about cell cycle control and oncogenesis, which was about the c-myc transcription factor and its many interactions with other factors.

    The graph was so crowded that the authors had added the following comment:

    “Please, don’t discover any new interactions, because there is no more space left!” 🙂

  230. 230
    gpuccio says:

    Dionisio:

    Mille grazie a te per le gentili parole!

  231. 231
    Axel says:

    ‘….. Moreover, the reductionist materialist philosophy is recent, unsupported by specific facts, not shared by the majority of human beings, not shared by the majority of past thinkers, scientists, and philosophers. My point is: there is no reason to accept it simply because the scientific academy of the last few decades has made a religion out of it.’

    Moreover, vecchio*, in complete contrast to the yawning deficiencies in terms of supporting evidence of their reductionist assertions, and of RATIONAL THOUGHT on their part – of which they have the brass neck to posture as veritable paragons – the matter of irreducible complexity is simply unanswerable!

    It just makes no sense to me that scientists, ‘above all kites and crows’, should simply refuse to accept plain, scientifically and logically incontestable FACTS, instead, continuing to cling to their own conjectures and fantasies, irrespective even of whether they have been roundly, scientifically disproved.

    *vecchio’ is ‘old chap’ isn’t it?

  232. 232
    Axel says:

    Got ma trusty hammer with me still… looking for the next nail. A simulacrum* of a nail will do, of course!

    * Or ‘maquette’ if your scientific mindset demands it. But it just seems a bit ‘over the top’ to me for such a simple item!.

  233. 233
    gpuccio says:

    Axel:

    Well said, vecchio mio!

  234. 234
    Piotr says:

    Moreover, the reductionist materialist philosophy…

    Gpuccio, I know quite a number of evolutionary biologists (from Theodosius Dobzhansky, with his famous dictum, to Ken Miller) who somehow manage to reconcile their “non-reductionist” “non-materialist” religious worldview with doing science. The allegation that you have to be an atheist or a “reductionist materialist” (whatever all these -isms are supposed to mean in practice, except that you use them to label your “Darwinist” adversaries) to accept a scientific theory is bloody demagoguery. I thought you could do better than that. Like you, I live in one of the countries regarded as Roman Catholic strongholds. The only creationdesign proponentsists I meet here are the occasional Jehovah’s Witnesses — a recent import from the USA.

  235. 235
    gpuccio says:

    Piotr:

    I could not care less if one is religious or atheist. A lot of religious people are reductionists and materialists if you really ask them what they think about science. Scientism is as popular among religious people as it is among atheists. Ken Miller is a good example.

    Reductionist materialism means that one embraces the worldview that only matter (whatever it means) exists, or (if one is religious) that only matter can be considered by scientific knowledge, and religion is something completely separated.

    Scientism means the doctrine that science is the supreme (maybe the only) source of true knowledge.

    Methodological naturalism is the doctrine according to which science can only consider “natural” causes. As “natural” means essentially nothing, the final result is that “natural” is defined as “compatible with my present worldview, both philosophical and scientific”. That is the death of true science.

    All these positions are legitimate as personal worldviews. I don’t want to label anyone. As I said, I believe that personal worldviews are a choice, and they must be respected.

    What I don’t respect is that a personal worldview be used as the standard of science for all.

    I don’t know the situation in your country, but here I am practically the only design proponent that I know. And I have not been imported from the USA. 🙂

    Again, it is not a question of religion. ID is a scientific theory, and a very good one. Maybe many embrace it for religious reason. That is a pity, in a sense, because it deserves to be embraced for its scientific merits only.

    I would really like to see atheists embrace ID for its merits. While remaining atheists, if they like. Just as Ken Miller can remain religious, and yet embrace the inconsistency of darwinian dogma.

    As I have said many times, my religious convictions predate my passion for ID, and have never needed ID. They are strong on their own.

    My passion for ID is scientific, intellectual and moral. While it is perfectly compatible with my religious views, it is not motivated by them. Unless you consider love for truth a religious view.

  236. 236
    gpuccio says:

    Piotr:

    Moreover, I have given those philosophical considerations only as a premise to explain how and why the problem of consciousness matter interface, although in part philosophical, has definite scientific aspects and implications in scientific epistemology. That was done only to try to answer your request about my views on those issues.

    For the rest, you can see that I have tried to keep the discussion on a purely scientific plane. If someone has repeatedly referred to God, religion and religious implications, that was you.

  237. 237
    Upright BiPed says:

    Piotr,

    Here is what you say GP said:

    The allegation that you have to be an atheist or a “reductionist materialist” .. to accept a scientific theory is bloody demagoguery.

    – – – – – – – – – – – – – – – – –

    1. demagogue: a leader who makes use of popular prejudices and false claims and promises in order to gain power

    n. demagogue: A leader who obtains power by means of impassioned appeals to the emotions and prejudices of the populace.

    – – – – – – – – – – – – – – – – – –

    What GP actually said:

    Today’s culture is strongly biased in favor of a reductionist materialist worldview. I have nothing against that (everybody can choose the worldview he likes), but it is only a philosophical position: it cannot be the foundation for scientific inquiry. … Moreover, the reductionist materialist philosophy is recent, unsupported by specific facts, not shared by the majority of human beings, not shared by the majority of past thinkers, scientists, and philosophers. My point is: there is no reason to accept it simply because the scientific academy of the last few decades has made a religion out of it.

  238. 238
    Axel says:

    Troppo simpatico, Dottore! Ma e vero. N’est-ce pas? (rhetorical, veccio). (You’ll be relieved to hear I’m going to stop with the Italian, while (I hope) I’m ahead.

    Crazy as it sounds, Piotr, we Roman candles have been ‘on the back foot’ about the prevailing scientific/scientistic paradigm, since the Galileo affair.

    Those RC prelates and high churchmen don’t miss much, but as regards evolution, so all-pervasive and hegemonic has been the latter’s imposition by the multinationals, that that lacuna in their knowledge is almost certainly, imo, due to plain ignorance; as is certainly the case with many other very astute and otherwise knowledgeable people in the media, public life, etc.

    In the case of the RC intellectuals, indeed, part of the reason for their diffidence is precisely because most would surely prefer God to have used evolution. It would really be something, after all, for a child’s scooter to change into a bicycle, then a motorbike, then a car, so far from recoiling in horror, if they were modern youngsters, they would doubtless say, ‘THAT’S COOL!’ Or some similar daft, but wonderfully colourful formula.

  239. 239
    Piotr says:

    Gpuccio:

    That’s because although there are many religious evolutionists, I have yet to see a non-religious ID proponent. Also, the designer has so many divine attributes (unknown origin, activity over billions of years, invisibility combined with omnipresence and omnipotence) that is seems to me slightly disingenuous to pretend that you don’t mean God (or at least a god) when referring to “the designer”. But OK, I accept your explanation for the sake of argument. I’ll comment on the mind-matter “quantum interface” tomorrow.

  240. 240
    gpuccio says:

    Piotr:

    Believe me, I am not pretending anything. I have my ideas about the designer, but they are my ideas, they are based on my personal worldview, and I never discuss them here. I only discuss here what is empirically based, or what, although philosophical, has important epistemological implications in a scientific debate about the things we debate here. I am not pretending anything, I believe in that attitude, and I try to practice it.

    OK, let’s go to sleep.

  241. 241
    gpuccio says:

    UB and Axel:

    Thank you for your friendship.

  242. 242
    Piotr says:

    Methodological naturalism is the doctrine according to which science can only consider “natural” causes. As “natural” means essentially nothing, the final result is that “natural” is defined as “compatible with my present worldview, both philosophical and scientific”. That is the death of true science.

    I think it’s self-deception on your part. Scientists are open to philosophical and scientific worldview changes. They may resist new theories for various reasons, but evidence (if really incotrovertible, and inexplicable within the old framework) will eventually sway them. Can you imagine what it must have cost early 20th-century physicists to switch from classical mechanics plus ether theory to relativity? And before they recovered from the shock, they had to assimilate quantum mechanics. Evolutionary biology was likewise incompatible with most people’s philosophical and scientific worldview. If scientists resisted novelty just because of theoretical, philosophical or ideological bias, pre-Darwin creationsism would be well and kicking.

  243. 243
    gpuccio says:

    Piotr:

    My comments are not about scientists in general, or science at all times. I love scientists, and I love science.

    My comments are about a specific cultural situation which has been established about 50 – 60 years ago, with the advancement of the “modern synthesis” to the status of “absolute and indisputable truth” in biology, and of strong AI theory as “explanation of consciousness” in general thought.

    My comments refer to the cultural academy of the last decades, and only to that. The bias in scientific academy in this period is not a bias of science, it is a bias of men.

    One important difference with past situations is that now it is exactly the scientific academy which has the role of “priest class” and of holder of absolute truth. IOWs, scientism is the new religion of our era. And methodological naturalism is its tool.

    Just think of the definition itself of “methodological naturalism”.

    From RationalWiki:

    Methodological naturalism is the label for the required assumption of philosophical naturalism when working with the scientific method. Methodological naturalists limit their scientific research to the study of natural causes, because any attempts to define causal relationships with the supernatural are never fruitful, and result in the creation of scientific “dead ends” and God of the gaps-type hypotheses. To avoid these traps scientists assume that all causes are empirical and naturalistic; which means they can be measured, quantified and studied methodically.
    However, this assumption of naturalism need not extend beyond an assumption of methodology. This is what separates methodological naturalism from philosophical naturalism – the former is merely a tool and makes no truth claim; while the latter makes the philosophical – essentially atheistic – claim that only natural causes exist.

    Now, please note (as a linguist) the ambiguity in words.

    “Nature” and “natural causes” are never defined.

    Obviously, “natural” is one of those words which have no definite meaning. What is nature? What is natural? Is human consciousness “natural”? If non physical beings exist, are they “natural”? If one god, or many gods, exist, is he (are they) natural? What distinguishes existing things or beings in natural and supernatural? Note that, according to the second paragraph, in methodological naturalism there is no assumption at all that “only natural causes exist”. So, if non natural causes can exist, how do you generate the partition? And, if non natural causes can exist, why shouldn’t science be interested in their effects? And so on.

    Then in the following statement:

    “To avoid these traps scientists assume that all causes are empirical and naturalistic;” (emphasis mine)

    The word “empirical” suddenly appears, together with “naturalistic” as though they mean the same thing.

    Wait a moment! We were not discussing “methodological empiricism”!, and “empirical” and “naturalistic” do not mean the same thing. Not at all.

    From Dictionary.com:

    “Empirical: derived from or guided by experience or experiment.”

    “Naturalistic: imitating nature or the usual natural surroundings.”

    I have taken the first meaning for both. Note the vague definition for naturalisitc (the other two definitions are no better), and the precise meaning of “empirical”: “guided by experience”.

    Note also the ambiguity of the final statement:

    “which means they can be measured, quantified and studied methodically”

    First of all, it is not clear if that is the meaning of “empirical”, of “naturalistic” or both. Second, to be measured, to be quantified and to be studied methodically are not the same things. In particular, “studied methodically” has not the same meaning as “measured”.

    So, you may think that my ideas on these things are “self-deception on my part”. I don’t.

    But obviously, being self-deceived, I wouldn’t. 🙂

  244. 244
    Piotr says:

    Gpuccio:

    My comments refer to the cultural academy of the last decades, and only to that. The bias in scientific academy in this period is not a bias of science, it is a bias of men.

    And women too. You won’t be going places, young man, if you ignore women.

    As for the rest, I myself prefer the term “empirical” and “based on evidence”. Terms like “natural”, “naturalistic” and “materialistic” have an antiquarian flavour and are practically devoid of meaning. In the light of modern physics words like “matter” no longer have a clear formal interpretation. We continue using them for convenience, more or less informally, but you can’t build a philosophical system on vague pronouncements like “matter is all that exists”.

    That’s why I don’t care for being called a “materialist” or a “methodological naturalist”. In disputes, such terms are used more often as condemnatory labels than as accurate descriptions of someone’s actual philosophical stance. I don’t mind being called an “atheist” because I don’t “believe” in god(s) (by believe I mean ‘accept for cultural reasons whatever the evidence’). I find the evidence for god(s) unconvincing not because she/he/it/they are “supernatural” or “non-material”, but because the evidence itself is not compelling by scientific standards. I do subscribe to a mild version of scientism. I accept that science is the best method of collecting reliable and objectively communicable knowledge about reality.

    I suppose we largely agree about these things.

  245. 245
    gpuccio says:

    Piotr:

    Yes. Except for a couple of things:

    a) I don’t ignore women. But here in Italy we are usually not so fastidious about using “man” to mean “human”.

    b) I am not so young 🙂

    Regarding the evidence for the existence of God, it can be debated. I think there is great evidence, but much of it is not “scientific” in the strict sense. And I agree that believing in God is in the end a personal choice, and a personal experience.

  246. 246
    Upright BiPed says:

    …but because the evidence itself is not compelling by scientific standards.

    😐

  247. 247
    Dionisio says:

    gpuccio @ 245

    But here in Italy we are usually not so fastidious about using “man” to mean “human”.

    Apparently his country has been historically a so called matriarchal society, therefore men have to be careful not to say anything that women could misinterpret and disagree. There women lead and men follow. I’ve seen women telling their husbands or brothers to shut up and keep quiet. Really sad.
    Perhaps that’s why he wrote @ 244:

    And women too. You won’t be going places, young man, if you ignore women.

    Thank God that seems to be changing as younger generations come along 😉

  248. 248
    Dionisio says:

    Piotr @ 234

    The only creation design proponentsists I meet here are the occasional Jehovah’s Witnesses — a recent import from the USA.

    proponentsists? can we assume you meant proponents?

  249. 249
    Dionisio says:

    Piotr @ 234

    The only creation design proponentsists I meet here are the occasional Jehovah’s Witnesses — a recent import from the USA.

    Apparently you’re not aware of what’s going on in your own country?

    Christians (including RC, but not only) are the most active proponents of creation in your country. [BTW, JWs are not Christians. That’s a cult.]

    You may look at this blog by Polish Creation proponents in your own language:
    http://creationism.org.pl/artykuly/TJarosz

    Also, you may want to review the content of the ‘TZ Polski’ link within http://tzadarmo.wordpress.com

    Enjoy it!

  250. 250
    Piotr says:

    Dionisio:

    Has it escaped your attention that the “News” section on the Polish Creationist Society page you have linked to has rather old news (the most recent entry is from September 2010)? The website is as dead as the dodo, and so is the organised creationist/ID movement in these parts. I have no idea who Tomasz Zadarmo is, but I can see that nobody’s commenting on that blog.

  251. 251
    Piotr says:

    proponentsists? can we assume you meant proponents?

    Google up “cdesign proponentsists” if you’ve never seen this phrase before.

  252. 252
    Dionisio says:

    Piotr @ 244

    I accept that science is the best method of collecting reliable and objectively communicable knowledge about reality.

    Is that a scientific affirmation? Does the term ‘reality’ include whatever is beyond this universe?

    That seems like a philosophical statement, doesn’t it?

    The whole discussion boils down to a confrontation between two opposite irreconcilable worldviews. On one side stand those who believe the ultimate reality is matter and energy represented by the universe or its recent multi variant. On the opposite side stand those who believe that the ultimate reality is non-material transcendent intelligence as the first cause of the universe or its multi valiant. Since there’s no apparent reconciliation between those two positions, this discussion becomes senseless at some point. Perhaps this particular thread has reached that state.

  253. 253
    Piotr says:

    Gpuccio, @225

    A preamble:

    You may be aware of models of the mind-brain interface which are based on quantum mechanics.

    I am aware of Roger Penrose’s ideas about “the quantum mind”. With all due respect to Sir Roger, whose work I admire, I don’t think this particular idea is very helpful. As originally presented by Penrose, it wasn’t a specific model, by the way, and attempts to turn it into a testable biological model, with Stuart Hameroff’s help (things supposedly going on in microtubules), have not been very successful so far.

    Anyway, Penrose can’t be described as a mind/physics dualist. Consciousness, according to him, is a quantum phenomenon. It isn’t “material” (in the classical sense) but it is physical. In particular, his idea does not allow consciousness to exist without a physical substrate, independently of other stuff that makes up the universe. Quantum computations won’t do themselves without a quantum computer.

    We know from physics that the universe must not be necessarily considered as wholly deterministic (unless you are a die hard Einsteinian). Quantum wave function collapse (at least in most interpretations of quantum mechanics) is a true example of intrinsic probabilistic realities. The probabilities in quantum mechanics are not just a way to describe deterministic systems with too many variables, like in conventional statistics. They are an intrinsic property of reality at that level.

    Before you ask, I’m not a fan of any interpretation of quantum mechanics which assigns a special role to a conscious observer in reducing indeterminacies to a single possibility. More generally, I would argue that the dichotomy “indeterministic quantum reality” versus “deterministic classical reality” (with wave function collapse creating the latter) is a false one. There are, for example, no “quantum electrons” as opposed to “localised electrons” produced by the act of observation. Far from being a fundamental physical process, collapse is an apparent effect of decoherence.

    I can develop these thoughts and provide some basic references on demand, but I hope that even without a detailed justification you can see what my general position is.

  254. 254
    Piotr says:

    Is that a scientific affirmation? Does the term ‘reality’ include whatever is beyond this universe?

    Human language has its limitations. I said “reality” (rather than “this universe”) in the sense ‘anything we can learn about’. There may be other universes, and we may find a way to learn something about them indirectly, without being able to observe them. That would make them “real” too.

  255. 255
    Dionisio says:

    Piotr @ 250

    I have no idea who Tomasz Zadarmo is, but I can see that nobody’s commenting on that blog.

    In the ‘About’ page, the author of that blog wrote that his main purpose for his blog is bookmarking interesting articles, i.e. to save the links to online material he might want to use later. At least that’s what I understood. Here’s the ‘About’ section of that blog:

    http://tomaszzadarmo.wordpress.com/about/

    Apparently the guy left the comment option still open for himself to write his own comments next to the links at a later time. But maybe that was not the intent. Bottom line, the blog is not intended for commenting, as it is done in most blogs out there. Notice that the guy does not seem to write anything of his own inspiration, but simply links to other sources of information. I admit that I had not seen this kind of use for a blog before. But that’s fine with me.

  256. 256
    Dionisio says:

    Piotr @ 254

    Human language has its limitations. I said “reality” (rather than “this universe”) in the sense ‘anything we can learn about’. There may be other universes, and we may find a way to learn something about them indirectly, without being able to observe them. That would make them “real” too.

    The terms ‘reality’ and ‘this universe’ are quite different. Wouldn’t reality include anything that might be beyond this universe of beyond its ‘multi’ variants? Would science be able to research that transcendent ‘whatever’ using the scientific method that includes observation of the evidence in order to confirm and prove any hypothesis or theory?

    Since you said you’re an expert in linguistics at the main university in Poznan, you could have done much better than that, couldn’t you?

    I’m not an expert in linguistics and English is not my first language. Actually, I’m not an expert on anything.

    I have good news for you. Even though you deny or reject God, He loves you. I know it because I know He loves me, and I’m much worse than you are.

  257. 257
    Dionisio says:

    Piotr,

    your discussion with GP has turned philosophical, because you have introduced unscientific terms in your comments (allusions to religions, etc.). Stick to the subject. Stay away from non-scientific terms. BTW, intelligent design is not divorced from science. If you say so, then many engineers and computer scientists would tell you the opposite. Think about it. They claim to use their intelligence to design the stuff we use later for our convenience.
    When someone asks a purely scientific question, about a particular GRN, or signaling pathway, or genotype-phenotype association mechanisms, or cell fate determination mechanisms, or as it was in my case, where I asked you to help me to contact some biologist researchers at your university, so that I could get some links to materials explaining the mechanisms associated with the spindle apparatus that operates during intrinsic asymmetric cell division, you quickly responded that you could not help, because you are not a biologist or biochemist. But don’t you know anyone in your university that could respond my questions? Where have the real scientists gone to? 😉
    I have don’t much google searching already, and plan to keep doing it (binging it too). But direct suggestions from specialists are always helpful. So I encourage you to ask your colleagues in the university and see if they know a researcher in a biology-related department.
    Don’t forget my ‘zaproszenie na herbate albo kawe’ next time you go to Gdansk. Then we could chat directly po polsku.
    Serdecznie pozdrawiam.

  258. 258
    gpuccio says:

    Piotr:

    a) About Penrose:

    I admire his work too. Especially his demonstration of the non algorithmic nature of conscious knowledge, starting from the Godel theorem.

    However, I agree with you that his attempts to build a “positive” model have great limitations, and the reason is exactly that he tries to stick to a “physical” view of reality. I am not sure that I am a dualist in the conventional sense, but I do believe that we have to consider consciousness as a separate empirical thing, and that it is impossible to explain it in terms of configurations of matter, even by quantum models.

    But Penrose is not the only theorist of quantum interaction between mind and brain. I was thinking more of Eccles and similar.

    b) You say:

    Before you ask, I’m not a fan of any interpretation of quantum mechanics which assigns a special role to a conscious observer in reducing indeterminacies to a single possibility. More generally, I would argue that the dichotomy “indeterministic quantum reality” versus “deterministic classical reality” (with wave function collapse creating the latter) is a false one. There are, for example, no “quantum electrons” as opposed to “localised electrons” produced by the act of observation. Far from being a fundamental physical process, collapse is an apparent effect of decoherence.

    I am not a fan of those interpretations too. I don’t think that the collapse of the wave function is determined by conscious observation. But I believe that it is real, and not “an apparent effect of decoherence”.

    Without the collapse, or however you want to call it, QM would just be another form of deterministic description of reality, essentially not different from traditional mechanics. Why? Because the evolution of the wave function is strictly deterministic.

    It’s only when we take into consideration the collapse, and interpret the wave function as a function of probability for the results of the collapse itself, that the whole theory is no more strictly deterministic.

    The collapse, however, happens in the most diverse contexts, and as far as I can understand we still have no idea of why it happens.

    What I believe is not that consciousness determines the collapse, but that consciousness, in particular settings, can guide the collapse, transforming events that should be completely probabilistics in events that are apparently probabilistic, but conform in reality to a function or meaning willed by the consciousness itself.

    IOWs, something like that (from the Wikipedia page about “How the Self Controls Its Brain”, by John Eccles):

    Eccles called the fundamental neural units of the cerebral cortex “dendrons”, which are cylindrical bundles of neurons arranged vertically in the six outer layers or laminae of the cortex, each cylinder being about 60 micrometres in diameter. Eccles proposed that each of the 40 million dendrons is linked with a mental unit, or “psychon”, representing a unitary conscious experience. In willed actions and thought, psychons act on dendrons and, for a moment, increase the probability of the firing of selected neurons through quantum tunneling effect in synaptic exocytosis, while in perception the reverse process takes place.

    Now, I want to clarify that I don’t believe that Eccles, or anyone else, has a definite, detailed theory of the consciousness – brain interface. But I think that the correct solution is in that direction.

    That allows for an empirical approach to consciousness and brain (both empirically considered and respected), and their interactions. With space enough for models including libertarian free will without any violation of the known laws of physics.

  259. 259
    gpuccio says:

    Piotr:

    However, Dionisio is right. You had asked about my ideas on how the designer acts on material things, and I have answered giving you my ideas about the consciousness brain interaction (and therefore also the designer – biological matter interaction, which IMO is nased on the same principles).

    That is interesting, but the biological issues we debated before that are interesting too. Let’s remember that.

  260. 260
    Dionisio says:

    Dionisio @ 257

    I have don’t much google searching already,…

    Oops! Sorry, I meant

    I have done much google searching already,…

    Mea culpa 🙁

  261. 261
    Piotr says:

    Gpuccio:

    Some of the same topics (gene duplication + subfunctionalisation) have come up in your discussion with Nick Matzke in another thread. Nick knows a helluvalot more about these things, and I don’t want to duplicate that discussion, so I’ll suspended my participation for the moment. I haven’t forgotten, though.

  262. 262
    Dionisio says:

    Piotr, This Polish scientist apparently is against neo-Darwinian RV+NS theory, though he may not be an ID proponent. Perhaps he is closer to the position of the guy who is the head of the NIH in the USA, some kind of TE or something like that, but definitely they don’t seem to buy the RV+NS story. So here you have a respected Polish scientist from the famous university in Krakow, who does not seem to agree with the Britton who wrote the scandalous extrapolation story based on the adaptation of the Galapagos finch:

    Biologia komórkowa i molekularna nauk? XXI wieku

    BTW, I got this link from the TZ Polski link within the Tomasz Zadarmo bookmarking blog. Maybe there are more cool stuffs in the same TZ Polski link?

  263. 263
    Piotr says:

    Dionisio:

    So here you have a respected Polish scientist from the famous university in Krakow, who does not seem to agree with the Britton who wrote the scandalous extrapolation story based on the adaptation of the Galapagos finch.

    I haven’t heard of Korohoda before. He does seem to be a respected retired embryologist and cytobiologist. As far as I can see, he hasn’t published anything on evolution, so I assume that he’s presenting his private views to a more-or-less lay audience. Judging from the presentation, he’s a Lamarckist of sorts, skightly obsessed with “epigenetic self-reprogramming” as a major evolutionary force — eccentric, but not exactly ID.

    To save you the trouble of googling up furter examples, there’s also a retired professor of dendrology (and ultraconservative politician) called Maciej Giertych, who is a genuine young-Earth creationist. A few years ago, when he was a Polish member of the European Parliament, he made a show of himself by organising YEC seminars in Brussels. You must have heard of him. So there’s one YEC with scientific credentials. Do you realise how many biologists there are in Poland? Find me one who thinks Giertych is right.

    You should know even from discussions on this blog that modern biologists don’t worship Darwin and of course disagree with many of his ideas. Darwin has to be given due credit for his pioneering work, but he was demonstrably wrong about many important features of evolution. It would be foolish to blame him: he worked with very limited evidence, had no great predecessors to stand on their shoulders, and didn’t even live to witness the birth of genetics, let alone pop gen. Anyway, The Origins is not the biologists’ bible.

  264. 264
    Dionisio says:

    Piotr,

    Thank you for the additional information you wrote.

    I think that OOL theories and discussions are not scientific per se because they can’t be completely tested with observations.

    I’m more interested in the detailed description of the known biological systems. They are fascinating and complex enough to keep busy many honest dedicated scientists all over the world. Fortunately most scientists don’t care much about this OOL debate, because they’re too busy trying to get their difficult research work done. Science should stay away from the philosophical discussion on OOL.

    These days we can find engineers and computer scientists working along with biologists and biochemists on research projects. In another thread I mentioned two examples of engineers and computer scientists who lead biology research teams at Stanford University (a lady who is electrical engineer) and University of Florida (an Italian gentleman who is a computer scientist).

    I’m not a scientist. I work on a software development project.

    The data coming out of research labs is answering some outstanding questions, but also raising new questions. Almost like a never-ending story. The deeper they dig, the more fascinating the picture looks.

  265. 265
    Dionisio says:

    Piotr,

    Your and my interpretations of the information we read are biased, because they’re affected by our different worldviews. That’s why the OOL discussion can easily turn philosophical and lead no where. We should look objectively at the data and make our unbiased conclusions based on the evidences we see. In the areas we still don’t understand, we should not rush to premature conclusions.

  266. 266
    Dionisio says:

    Piotr,

    You should know even from discussions on this blog that modern biologists don’t worship Darwin and of course disagree with many of his ideas. Darwin has to be given due credit for his pioneering work, but he was demonstrably wrong about many important features of evolution. It would be foolish to blame him: he worked with very limited evidence, had no great predecessors to stand on their shoulders, and didn’t even live to witness the birth of genetics, let alone pop gen. Anyway, The Origins is not the biologists’ bible.

    However, despite all that, most textbooks out there don’t reveal what you just wrote. They still present the Darwinian RV+NS formula as the proven magic creator of all the plants and animals. Does that make sense to you? Not to me. That attitude has only discredited science in the eyes of many. Perhaps that’s why the ongoing heated debate seems to get louder everyday.

  267. 267
    gpuccio says:

    Dionisio:

    There is no necessity to have doubts about the unchanged status of neo darwinism (RV + NS) as the central dogma of scientific academy, from Dawkins to Coyne to Matzke. It’s enough to read Matzke’summary here:

    http://www.uncommondescent.com.....questions/

    at posts 29-34.

    And, if you want, my summary of his ideas at post 56 in the same thread, and his comment again at post 63 (with some backpedaling at 65). And my final request of some scientific support to his statements, at posts 69 – 70, so that we may discuss facts.

    Piotr is aware of the exchange, as from his post #261 here. And it seems he is waiting for further contributions from Matzke, who “knows a helluvalot more about these things”.

    I am waiting, too.

  268. 268
    gpuccio says:

    Dionisio (and Piotr):

    Scientists like Moran (and maybe Myers) have tried to present themselves as different, in some way, from the neo darwinian orthodoxy, but the whole discussion originated by VJ here, and Moran’s contributions to it, show well how ambiguous and vague this “difference” is, when really tested by definite requests. In the end, as I have said here, RV + NS is still the only game in town. If one excludes design.

    There are, obviously, true substantal “dissenters”. there have been in the past, too. Gould, and Kimura, and McClintock. There are now. Shapiro, Pigliucci, and many others. Each of them has brought interesting contributions, and the scenario is more varied for that.

    But, in most cases, the commitment to a “naturalistic” (which, in this context, just means “non design”) explanation makes their novelty extremely vulnerable: the old strong story of RV + NS is always there, ready to include and digest and neutralize all other points of views, and remains the only game in town.

    Because it is. Dawkins is completely right, IMO, about that. If design is excluded a priori, RV + NS is really the only game in town. A very bad game, but the only one.

    Neutralism, epigenetics, engines of variation, and all the other finesses of what I often call “neo neo darwinism” are not even a game. They don’t even start to try to explain anything.

  269. 269
    Piotr says:

    Dionisio:

    They still present the Darwinian RV+NS formula as the proven magic creator of all the plants and animals. Does that make sense to you?

    Probably because natural selection is the most important mechanism of adaptive change, and adaptations look so cool. They are didactically attractive. For a similar reason popular books about paleontology used to be mostly about dinosaurs (and not just any old dinosaurs but the big weirdos chasing each other across Jurassic plains). Who doesn’t adore dinos?

    Neutral (or rather nearly neutral) evolution is (1) harder to understand (you have to learn something about the mathematics of drift to appreciate its importance), (2) its effects look less impressive.

    Gpuccio:

    “neo neo darwinism”

    The discipline is being developed all the time, and you can expect more change in the future. How about calling it simply (modern) evolutionary biology rather than add more “neos” to “Darwinism”? After all, we don’t call modern quantum physics “neo-neo-Bohrism”.

  270. 270
    gpuccio says:

    Piotr:

    The neo neo thing intended to be ironic. It implied (in my mind) the idea that in those views everything seems to be different and new and fascinating and trendy, but in the end the old traditional “modern synthesis” always rules.

    I could also call it “new age darwinism”. 🙂

    But perhaps my wife is right: my jokes are funny only for me.

  271. 271
    Dionisio says:

    gpuccio,

    [off topic]

    But perhaps my wife is right: my jokes are funny only for me.

    Please, let you wife know that your jokes are funny to other readers of your comments as well. At least to those who are Spanish-speakers. But maybe that’s because we both share a common ancestor? I’m not too familiar with the origin of nationalities and cultures, but do the Spanish and Italian languages share a Common Descent? What is it?

    I remember they told me an Italian guy was hired by a Spanish queen to sail westward, and the Italiano discovered the Caribbean islands for the Spaniards. But I don’t recall the details.

    By the way, my family tree looks more like a balanced binary tree than the tree of life I’ve seen described in some articles lately. Also, my family tree does not keep changing shape and form, with branches switching places or suffering radical transformations, as I’ve seen sometimes happening with the tree of life. Why? Can’t they just set it and keep adding missing relative’s names, as we do with our family trees? I mean, we can draw our family tree, and leave empty boxes to be filled up with additional names or even sub-branches as the missing information is gathered later on. Can’t the do the same with the tree of life? Why not?
    Anyway, sorry for digressing so much from the original subject. Mea culpa 🙁
    P.S. I’m half Polish, that’s why I get along so well with Piotr too 😉

  272. 272
    gpuccio says:

    Dionisio:

    Your family tree is well mannered, that’s all! 🙂

    I think I too get along well enough with Piotr. Maybe Italians share a common ancestor with Polish too.

  273. 273
    Piotr says:

    There’s surely some horizontal transfer going on: my sister married an Italian and I have two nephews and a niece in Turin.

  274. 274
    Dionisio says:

    Piotr,

    Perhaps this recent news report will help you to finally convince our common friend GP that OOL is not as complex as he claims it is 😉

    http://www.trojmiasto.pl/wiado.....79519.html

    Now, given the tremendous popularity your discussion with GP has gained, I’m thinking about hosting a live debate on OOL between the two of you (in English), and then split the profits, 40% for you, 40% for GP, 10% for myself, 10% for the venue, which could be the Ergo Arena in Sopot. You may want to discuss the idea with GP and let me know if we should go for it. Then we have to determine a date. 😉

  275. 275
    Dionisio says:

    gpuccio @ 272

    “I think I too get along well enough with Piotr.”

    It’s obviously noticeable.

    “Maybe Italians share a common ancestor with Polish too.”

    Perhaps yes, they do. Check this out:
    http://en.wikipedia.org/wiki/Bona_Sforza

  276. 276
    Mung says:

    I think the relatedness can best be demonstrated by an examination of their sausages!

  277. 277
    Eric Anderson says:

    Piotr @269:

    Neutral (or rather nearly neutral) evolution is (1) harder to understand (you have to learn something about the mathematics of drift to appreciate its importance), (2) its effects look less impressive.

    Good point.

    Once we put real math into the equation the results appear a lot more modest. The same holds true with attempts to quantify natural selection’s capabilities (e.g., Behe’s Edge of Evolution). But given that most of the time the math is avoided and we are just dealing with cute just-so stories, then natural selection seems quite powerful indeed.

    Which leads back to one of my maxims:

    “The perception of evolutionary theory’s explanatory power is inversely proportional to the specificity of the discussion.” 🙂

  278. 278
    bonebone says:

    Hi gpuccio,

    Not sure if this thread is still exist. I notice a paper below use –log2(p) formula in calculating functional information, but p is estimated using Fisher’s exact test. I am not sure if it is used correctly. Can p-value from statistical test be used directly as the probability for functional information formula? If so, it leads to many alternative ways to calculate the p term in functional information.

    “DECODE: an integrated differential co-expression and differential expression analysis of gene expression data”, BMC Bioinfomratic 2015.
    http://www.biomedcentral.com/1471-2105/16/182

Leave a Reply