agit-prop, opinion manipulation and well-poisoning games biosemiotics Darwinist rhetorical tactics language Logic and First Principles of right reason

L&FP40: Language is . . . (as a foundation for understanding machine code and mathematical language as just that, linguistic)

Spread the love

It seems we need to clarify language. For, we see in the Ortho types thread:

EG, 140: >> . . . Definitions of language:

Webster’s: the words, their pronunciation, and the methods of combining them used and understood by a community.

Britannica: a system of conventional spoken, manual (signed), or written symbols by means of which human beings, as members of a social group and participants in its culture, express themselves.

Cambridge: a system of communication consisting of sounds, words, and grammar, or the system of communication used by people in a particular country or type of work.

Collins: A language is a system of communication which consists of a set of sounds and written symbols which are used by the people of a particular country or region for talking or writing.

I will keep looking but I can’t find a definition of language that would apply to DNA and how it works. So, my tentative conclusion at this time is that this is sloppy use of language.>>

For one, EG didn’t do a broad enough dictionary search at just first level:

KF, 166 (following UB at 141 etc): >>On how a dictionary can be used to set up and knock over a strawman:

language noun

[ . . . ]


Definition of language

1a : the words, their pronunciation, and the methods of combining them used and understood by a community studied the French language
b(1) : audible, articulate, meaningful sound as produced by the action of the vocal organs
(2) : a systematic means of communicating ideas or feelings by the use of conventionalized signs, sounds, gestures, or marks having understood meanings the language of mathematics
(3) : the suggestion by objects, actions, or conditions of associated ideas or feelings language in their very gesture— William Shakespeare
(4) : the means by which animals communicate the language of birds
(5) : a formal system of signs and symbols (such as FORTRAN or a calculus in logic) including rules for the formation and transformation of admissible expressions
(6) : machine language sense 1
[–> the protein code is an aspect of the GCAT machine language, which also has various regulatory functions]
2a : form or manner of verbal expression specifically : style the beauty of Shakespeare’s language
b : the vocabulary and phraseology belonging to an art or a department of knowledge the language of diplomacy medical language
c : profanity shouldn’t of blamed the fellers if they’d cut loose with some language— Ring Lardner
3 : the study of language especially as a school subject earned a grade of B in language
4 : specific words especially in a law or regulation The police were diligent in enforcing the language of the law.>>

That’s actually just a PS. The main discussion I wish to headline is:

KF, 165: >> . . . codes and alphanumerical digital symbol strings are linguistic, as are Chinese Character-like strings of stylised conventionalised, abstracted drawings, which go back to Cuneiform also.

[Insert, HT Wiki, Cuneiform’s development:]

Bringing in other River Valley Civilisation level pictographic and logographic systems:

Observe, here, that the different versions of Chinese — e.g. Mandarin vs Cantonese — pronounce the symbols differently but they carry the same meaning, even as 1, 2, 3, 4, 5, 6, 7, 8, 9, 0 have common meanings but are pronounced differently in various languages. Where, place value notation then shifts the sense of 2 significantly in the different cases in say 2,222,222.222. The first, in context, is two millions of units, the last, 2 thousandths of the unit, 1. And, the forms vary, e.g. I remember Indian profs still using the tiny form of the 0 that comes from the home of the decimal numeral system, India.

Even alphabetic and partly alphabetic systems are representing sounds in temporal succession with strings of symbols in space *-*-*-*- . . . -* [many of which were originally stylised drawings as we see with “A” tracing to aleph, the ox . . . triangle head with horns].

Insert, as in:

Similarly in mathematics, conventional symbols represent concepts, e.g. the elongated form S– used up to C18 — for sum being used to represent integration and DELTA the symbol for change. Where the Greek capital SIGMA is also used for sum in a different but related sense. That is, language is an integral part of Mathematics, also. Think of plus, minus, equal sign etc also or e, i, pi, h as a conventional infinitesimal, x, y, z as often space-linked variables, sine, cos, exponential functions, gamma function and many other special functions etc. Add here, Periodic table symbols for elements, their electronic configurations, typical state, etc then for molecules then how GCAT becomes a system for the Genetic Code — note that word! — and how it works in the cell based on prong height, comparable to a Yale lock.

DNA is a string digital data structure which stores coded information in the specific sequence of bases, G/C/A/T, both for protein coding and for regulation/control

Ability to represent symbolically [and often to pronounce said symbols] is a key part of the structure and power of language-using intelligence that helps us to trace out lines of logical or creative thought.

Something is deeply, conceptually wrong in several objections above; they have a far too cramped view of what language phenomena are and are about. >>

So, language is not synonymous with natural language as spoken or written. The underlying concept is meaningful, coded, symbolic communication in accord with relevant protocols. Accordingly, layer-cake communication systems using codes . . .

which extend the general communication system architecture . . .

A communication system

and specifically apply (per Yockey) to protein synthesis . . .

Yockey’s analysis of protein synthesis as a code-based communication process

are expressions of language. Specifically, including machine language. END

F/N: As DS insists on seeing “well formed” expressions, here is a result from Wiki, on Human mitochondrial DNA:

Notice, overlapping valid codes. Observe the Blue code START and the red code STOP. Ability to interweave code is one of the highest grade adept arts in machine code programming.

23 Replies to “L&FP40: Language is . . . (as a foundation for understanding machine code and mathematical language as just that, linguistic)

  1. 1
    kairosfocus says:

    L&FP40: Language is . . . (as a foundation for understanding machine code and mathematical language as just that, linguistic)

  2. 2
    daveS says:

    Can we enumerate the complete set of well-formed sentences in this language? I assume that it’s an infinite set but that it has a finite description.

    OT: The great Jerry Stiller has passed. RIP

  3. 3
    kairosfocus says:

    DS, I assume, DNA language[s] which seem to be like an OS-extended machine code. Andrew Tanenbaum puts the OS down with Mac-code-Assembly Language in his layer-cake diagrams of machine stacks! The protein chaining can be readily characterised: start-load methionine, elongate 2 . . . n, STOP. Regulatory stuff is only now being partly figured out. Then there is the onward fold, agglomerate, augment and modify to work in the cell etc, which impose further constraints requiring the right programs for the right contexts. We are now looking at: how many Novels in English are possible? ANS: potentially infinite and all using a pretty finite set of alphanumeric symbols and linked conventions. Mix in S|V\O grammar and Kellogg type diagrams. Have you seen how complex a reasonable diagram for the child’s primer “See Spot run” is? Language is an astonishingly complex built in capability. KF

    PS: Passing noted, one of oh so many.

  4. 4
    daveS says:

    Thanks, KF, perhaps it’s not a simple task.

  5. 5
    kairosfocus says:

    DS, simple is far, far from a lot of reality. KF

  6. 6
    David P says:

    Thanks for posting this info as well as pointing out the weak arguments presented by materialists.
    Seems some have the intellectual honesty to admit the genetic code has linguistic properties while others choose to retreat to the realm of a dictionary in hopes of an easier adversary.

  7. 7
    bornagain77 says:

    This may, or may not, be of interest,

    Complex grammar of the genomic language – November 9, 2015
    Excerpt: The ‘grammar’ of the human genetic code is more complex than that of even the most intricately constructed spoken languages in the world. The findings explain why the human genome is so difficult to decipher –,,,
    ,,, in their recent study in Nature, the Taipale team examines the binding preferences of pairs of transcription factors, and systematically maps the compound DNA words they bind to.
    Their analysis reveals that the grammar of the genetic code is much more complex than that of even the most complex human languages. Instead of simply joining two words together by deleting a space, the individual words that are joined together in compound DNA words are altered, leading to a large number of completely new words.
    http://www.sciencedaily.com/re.....140252.htm

  8. 8
    Seversky says:

    The key question here is whether a language or code entails or embodies the unstated assumption that intelligent agency is required both to send and receive meaningful information using language or a code a a medium.

    To use a previous example, a computer could record an image of tree rings and send it as an image data file to another computer. The second computer could even be programmed to scan and measure the spacing of the rings and make predictions of the age of the tree, its varying growth rate over the years and even the climatic conditions it underwent during its life. But the computer could only perform that analysis on the basis of information provided by a human dendrochronologist. Only a human (or similar) conscious intelligence can abstract meaning from the data, only such an intelligence can be informed by it.

    This, in my view, is why ID/creationists are so keen to establish that the genetic code is actually a code or language rather than that the latter are just useful metaphors which help us understand how the genetic code works. In their view, it is a major step along the road to establishing that their intelligent designer and their God are one and the same. To pretend otherwise is, shall we say, dissembling.

  9. 9
    bornagain77 says:

    LOL “the unstated assumption that intelligent agency is required both to send and receive meaningful information using language or a code a a medium.”

    Your too much Seversky, seeing that the information is keeping you alive, do you think that would qualify as ‘meaningful information’ for you?

    LOL

  10. 10
    ET says:

    Again, trees are data recorders. And they are also living things. So it isn’t an example of nature producing a code.

    But that is moot as tree rings don’t fit the definition of a code.

  11. 11
    kairosfocus says:

    DP, thanks for thoughts, anything more? KF

  12. 12
    kairosfocus says:

    Sev, strawman again. The issue is the production of sufficiently complex functionally specific, coherent organisation and/or associated information. Where, a machine language, storage devices and execution machinery organised in accord with an architecture will easily surpass the 500 – 1,000 bit threshold for which it is maximally implausible that blind chance and/or necessity based searches can scan more than a negligible fraction of a relevant configuration space. Where, for such FSCO/I, on a base of trillions of observed cases, in every case where we can observe the cause it is intelligently directed configuration. So to project an assumption is a serious and willful misrepresentation in disregard of duty to truth. Further, you know or should know that the design inference explanatory filter does have two defaults: an entity or process is assumed to be blind chance and/or mechanical necessity UNLESS there is FSCO/I beyond the 500 – 1,000 bit threshold for cause seen as utterly implausible under the defaults. In this, design thinkers are happy to accept false negatives in order to be ever so reliable in inferring to the only empirically warranted cause of such FSCO/I, intelligently directed configuration. After years in and around UD, we have reason to expect better than the above from you. KF

  13. 13
    kairosfocus says:

    PS: I markup on points

    >>a computer could record an image of tree rings>>

    — only as functionally organised, provided with peripherals, programmed and powered up appropriately, all of which trace to design

    >> and send it as an image data file to another computer. >>

    — the protocols, codes, organisation and processes to so communicate are similarly designed.

    >>The second computer could even be programmed>>

    — by a designer

    >>to scan and measure the spacing of the rings>>

    — as programmed

    >> and make predictions of the age of the tree, its varying growth rate over the years and even the climatic conditions it underwent during its life.>>

    — all of which is programmed through designers

    >> But the computer could only perform that analysis on the basis of information provided by a human dendrochronologist.>>

    –the computer actually blindly executes programming constrained by GIGO

    >> Only a human (or similar) conscious intelligence>>

    — so, you acknowledge that we exemplify but do not inherently exhaust language using intelligence

    >>can abstract meaning from the data,>>

    — the tree provided only phenomena tracing to its causal processes that lead to rings. It is analysts and designers who have developed a model and programming to turn the phenomena into a time model and associated inferences.

    — your attempted counter example fails

    >> only such an intelligence can be informed by it.>>

    — true enough, directly or indirectly

  14. 14
    daveS says:

    KF,

    Further to my question at #2, can we at least give one or a few examples of well-formed sentences in this/these language(s)?

    It would be interesting to look at some specific cases.

  15. 15
    jawa says:

    Biology is just pure chemistry.
    There’s nothing in biology that can be compared to designed information-processing systems based on semiotics, Boolean logic and cybernetic principles.
    Biology is just chemistry and physics. That’s all.
    Here’s an example of how biological processes can be described solely as chemical processes.
    On three genetic repressilator topologies

    Novel mathematical models of three different repressilator topologies are introduced. As designable transcription factors have been shown to bind to DNA non-cooperatively, we have chosen models containing non-cooperative elements. The extended topologies involve three additional transcription regulatory elements—which can be easily implemented by synthetic biology—forming positive feedback loops. This increases the number of variables to six, and extends the complexity of the equations in the model. To perform our analysis we had to use combinations of modern symbolic algorithms of computer algebra systems Mathematica and Singular.

    Synthetic biology is one of the most rapidly developing fields of biology. Synthetic
    genetic circuits are of high interest due to their possible applications in
    biosensing, bioremediation, diagnostics, therapeutics, etc. Genetic oscillators
    are some of the most studied circuits due to their complexity and the possibility
    of many different topologies. Building synthetic genetic oscillators with
    controllable periods and amplitudes would be of great interest to the synthetic
    biology field as they could for example potentially be used for treatment of
    diseases related to the circadian cycle.

     
    The full text is available here

    🙂

  16. 16
    kairosfocus says:

    DS, This seems to be the core listed sequence for Insulin, DNA form:

    ATG GCC CTG TGG ATG CGC CTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTG
    1200
    ACCCAGCCGCAGCC
    TTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCT 1260
    ACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACC
    CGCCGGGAGGCAGAGG
    1320
    ACCTGCAGG . . .

    TGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTG
    2160
    CAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGT
    GGCATTGTGGAACAATGCTGTACC
    2220
    AGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAAC

    Source: http://www.lifesci.sussex.ac.u.....nsulin.pdf

    I add an overlap to OP.

    KF

  17. 17
    daveS says:

    Thanks, KF, a specific illustration is helpful.

  18. 18
    kairosfocus says:

    DS, okay. Note the significance of interwoven machine code as appended to OP above. That, is true high class, adept dark arts stuff. KF

  19. 19
    jawa says:

    It’s interesting  how they refer to their regulatory circuits as being “designed”, but claim that the complex regulatory circuits found in the biological systems are not “designed”?  Is that double standard or inconsistency?

    Polarized displacement by transcription activator-like effectors for regulatory circuits

    The interplay between DNA-binding proteins plays an important role in transcriptional regulation and could increase the precision and complexity of designed regulatory circuits.

  20. 20
    kairosfocus says:

    Jawa, ideological blindness, I think. I recall a book back in Uni, functional Design in Fishes. the title was not consciously ironic. KF

    PS: Found at Amazon https://www.amazon.com/Functional-Design-Fishes-McN-Alexander/dp/B004NP6SOK the hardback is $1.20 up and paper is $890 !

  21. 21
    jawa says:

    KF,
    Interesting information that you found about those “Functional Design Fishes”. Another example that words have relative meaning in this world, where OMG! is a normal expression of amazement for any silly thing out there. It’s so sad. Really depressing.

    Yes, I agree that’s ideological blindness, but that’s deeply sad to watch.
    Our Adonai was deeply sad looking at Jerusalem people being so spiritually blind and oblivious.

    BTW, been there, done that. Embarrassingly narrow-minded and stupid.
    It’s shameful just to remember that past.
    John Lennox recently wrote a very serious book “Determined to Believe?” that deals with a related -though more profound- issue: how is it that each of us has a different reaction -in timing and depth- to the exact same message?
    Why is it that all of us will have life experiences, but not many people will search for the meaning of those experiences and actually very few will fin their true meaning?
    The so-called “hard problem of consciousness” seems to get harder every day. 🙂

  22. 22
    kairosfocus says:

    Jawa, you raise serious questions. I will say, vexed questions drove me to worldviews issues in the end, thence philosophy generally. Such, is definitely an acquired taste; much as that for bitterish veggies. Bitter in controlled doses broadens other flavours, much like sour. I also learned from our Caribbean beach death-apples . . . they look like small apples and at first taste like them but then the caustic burning begins. I wonder how the hard lesson was learned originally? BTW there is a certain iguana that freely eats same. So, the manchineel is an exception to if natural and sweet, safe to eat. What sweet nanny goat mout run ‘im belly is a regional saying. KF

    PS: Yup, hard issues like consciousness are gateways to serious philosophy. As in the best definition thereof I saw is that phil is the dept of study that addresses hard questions. Hard, as there are no easy, sound answers. Hence, comparative difficulties as key method.

  23. 23
    kairosfocus says:

    Jawa, did you see the interwoven code example added to the OP, from Wiki? Do you notice, it does not register that interwoven DOUBLE functionally specific complex organisation and associated information is exponentially harder to do? That’s a signature of virtuosity in design if ever you wanted one. KF

Leave a Reply