Like Dracula it can’t really die, as it is culturally needed.* So it just keeps rising from the grave. Evidence is irrelevant.
In the context of giving apes human rights instead of protection, we read:
We share about 99% of our DNA with chimpanzees and it has been argued this makes ape experimenters 99% as bad as the Nazis. It has also been argued that the medical benefits obtained from experiments on chimpanzees have been minimal. The chances are that the advancement of medical research would suffer little if the apes were given new rights that protected them from these experimental procedures.
Most funding for chimp lab research in the United States was to end immediately in 2011, and the biggest problem is what to do with the chimps. The net effect, if not the intention, of giving apes rights they don’t understand and cannot use on their own will be to degrade civil liberties for humans. Just what civil liberties mean will be confused and confusing.
The above link from the The Telegraph is a remarkably stupid article, in a field with many close contenders.
For example, author Desmond Morris, who worked with a chimp, recounts:
When he was with us, the complexity of his brain never ceased to amaze me. There was one occasion when he caught a cold and could not appear on television. There were so many complaints from his fans that we obtained another small chimp to act as a stand-in. When Congo had recovered from his cold we decided to have both of them together on the next show. My assistant was standing by, holding one in each arm. Congo had been very friendly towards the new chimp, and we anticipated no trouble. Indeed, when I announced that Congo was about to appear, he leaned over towards the other little ape to kiss him. The newcomer protruded his lips for a friendly contact, whereupon Congo bit him hard and drew blood. The injured chimp started screaming and had to be rushed out of the room, leaving Congo as the sole star of the show. What is extraordinary about this incident is the timing of it. Congo waited until the crucial moment to dispose of his rival.
Aw, Morris, get out more.
I (O’Leary for News) have seen domestic kitties do exactly the same thing, and no one makes great claims for their intelligence, just their cunning in expressing spite.
(Yes, I have read Morris’s book about cats and found it superficial. Its redeeming feature is that they are, after all, only cats. His books on more intelligent creatures are more superficial.)
* Here is another dramatic example of the social use of off base 99% claims to facilitate nonsense. (Actual similarity figures are, obviously, much lower. See, for example, Genomics scientist Jeffrey Tompkins takes issue with BioLogos’ we are 98% chimpanzee claim, and Epigenetic differences between humans and chimps (vs. 98% similarity claims))
See also: Barry Arrington asks, “Here’s an interesting question. Would that same liberal judge extend habeas corpus rights to an eight pound human baby about to be chopped into pieces by an abortionist for the crime of not yet being born?” My answer is, of course, not:
Any horror or injustice that can legally be perpetrated on any human being advances progressive causes. So it is an advantage to the progressive that unborn children can legally be killed by dismemberment, or if born alive by some other method, left to die in the soiled utility closet. Just as it is an advantage if the law equates chimps and humans.
Does anyone remember Baby Doe of Bloomington, Indiana, legally starved to death in a hospital at the behest of his parents, because he had Down syndrome? (No, I thought not.)
In the progressive’s ideal world, the chimp is has civil rights and the human doesn’t. And that, folks, is the general direction, fast forward.
Wasn’t the current U.S. president the only legislator in the Illinois senate who the refused to endorse protection for children born alive from abortions.** Yet he was wildly popular (including among Christians who stressed that they were “really” pro life anyway). And Americans elected him twice as their head of state.
But civil liberties would appear to be a dying concept anyway. And if they are understood as being shared with non-rational beings, the concept will die faster.
** The situation is worse in Canada.
Follow UD News at Twitter!
It’s so hard to let go of this scientific myth becaue it sounds so persuasive!
What’s a little white lie matter as long as Darwin is being exalted and people are being influenced to follow him?
Why are people so offended by the prospect of being closely related to chimpanzees?
Does our occasional failure to uphold the rights of our fellow human beings prevent us from extending them to others? Rights are not somehow diluted by being extended to more individuals.
Isn’t the way we treat our fellow creatures a measure of how civilized we are? Everybody here is rejecting the claim that having “dominion” means that we have absolute authority over them. The alternative concept of “stewardship” implies a duty of care.
Seversky @ 2:
Why to miss the point. And you did miss the point, badly. Read the article again. Then come back and tell us why your comment at 2 is way off base. I know you can do it.
Seversky:
Why do people want to be closely related to chimps?
repost from ‘Apes Is People’ thread:
The original 99% error came from a King and Wilson paper in 1975
The supposed 99% similarity between chimps and humans, that King and Wilson originally came up with, has now been found to be a fallacious number. Although the estimated genetic similarity has been falling for a few years, fairly recently Jeffrey Tomkins did a comprehensive genomic comparison and arrived at a 70% figure for genetic similarity instead of a 99% figure:
Moreover, unexpected genetic similarity is found in radically different species, such as dolphins and kangaroos:
Thus genetic similarity is not as good of a benchmark for inferring relationships as Darwinists had presupposed.
Moreover, it is found that King and Wilson were correct in their hunch that genomic regulatory systems between chimps and humans would be found to be very different.
The regulatory regions of the genomes between chimps and humans are found to be ‘orders of magnitude’ different:
Moreover, if that was not bad enough for Darwinists, mutations to the developmental gene regulatory networks are found to be ‘always catastrophically bad’:
Thus, where Darwinists most need plasticity in the genome to be viable as a theory, (i.e. developmental Gene Regulatory Networks), is the place where mutations are found to be ‘always catastrophically bad’. Yet, it is exactly in this area of the genome (i.e. regulatory networks) where substantial, ‘orders of magnitude’, differences are found between even supposedly closely related species.
Needless to say, this is the exact opposite finding for what Darwinism would have predicted for what should have been found in the genome. If Darwinism were a normal science, instead of a faith based belief system for atheists, this finding would count as a solid falsification.
Moreover, anatomically we are now found to be closer to pigs than to chimps.
Now to be sure, the Darwinist who put forward the idea that a pig/chimp hybrid produced humans was roundly condemned by other Darwinists.
But the funny thing in all that condemnation from other Darwinists is that none of the other Darwinists who condemned his ‘heretical’ idea were able to refute his ‘pimp hybrid’ hypothesis with any real empirical evidence to the contrary:
Does anyone truly think that think that pigs, kangaroos, or dolphins, ought to be grouped anywhere near chimps as our next of kin on the imaginary cladograms of Darwinists? Thus, that pretty much renders these imaginary Darwinian cladograms useless as far as rigorous science is concerned.
Another place where ‘orders of magnitude’ differences are found between humans, chimps, (and all other animals), is in the ‘image of God’ that is uniquely inherent to man.
More interesting still, the three Rs, reading, writing, and arithmetic, i.e. the unique ability to process information inherent to man, are the very first things to be taught to children when they enter elementary school.
And yet it is this information processing, i.e. reading, writing, and arithmetic, that is found to be foundational to life itself:
As well, as if that was not ‘spooky’ enough, information, not material, is found to be foundational to the universe itself:
Finding both life, and the universe itself, to be ‘information theoretic’ in their basis, and finding humans, among all creatures on earth, to uniquely possess the ability to understand, communicate, and create information, is certainly very strong support for the Christian belief that we humans were made in the image of God. (As well as strong support for a ‘mechanism’ as to how prayers can be effective)
It is hard to imagine what a more convincing proof that we are made in the ‘image of God’ might look like.
I guess a more convincing proof could be if God became a man, died on a cross, and rose from the dead, so as to prove He was God. But who has ever heard of such a thing as God becoming a mere man so as to save us from death? 🙂
Verses and Music:
@2 Seversky
Rights ?
According to whom? Based on what?
Clearly Seversky wants apes and monkeys to be good citizens that pay their taxes and vote for the democratic far left.
@8 Andre
The questions @7 are serious.
The person who used that ‘R’ term in his comments should be able to answer those simple questions upon request.
These days words have lost their meaning. We hear expressions like ‘omg!’ or ‘amazing!’ or ‘absolutely!’ or ‘perfectly!’ within any context, hence there are no words left to use in real situations where we need to describe something that is really absolutely amazing. But this world doesn’t seem to care. Does it?
We ‘love’ anything theses days: chocolate, to go somewhere, to do something, or sometimes ‘love’ somebody too. What does it mean in each case? Is it the definition given in Luke 6:32 or John 3:16? The latter is ‘agape’. We can’t ‘agape’ chocolate. At least I don’t know how. I could say I like so much the taste of chocolate, i.e. I very much like what chocolate does to me.
Now, back to ‘Rights’: What rights? According to whom? Based on what?
In the first half of the 20th century, apparently many ‘civilized’ central Europeans, including some who ‘claimed’ to be Christians, believed they had the ‘right’ to do ‘krystalnacht’ and everything they did after that. What right? According to whom? Based on what?
What do you think?
Seversky
Rights are aligned with responsibilities. Rights are diluted when they’re extended without regard to responsibilities that follow. The right to freedom is not extended to people (murderers) who don’t want to act in accord with those rights.
So, rights are reciprocal. Animals cannot express that reciprocity.
Yes. But if we’re the ones that grant rights, we’re expressing our dominion. We can also limit rights based on limits in responsibilities. The owner of the company has more rights to decide its direction because he/she has more responsibility. He has greater responsibility for stewardship of assets.
True. I thought your comments on the problems with Scriptural interpretation were insightful and reasonable also, but yes anyway, it’s not a question of absolute authority with no responsibility for the creatures of earth, or of the earth itself.
Yes, true. Some ‘rights’ should and always have been extended to animals. There are animal cruelty laws — even though it can seem strange that those rights are granted by carnivores.
It’s a lot more strange from a Darwinian perspective where it’s all about undirected movements around fitness and reproductive advantage.
We have dominion/stewardship from a God-centered view. We reflect the care that God has for his creatures.
One of the reasons the 99% ‘myth’b won’t die is that it’s true. If you take a random stretch of human DNA and compare it to the equivalent sequence in a chimp then 98-99% of the bases will be identical (on average).
Anyone doubting this is welcome to putting me wrong, here is an entire database of raw sequencing data, including human and chimp sequencing:
http://www.ncbi.nlm.nih.gov/sr.....%5Borgn%5D
No wd400, no one has done a complete side-by-side comparison. So you aren’t even wrong.
WHat is the actual % difference between human and chimp DNA?
: “More than 6 percent of genes found in humans simply aren’t found in any form in chimpanzees. There are over fourteen hundred novel genes expressed in humans but not in chimps.”
Jerry Coyne – ardent and ‘angry’ neo-Darwinist – professor at the University of Chicago in the department of ecology and evolution for twenty years. He specializes in evolutionary genetics.
Finding Protein-Coding Genes through Human Polymorphisms – January 2013
Excerpt: We found 5,737 putative protein-coding genes that do not exist in the reference, whose protein-coding status is supported by homology to known proteins. On average 10% of these genes are located in the genomic regions devoid of annotated genes in 12 other catalogs. Our statistical analysis showed that these ORFs are unlikely to occur by chance.
http://www.plosone.org/article.....ne.0054210
Mechanisms and dynamics of orphan gene emergence in insect genomes – January 2013
Excerpt: Orphans are an enigmatic portion of the genome since their origin and function are mostly unknown and they typically make up 10 to 30% of all genes in a genome.
http://gbe.oxfordjournals.org/.....l.pdf+html
“However, with the advent of sequencing of full genomes, it became clear that approximately 20–40% of the identified genes could not be associated with a gene family that was known before. Such genes were originally called ‘orphan’ genes”
http://ccsb.dfci.harvard.edu/w.....S_2013.pdf
Guy Walks Into a Bar and Thinks He’s a Chimpanzee: The Unbearable Lightness of Chimp-Human Genome Similarity – Sternberg – 2009
Excerpt: One can seriously call into question the statement that human and chimp genomes are 99% identical. For one thing, it has been noted in the literature that the exact degree of identity between the two genomes is as yet unknown (Cohen, J., 2007. Relative differences: The myth of 1% Science 316: 1836.). ,,, In short, the figure of identity that one wants to use is dependent on various methodological factors.
http://www.evolutionnews.org/2.....think.html
The Chimp-Human 1% Difference: A Useful Lie – 06/29/2007
Excerpt: But truth be told, Wilson and King also noted that the 1% difference wasn’t the whole story. They predicted that there must be profound differences outside genes—they focused on gene regulation—to account for the anatomical and behavioral disparities between our knuckle-dragging cousins and us. Several recent studies have proven them perspicacious again, raising the question of whether the 1% truism should be retired.
“For many, many years, the 1% difference served us well because it was underappreciated how similar we were,” says Pascal Gagneux, a zoologist at UC San Diego. “Now it’s totally clear that it’s more a hindrance for understanding than a help.”,,,
This is a very disturbing article. We have basically caught the Darwinists in a bald lie that has hoodwinked the world for over 30 years. Gagneux says, “For many, many years, the 1% difference served us well” – stop right there! Who is “us”? Was it the millions of school children and laymen who were lied to? Was it the majority of people who believe God created mankind, suffering under an onslaught of lies told in the name of science? No! “Us” refers to the members of the Darwin Party,,,
http://creationsafaris.com/cre.....#20070629a
Chimp DNA Mutation Study—Selective Yet Surprising – Jeffrey Tomkins – August 16, 2014
Excerpt: It was initially noted by another group of evolutionary scientists that when comparing random chimp genomic sequence only “about two thirds could be unambiguously aligned to DNA sequences in humans”(2). In confirmation of this widely known, but seldom discussed, inconvenient fact among those evolutionists working in the field was a comprehensive study published in 2013 by this author (3). In that research, I compared each individual chimpanzee chromosome to human (piece-by-piece) and it was shown that the chimpanzee genome was only 70% similar on average to human, with only short regions being highly similar.
,,, 30% difference in their genomes—some 900,000,000 DNA letter differences.,,,
When the entire genomes are compared between humans and chimps, it becomes clear that they were each engineered uniquely and separately by an Omnipotent Creator.
http://www.designed-dna.org/bl.....c5-110.php
Geneticist Jeff Tomkins vs. Evolutionary Biologist who got laughed off stage – August 12, 2013
Excerpt: Tomkins described the origin of the fallacious comparison as a myth that got started in reassociation kinetic methods of comparison in the mid-1970’s prior to the advent of modern sequencing techniques (like Illumina and Solexa). Reassociation kinetics was a technique where fragments of chimp and human DNA were mixed in the same chemical soup, and the DNAs that were reasonably similar would pair up, hence we got a biased sampling!
If we take genes that are found in both humans and chimps and disregard the indels, we get the 98% figure. When indels are considered, the similarity drops to 80-85%!
When including other sequences, the similarity drops even further, down to 70%. But that 70% figure itself, imho, is too generous. I don’t think Tomkins used ORFans or pseudo genes or many other intergenic sequences, and he explicitly avoided the complication of Synteny….
Tomkins pointed also to reports where lab workers may have contaminated the sequencing labs for Chimps with their own human DNA and thus biasing the figures! Hence re-sequencing has been done, and there is more sequencing pending to clean up these errors. He joked about the coughing and sneezing that may have gone on to cause contamination.
http://www.uncommondescent.com.....off-stage/
Human and Chimp DNA–Nearly Identical? by Jeffrey Tomkins, Ph.D. – 2014
Excerpt: Major research published over the past decade comparing human and chimpanzee DNA was recently reviewed and critiqued.1 In every single publication, researchers only reported on the highly similar DNA sequence data and discarded the rest—apparently because it was too dissimilar. In fact, when the DNA similarities from these studies were recalculated using the omitted data, markedly lower levels—between 81 and 86 percent similarity—were found. Even the well-known chimpanzee genome paper published by evolutionists in 2005 provides a genomic similarity of only about 80 percent when the discarded nonsimilar data are included and only 70 percent when the estimated size of the chimpanzee genome is incorporated.2,3,,,
Not counting the Y-chromosome, the results of my comparison showed variability between 66 and 76 percent similarity for the different chimp chromosomes, with an overall genome average of only 70 percent similarity to human chromosomes. In reality, many chromosomal regions are vastly different between chimps and humans, and several areas of the genome that are present in chimps are completely absent in humans—and vice versa.
While it is true that there are sections of the chimp genome that are very similar to humans, this is not the complete picture. DNA sequence comparisons that include all the relevant data plainly show that the human and chimp genomes are not nearly identical at all. Instead, they are as distinct as one might expect based on the obvious differences in the resulting anatomies and behavioral capacities.
Hypothetical evolutionary processes cannot explain the extremely broad differences between chimp and human DNA when the whole genomes are considered. The similar regions between genomes are easily interpreted as the basic reuse of effective code—a concept very familiar to software engineers.,,,
http://www.icr.org/article/7892/
Human and Chimp DNA–Nearly Identical? by Jeffrey Tomkins, Ph.D. – 2014
Excerpt: Major research published over the past decade comparing human and chimpanzee DNA was recently reviewed and critiqued.1 In every single publication, researchers only reported on the highly similar DNA sequence data and discarded the rest—apparently because it was too dissimilar. In fact, when the DNA similarities from these studies were recalculated using the omitted data, markedly lower levels—between 81 and 86 percent similarity—were found. Even the well-known chimpanzee genome paper published by evolutionists in 2005 provides a genomic similarity of only about 80 percent when the discarded nonsimilar data are included and only 70 percent when the estimated size of the chimpanzee genome is incorporated.2,3,,,
Not counting the Y-chromosome, the results of my comparison showed variability between 66 and 76 percent similarity for the different chimp chromosomes, with an overall genome average of only 70 percent similarity to human chromosomes. In reality, many chromosomal regions are vastly different between chimps and humans, and several areas of the genome that are present in chimps are completely absent in humans—and vice versa.
While it is true that there are sections of the chimp genome that are very similar to humans, this is not the complete picture. DNA sequence comparisons that include all the relevant data plainly show that the human and chimp genomes are not nearly identical at all. Instead, they are as distinct as one might expect based on the obvious differences in the resulting anatomies and behavioral capacities.
Hypothetical evolutionary processes cannot explain the extremely broad differences between chimp and human DNA when the whole genomes are considered. The similar regions between genomes are easily interpreted as the basic reuse of effective code—a concept very familiar to software engineers.,,,
http://www.icr.org/article/7892/
Oh, I forgot to mention Tomkins.
His analyses are pretty seriously flawed. He doesn’t allow gaps in sequence so he’d call these two sequences …
ATATAGAATGATGCTAGCATCGTGATGTAG
ATATAGAATGATGCTAGCATGTGATGTAG
… which differ by one base 2/3rds identical. I think that’s pretty obviously wrong.
Again, the raw data is there, anyone who wants to can check for themselves.
Humans and chimps have 95 percent DNA compatibility, not 98.5 percent, research shows
Oh, but we can ignore that….
Dont’ ignore it Joe, but maybe read it. It’s ~99% identity when comparing like bases (the thing I desribed above), the ~95% numbers includes sequences missing in one or other species.
“which differ by one base 2/3rds identical. I think that’s pretty obviously wrong.”
What is ‘pretty obviously wrong’ is Darwinists trying to force fit the sequence data into their preconceived conclusion of common ancestry and ignoring all the other data that does not fit their preconceived conclusion.
Moreover, genetic sequences that won’t align to the Darwinian narrative are just the tip of the iceberg of problems for Darwinists.
For instance, here are few more problems:
“Any transition of form is pure fantasy. There is no demonstration of it.”
Douglas Axe – co-author of Science & Human Origins – video
http://www.youtube.com/watch?v=XxMmLakH2LQ
Thou Shalt Not Put Evolutionary Theory to a Test – Douglas Axe – July 18, 2012
Excerpt: “For example, McBride criticizes me for not mentioning genetic drift in my discussion of human origins, apparently without realizing that the result of Durrett and Schmidt rules drift out. Each and every specific genetic change needed to produce humans from apes would have to have conferred a significant selective advantage in order for humans to have appeared in the available time (i.e. the mutations cannot be ‘neutral’). Any aspect of the transition that requires two or more mutations to act in combination in order to increase fitness would take way too long (greater than 100 million years).
My challenge to McBride, and everyone else who believes the evolutionary story of human origins, is not to provide the list of mutations that did the trick, but rather a list of mutations that can do it. Otherwise they’re in the position of insisting that something is a scientific fact without having the faintest idea how it even could be.” Doug Axe PhD.
http://www.evolutionnews.org/2.....62351.html
More from Ann Gauger on why humans didn’t happen the way Darwin said – July 2012
Excerpt: Each of these new features probably required multiple mutations. Getting a feature that requires six neutral mutations is the limit of what bacteria can produce. For primates (e.g., monkeys, apes and humans) the limit is much more severe. Because of much smaller effective population sizes (an estimated ten thousand for humans instead of a billion for bacteria) and longer generation times (fifteen to twenty years per generation for humans vs. a thousand generations per year for bacteria), it would take a very long time for even a single beneficial mutation to appear and become fixed in a human population.
You don’t have to take my word for it. In 2007, Durrett and Schmidt estimated in the journal Genetics that for a single mutation to occur in a nucleotide-binding site and be fixed in a primate lineage would require a waiting time of six million years. The same authors later estimated it would take 216 million years for the binding site to acquire two mutations, if the first mutation was neutral in its effect.
Facing Facts
But six million years is the entire time allotted for the transition from our last common ancestor with chimps to us according to the standard evolutionary timescale. Two hundred and sixteen million years takes us back to the Triassic, when the very first mammals appeared. One or two mutations simply aren’t sufficient to produce the necessary changes— sixteen anatomical features—in the time available. At most, a new binding site might affect the regulation of one or two genes.
http://www.uncommondescent.com.....rwin-said/
Ask an Embryologist: Genomic Mosaicism – Jonathan Wells – February 23, 2015
Excerpt: humans have a “few thousand” different cell types. Here is my simple question: Does the DNA sequence in one cell type differ from the sequence in another cell type in the same person?,,,
The simple answer is: We now know that there is considerable variation in DNA sequences among tissues, and even among cells in the same tissue. It’s called genomic mosaicism.
In the early days of developmental genetics, some people thought that parts of the embryo became different from each other because they acquired different pieces of the DNA from the fertilized egg. That theory was abandoned,,,
,,,(then) “genomic equivalence” — the idea that all the cells of an organism (with a few exceptions, such as cells of the immune system) contain the same DNA — became the accepted view.
I taught genomic equivalence for many years. A few years ago, however, everything changed. With the development of more sophisticated techniques and the sampling of more tissues and cells, it became clear that genetic mosaicism is common.
I now know as an embryologist,,,Tissues and cells, as they differentiate, modify their DNA to suit their needs. It’s the organism controlling the DNA, not the DNA controlling the organism.
http://www.evolutionnews.org/2.....93851.html
Podcast – Richard Sternberg PhD – On Human Origins: Is Our Genome Full of Junk DNA? Part 5
(emphasis on ENCODE findings and the loss of the term ‘gene’ as a accurate description in biology and also how that loss undermines the modern synthesis of neo-Darwinism)
http://www.discovery.org/multi.....-dna-pt-5/
etc.. etc…
Then the 95% is a better value for indicating the difference.
Joe, ORFans by themselves exceed that 95% difference
DNA is way overrated as a way to understand the difference in Chimp vs Neanderthal or Sapien. Overrated and useless really. Same thing with Sapien versus Banana.
But DNA and DNA replication is a great example of Design. Unguided and Random and Ooops are becoming dustbinned very quickly. Exciting times. Science waking up.
https://m.youtube.com/watch?v=WFCvkkDSfIU
bornagain77 @ 5
Great remark and great citations. Thanks.
There is no One True Metric for genetic simlarity, if you prefer 95% that’s fine. But the 99% identity between like bases is not a “myth”, it’s there for everyone to see.
Maybe, but it remains the case that IDers and creationists twist themselves in knots to deny the 99% identity. Tomkins and his papers, BA and the absurd claim that orphan genes make up more than 5% of the human genome.
Why do you think people are so put out by sharing such similar DNA to chimps?
“Why do you think people are so put out by sharing such similar DNA to chimps?”
Because being called similiar to a Chimp is an insult? Same thing with Pig. PigChimp is kind of fun though.
Look, if DNA can’t explain the differences between Chimp & Man, why should it be assumed to show similarity? Irrational and illogical. Same with Universal Common Descent. Universal lol.
as to:
“BA and the absurd claim that orphan genes make up more than 5% of the human genome.”
And yet, as was already referenced, but was ignored by wd400, there is more than 5% ORFan genes in the human genome as even arch-militant atheist Jerry Coyne admits:
As to the fact that the 2% of DNA that codes for proteins (i.e. genes) is vastly overrated, well that fact is blatantly obvious. Even if Darwinists could account for the origination of new ORFan protein/genes, (or the transformation of existing protein into a similar protein of a different function), which they can’t explain by astronomical margins, the Darwinists still have not gone one inch of a thousand miles towards explaining the regulatory mechanisms that tell those proteins where, when, and how, to be used in an organism.
Talbott puts this vast void in Darwinian explanations for ‘form’, (i.e. body plans), like this:
The Darwinist’s lame argument is that the similarity between chimp and human DNA is evidence for Darwinism but not for ID. How lame. I don’t see that at all. I see it as a prime example of intelligent reuse in design.
Personally, I am delighted to be closely related to apes. Apes are magnificently designed creatures. So are we. But humans are much more advanced than apes because the human brain was designed to interface with the spirit realm. It was designed to serve as a receptacle for a spiritual entity. As Genesis put it, Yahweh framed the spirit of man within him. He did not do the same for apes and other animals.
PP,
I’m sorry you find the fact your DNA is so similar to a chimp’s offensive. I’m afraid your taking offense doesn’t make it any less true.
BA,
Coyne is wrong about the extend of orphans in the human genome. But even you take that quote on face value it does not say 6% of the genome is oprhan genes, but 6% of the genes. For 1600 genes to be ~6% of the genes Coyne must be talking about protein coding genes, which make about 2% of the genome.
So even taking Coyne’s old numbers, we end up with .02 * .06 = .0012 of the genome in orphans. A tenth of a percent, which I think even you will agree is not >5%.
You can avoid these embarrassing mistakes if yo bothered to learn a little biology, but I can’t imagine yo will.
wd400, you, the supposedly educated one, are the one embarrassing yourself against someone who is supposedly uneducated in these matters.
Coyne is, IMHO, underestimating the extent that ORFan genes are found,, as the papers I referenced under the Coyne quote make clear.
Moreover, I already noted that the protein coding regions only encompass approx. 2% of the genome. Yet you falsely said that I was considering the whole genome in the comparison.
Yet, if the entire genome is included, as you accused me of doing in my reference to ORFans, then, as you well know but are apparently too dishonest to admit, the percentage difference between chimps and humans greatly increases from your desired 99% mark which you are falsely claiming is true, apparently, for the entire genome now.
If you are not claiming that the entire genome is 99% similar then perhaps you need to rewrite what you wrote so as to not make it appear as if your are claiming 99% similarity for the entire genome?
Seversky:
I agree with Barry above that you have missed the article’s point. You seem to be reading too quickly. And that is not surprising. You seem to comment on column after column here, but never stay long on any one column long enough to have a sustained, back-and-forth discussion with anyone, a discussion where points and arguments are exchanged and people on both sides modify their views.
Your approach, for the most part, is scattershot. You toss in a drive-by comment, then move on to the next column which catches your interest, toss in another drive-by comment, move on again, etc. Most people who respond to you don’t get even a single reply to their responses. It’s as if you have what teachers for the past few years have been calling “ADD” — attention deficit disorder — and are unable to stay long at any one task, being too easily distracted by background activity in your environment. You would achieve more intellectual growth if you commented on fewer columns here, but engaged at length in those few places with your critics and questioners. Your current approach is unlikely to teach you anything. Certainly it does not teach anyone else here anything. Drive-by shots at the opinions of others, unsustained by argumentation, are worthless to a learning community.
Think about it, Seversky. Are you happy to be the village’s cranky old man, taking shots at everyone else’s position? Or do you wish to participate in the life of the village, by having genuine sustained dialogue with the village’s other members? Speaking for myself, at least, I don’t feel you’ve engaged my last four or five objections to your posts, and to me that makes your posts of little to no value. And I am inclined to think that someone who does not respond to reasoned objections to his comments cannot defend those comments; that is the most economical explanation of quick exits when challenges are given.
98-99% identity is for the whole genome. The idea that it applies only to protein coding genes really is truly a myth.
As I keep saying — the raw data is available. If I’m wrong it shouldn’t be hard to show it.
WD, no reason for you to be sorry. You asked why some people are “put off” and I gave you a reason. Are you truly sorry or were you just being snarky:(
pp,
I don’t won’t people to be offended, so of course I’m sorry when someone learns a fact about the world that upsets them. No snark there. But, as I say, whether you or anyone else takes offensive to something doesn’t make it more or less true.
Ok WD, I accept your apology.
The molecular machinery depicted in this Ted Talk is 100% Chimp and/or Human I presume?
https://m.youtube.com/watch?v=WFCvkkDSfIU
The “1%” difference is in the output of the common DNA replicator machine? That is so incredible. How about a Banana? Same machine?
wd400:
I’m one ID proponent who is not “offended” by genomic similarity to chimpanzees. Further, I find the responses of some ID proponents, e.g., that the similarity is not 99%, but only 94%, to be beside the point, which is that the similarity is very large. But why shouldn’t it be? Anyone can see by simple observation that chimpanzees are very similar in many ways to human beings, and one would expect that this similarity would be reflected in the genetic material (though of course the genes alone are not the only determinant of an organism’s properties).
I don’t see that the similarities in genomes has anything to do with the question of design in living systems. A sufficiently intelligent designer could employ many common design elements to create different overall results (e.g., as different computers can employ RAM, hard drives,etc. in similar ways), and such a designer could also devise an evolutionary program which was designed to generate new species from old. Thus, both “creationism” (e.g., Ross) and “evolutionism” (e.g., Denton) can be compatible with “design,” and ID has no built-in objection to references to chimp/human similarities, or even to speculations about historical relationships between chimps and humans; such relationships in themselves don’t threaten inferences of design.
I think the deeper objection to discussion of chimp-human comparisons is not at bottom genetic, but ethical or spiritual. The point is that, physical similarities notwithstanding, we are very different in crucial ways from chimpanzees and from all other creatures on the planet. Where Darwinian or other evolutionary theory is employed to blur these differences, or deny their existence, then the ethical or spiritual objections come into play.
Silly ideas about giving chimps legal rights are an example of this blurring. From what I’m told, cabbages (or is it bananas?) have 60% of the same genes as humans, so should they have 60% of the legal rights of humans? The arguments on this front are just plain stupid. Legal rights are not apportioned, and should not be apportioned, on the basis of information that can only be obtained with microscopes and complex scientific equipment. Chimpanzees are morally and politically irresponsible creatures, and even their greatest intellectual achievements are accomplished only when they are aided by human teaching and intervention. Chimpanzees *in nature* cannot employ symbolic language, for example; only with long training instigated by humans do they learn to manipulate symbols as humans do. And language in that sense is crucial for the moral/legal/social life typical of human beings. A person who cannot recognize the key macroscopic differences between a chimp and a human is a fool, even if he has a Ph.D. in comparative genomics and is celebrated in academic circles for his obscure technical articles. And it’s on the basis of macroscopic differences that legal and political rights are assigned.
Of course, this does not mean that we cannot or should not have laws restricting what we do to chimpanzees or other creatures. But to base those laws on a conception of “human rights” designed for fully rational, fully linguistic, fully moral creatures is idiotic. You of course do not torture an animal unnecessarily; but the reason for that is not that the animal has the “inalienable rights” guaranteed by the American constitution. “All men are created equal” does not mean “all creatures with X% or higher genomic similarity to man are created equal.” The Founders certainly knew the difference between an ape (back when “ape” was defined properly) and a man, and they had no intention whatsoever of granting constitutional rights to the former.
Good. I hope you can convince your fellow-travelers to stop embarrassing themselves on this topic.
I am not offended to share 50% DNA with bananas. I also respect pickle rights:
https://m.youtube.com/watch?v=3ob5sU0XRuk
If the 99% claim were correct, it would merely mean that genetics does not tell us very much about a life form.
Anyone can tell the difference between a chimpanzee and a human being.
I don’t care one way or the other, but prefer to think – for the present – that genetics is informative, and that the people quoting the lower figures are correct.
wd400, states:
and yet this was posted right before he stated that:
Willful blindness at its worse?
Tomkins comments on the severe bias of Darwinists here in omitting dissimilar data that does not agree with their preferred conclusion:
Moreover, the modern synthesis, which wd400 holds to be true, is found to be false (which is another fact that he will refuse to admit):
Of supplemental note: Here is a recent article by Tomkins which shows that the mechanism of Horizontal Gene Transfer does not even begin to explain the dissimilarity in genomes being found
WD400:
I think you should give the same advice to Darwinists such as yourself. The reason that some ID proponents resisted the chimp-human similarity is that you Darwinists love to use it as strong evidence for Darwinian evolution and common descent but not for ID. This is a lie, of course. It is also strong evidence for intelligent design.
It’s time for you to go back to school and learn a thing or two about intelligent design.
Here is another article on the bias of Darwinists in ‘filtering data’
Contradictory Trees: Evolution Goes 0 For 1,070 – Whif – Cornelius Hunter
Excerpt: One of evolution’s trade secrets is its prefiltering of data to make it look good, but now evolutionists are resorting to postfiltering of the data as well.,,,
Prefiltering is often thought of merely as cleaning up the data. But prefiltering is more than that, for built-in to the prefiltering steps is the theory of evolution. Prefiltering massages the data to favor the theory. The data are, as philosophers explain, theory-laden.
But even prefiltering cannot always help the theory.,,,
http://darwins-god.blogspot.co.....oes-0.html
Comprehensive Analysis of Chimpanzee and Human Chromosomes Reveals Average DNA Similarity of 70% by Jeffrey Tomkins on February 20, 2013
Excerpt: there is a great deal of preferential and selective treatment of the data being analyzed. In many cases, only the most promising data such as gene-rich sequences that exist in both species (homologs) is utilized from a much larger data pool. This pre-selected data is often further subjected to more filtering before being analyzed and discussed. Non-alignable regions and large gaps in DNA sequence alignments are also typically omitted, thus increasing the levels of reported similarity.
https://answersingenesis.org/answers/research-journal/v6/comprehensive-analysis-of-chimpanzee-and-human-chromosomes/
The Myth of 98% Genetic Similarity between Humans and Chimps – Jeffrey Tomkins PhD. – video
https://vimeo.com/95287522
News.
It’s ~99% identity whatever you may prefer to think. Nothing about that fact means genetics isn’t important. “Genetics”, after all, includes all the genetic sequences that control the timing and location of gene expression too.
BA,
If you keep reading rubbish like Luskin and Tomkins, you will keep being wrong about this topic. It seems you can’t be dissuaded form that, so, one more time I’ll repeat myself. The raw data underlying my claim is freely available, please prove me wrong if you can.
The importance of genetic similarities between species is that it tells us, when considered along with the fossil record, how fast DNA changes. When correlated with laboratory experiements (Douglas Axe et al.) and population genetics, population size, generation time, etc, we can begin investigate if natural causes can really explain the rate of genetic change. In order to do this investigation you need objective unbiased data on the genetic differences between species.
http://mbe.oxfordjournals.org/.....l.pdf+html
Timaeus @29:
Whew. For a bit there I thought you were talking about me!
I’d rather be related to slime than a chimp! Who’s with me?
wd400, you are proven wrong. The data itself is what proves you wrong. Whereas, I can not stop you from lying about what the evidence says.
In other words, Tomkins has access to the unfiltered raw data and that is what he bases his 70% analysis on.
That you would try to belittle him to try to discredit his work is a typical dishonest tactic of Darwinists.
Of related interest, Tomkins had a similar disagreement with Darwinists over the raw genetic data on the alleged chromosome fusion site that he debunked:
Seeing as Tomkins pretty much single handedly debunked Chromosome fusion, and had Miller personally concede that to him that he had done so, then I’m sticking with Tomkins’s assessment of the inherent bias with which Darwinists drastically ‘pre-filter’ the similarity data to fit their preconceived conclusion.
You guys simply have no credibility with me.
a few more notes on the fusion controversy:
My understanding of genome comparisons, and it is by no means comprehensive, is that the % similarity depends on the way the comparison is made. But regardless of the method used, chimps still come out as the closest to humans. Do does it really matter whether it is 99%, 95% or 90%? Chimps are still our closest relative.
wd400:
I see you ignored the most important part of my post. My agreement that the genomic similarity is high was merely prefatory to my more important point, which is that it doesn’t matter that it’s high, because no matter how high it is, the further inferences that all or many Darwinians draw from the similarity (e.g., there is no design, human beings are nothing special, chimps should have legal rights) are unwarranted. It’s precisely because those further inferences are unwarranted that I’m not at all threatened by the genomic similarity, whether the number is 99%, 94%, 89%, or whatever. And the other side of the coin, which you seem to miss, is that atheists/materialists are just as guilty of making too much of the numbers, since they don’t in themselves establish anything that’s of interest.
BA,
I already told you why Tomkins is wrong, if you don’t want to learn that’s fine, got back to link spamming.
Timeaus,
I din’t “ignore” anything. I only replied to the bit that bore any relation to anything I have said. No one is under any obligation to reply point by point to everything you say.
unwilling:
No, they are not our relatives because the word ‘relative’ implies a family relation that involves procreation. They are close to us genetically because we were designed by intelligent beings who did what intelligent designers everywhere always do: they reuse existing designs as much as possible. In software engineering, it’s called “adding functionality through class inheritance.”
Is a corvette a relative of a Ferrari, a horse drawn carriage or an SUV? No, they may just share similar designs (wheels, rear view mirrors, headlights, etc.)
T, true.
wd400, by your own admission then, most of what you’ve said is irrelevant.
Mapou: “They are close to us genetically because we were designed by intelligent beings who did what intelligent designers everywhere always do: they reuse existing designs as much as possible.”
Even though I agree that there is design involved, your argument here is based on a statistical degrees of freedom of zero. And as anyone with even the most basic knowledge of statistics knows, drawing any conclusions by extrapolating from a single point is not possible. We cannot rely on comparing what we see in biology to all known designers because we only know of one designer, humans. To be taken seriously we have to stop using this comparison.
wd400, not only are you completely wrong about genetic similarity, you are, at an even more fundamental level of theoretical importance, also completely wrong with your belief in the modern synthesis.
i.e. With your reliance on the ‘bottom up’ modern synthesis of neo-Darwinism, you simply are not even in the right ballpark to begin with. Dr. Meyer puts the insurmountable problem for neo-Darwinists like this.
as to some regions of genomic similarity being high, I repeat these facts:
Thus once again, similarity in certain regions of the genome is not the be all end all Darwinists pretend it to be: Moreover
and I repeat, mutations to developmental Gene Regulatory Networks are ‘always catastrophically bad’:
Let me try my best to provide an accurate summary.
wd400: It’s of utmost importance that we admit to just how similar are the genomes of humans and chimps.
Timaeus: It’s not how similar the genomes are, it’s the inferences we draw from the similarity.
wd400: I don’t care about that.
Jim@44
You’ve misread the paper. Try again.
unwilling (emphasis added):
Your argument is incoherent, IMO. First we know many designers, i.e., humans from all over the globe. Second, it has nothing to do with the species of the designers or where they come from but whether or not they are intelligent. The ID hypothesis is about both intelligence and design. It makes logical sense to reuse existing designs especially if there are only a few ways to do certain things due to environmental constraints. Reinventing the wheel every time one makes a new wheel is not particularly intelligent. It is stupid.
“I’d rather be related to slime than a chimp! Who’s with me”
I’m with you Mung. I find it appealing I’m 50% Banana. Uplifting that I have Bird DNA. Lion DNA? Makes me feel regal.
Not happy I have broccoli DNA. My spider DNA creeps me out, not feel like superhero no. Chimp DNA makes me want to shower. That’s just me though.
REC:
See here.
Mapou: “Your argument is incoherent, IMO. First we know many designers, i.e., humans from all over the globe.”
I’m afraid that I have to disagree. You are correct if we were looking at what we think is a man made artifact and extrapolating from what we have observed from thousands (or millions) of human designers. But this technique only has power to reasonably identify human made designs.
Since we have no idea how a non human designer of biological structures could facilitate the design and “manufacture” of a biological structure, we have nothing to compare against.
That is why I say that comparing to human design is not likely to be productive in concluding that design is the best explanation for any structure other than for structures designed and built by humans. To get beyond this, we must free ourselves of this bias.
BA,
Here’s the dolphin genome, it’s not even close to being “identical” to the human one: http://uswest.ensembl.org/Turs.....Info/Index
But by all means, keep embarrassing yourself.
Mung,
It’s more like
wd400: the 99% thing isn’t a myth. That so many of you are ready to believe that it is demonstrates the danger of seeking out ‘facts’ that suit your own opinions. Also, BA, just stop.
timeaus: a whole bunch of other stuff
wd400 you claim that the dolphin genome is not even close to being “identical” to the human,
You are, once again, completely wrong in your claim i.e. this time your ‘not even wrong’ claim is ‘not even close’
context is everything, so I will quote Sternberg in full:
Thus wd400 faces quite the dilemma, there is found to be far more dissimilarity than he wishes there to be for chimps and humans and far too much similarity for dolphins and humans.
All of this on top of the fact that mutations to DNA do not even effect basic body plan plasticity in the first place.
Just keep lying to yourself and others wd400, maybe you can make the truth go away! 🙂
Personally I’m sure you will fail !
unwilling:
You need to look at this from a different perspective. Intelligent design is not a conclusion. It is THE hypothesis. From this hypothesis we predict several things such as specified complexity, irreducibility, lateral inheritance and a hierarchical organization of the designs over time. From the predictions we can conduct experiments to find evidence for the hypothesis. This is why ID is falsifiable. And guess what? The evidence corroborates the ID hypothesis.
wd400:
Kind of like the way you want it to be 99% to suit your biased opinion, eh? Problem is, even 99% is not evidence for Darwinian evolution.
wd400: the 99% thing isn’t a myth.
So? Why do you care? Why does it matter?
Even if it’s true, you still have no response to Timaeus.
wd400:
Timaeus: It’s not how similar the genomes are, it’s the inferences we draw from the similarity.
wd400: I don’t care about that.
indeed
wd400:
You are right; you are not obliged to reply to anything anyone here says beyond what interests you. But clearly what interests you is polemics — scoring points against ID from a narrow, science-geeky point of view. If you were a person of broader intellectual sympathies, you might find statements that go beyond narrow technical points (e.g., 94% versus 99%) and into broader considerations (like whether mere amount of genomic similarity establishes anything important) to be actually interesting and worth pursuing. You might actually learn something from reflecting upon such statements.
wd400: I don’t care about that.
I’m not the least bit interested in scoring points. I’d/creationism lost long ago.
What interests me is how anti-scientific movements propigate. This is a great example, a cut and dried that is labeled a “myth” by many IDers and creationists! As I say, the torrent of links BA can provide to oppose so simple a finding is remarkable testament to how easy it is to find comforting “evidence”, and why doing so is such a bad idea.
Timaeus, While I certainly agree that the broader points that you are trying to bring out, and which wd400 refuses to discuss, (since they ‘uncomfortably’ falsify neo-Darwinism), are very important, even the narrow point that wd400 is trying to defend is not even right on the ‘narrow, science geeky point of view’ he would like to make.
ORFan genes by themselves refute his 99% claim for protein coding regions (by anywhere from a 10% to 40% margin, nobody really has a firm clue yet).
Of related interest to the large percentages of ORFan genes being found in ALL genomes is the disingenuous way that neo-Darwinists try to ‘explain away’ these dissimilar, non-Darwinian, sequences that are being found throughout the supposed tree of life
Moreover, wd400’s claim that the entire genomes, not simply protein coding regions, of chimps and humans are 99% similar is simply, for lack of a better term at this point of dealing with wd400’s continued misrepresentations of the evidence, a bald face lie.
The only way that a 99% similarity figure for entire genome comparisons can possibly be reached is by Darwinists presupposing common ancestry as true and then filtering the data to accord with that presupposition. And that is in fact what they do.
Thus Timeus, since wd400 can’t even be honest with the ‘narrow, science geeky point of view’ on his false 99% figure, I really don’t see why anyone should expect him to be honest on the more important matters that more directly falsify his worldview. He simply does not care for the truth.
bornagain77 relates
I see. So is this the data that wd400 has been referencing that shows that the parts of human DNA that matches chimpanzee DNA matches up extremely closely?
A single data point shows little, so one is tempted to ask
* What percent of closely matching dolphin DNA matches that of human DNA?
* And what percent of closely matching dolphin DNA matches chimpanzee DNA?
* Is this technique broadly used to determine evolutionary relationships?
Just asking.
-Q
WD400:
So why do you care? What are you continually foaming at the mouth about if you already won? Inquiring minds and all that.
Even if there was a 99% similarity between chimes and humans which there aren’t it still means a staggering 30 000 00 base pair difference. Consider that our last common ancestor lived a about 6 000 000 years ago Darwinism still can’t explain the amount of changes in such a short geological blink of time. WD400 the floor is yours. Enlighten us.
wd400 – why do you hold so strongly to the 99% figure? Of course it doesn’t really matter, but the point is good vs bad science. Why do you reject papers from even 10 years ago which demonstrate it at 96%? You say “what’s 3%” but when you are talking about giba bp any percent is significant. Are those papers wrong? Note – written by evolutionary biologists.
http://genome.cshlp.org/content/15/12/1746.full
That was 10 years ago. Is it incorrect?
Now I agree, if in fact Tompkins analysis aligns as you give an example above, short sequences without taking into account gaps for indels – is an incorrect way of measuring homology. So I am wary of that 70% figure and the best answer I have heard from him was simply a refutation by saying someone cannot compare by doing a simple armchair analysis. I have not heard an answer to the challenge about that particular issue, if in fact that is how he arose to his figure.
However to not budge on 99% when many non-ID scientists wouldn’t even quote 99% but would say “>90%” is a bit odd to me.
What do you make of this statement then:
“Best reciprocal nucleotide-level alignments of the chimpanzee and human genomes cover ~2.4?gigabases (Gb) of high-quality sequence, including 89?Mb from chromosome X and 7.5?Mb from chromosome Y.”
http://www.nature.com/nature/j.....04072.html
Does this not mean that only 2.4billion of the 3.2billion human base pairs in the genome could be aligned? If so, what to say about that 25% of the human genome sequence? Why could it not be aligned to the chimp genome, if in fact, it was 99% similar? Or even 96% similar? Why could 25% of the human genome not be aligned with chimp? Bear in mind 94% of the chimp genome was covered with 98% being high quality.
Thanks
Another question for anyone who knows the accurate measurements:
1) What is the accurate number of bp for the entire homo sapiens genome
2) What is the accurate number of bp for the entire pan troglodytes genome
Thanks
bornagain:
I can’t verify your arguments as I haven’t studied the technical material. I’m not familiar enough with the various methods that are used to measure similarity and dissimilarity. But supposing for the sake of argument your numbers are correct, then indeed, as you say, wd400’s argument here is in even worse shape than I suppose.
I suspect that, when all the dust of partisanship has cleared, the actual numbers accepted by just about everyone will be somewhere between the lowball numbers accepted by creationists and the ultra-high numbers accepted by the atheists. Somewhere in the 90s, I would say. But even a number in the 90s could not by itself prove common descent; and even if it could prove common descent, it could not refute design. wd400 apparently thinks that the higher the number, the worse the consequences for ID. But that’s simply not true.
I have nothing against you or others carrying on a fight for numbers lower than 99%, if that is what the empirical evidence warrants. If the atheists and materialists are wrong about the number, they should be corrected. But I always brace myself for the “worst” possible outcome. What if, after another 20 years of argument, the number were demonstrated to be 99%? Would any of my current views change? And the answer is, no. Even at 99% I could still deny common descent (if I wanted to, though I have no interest in doing so), and even at 99% I could still argue for design. And even at 99% I could still argue that chimpanzees are so obviously qualitatively different from human beings that all this stuff about chimps having lawyers to guarantee their rights is utter rubbish.
My problem with these battles over the percentage is that I think that underlying them is still the old opposition of “creation versus evolution.” I think that the creationists want to minimize the number because they think that creates a “gap” that makes human evolution impossible, and I think the atheists want to maximize the number because they think that closes all the “gaps” and makes evolution certain. But my whole motive for entering these debates is to argue that this is not the right opposition, that the opposition should be “design versus chance.” Once design is established, the truly important question has been settled.
So I’m neither going to accede to wd400’s demand that I persuade others here to stop talking about numbers (if his numbers are wrong, he deserves to be contradicted), nor will I endorse lengthy debates by Christians motivated by the desire to keep the numbers lower than 99% at any intellectual cost. I think much more important questions than genome similarity include how new body plans are formed, why the universe is fine-tuned, etc. I think those are the things ID should be concentrating on. I think genome similarity is a red herring, which misleads people on both sides.
wd400:
If you’re interested in how anti-science propagates, study the hacked Climategate emails. No greater betrayal of the very spirit of science can be imagined. Indeed, the whole AGW propaganda machine has been an object lesson in how to spread extremely shaky science (mathematical models based on many questionable factual assumptions and at most about a 20% understanding of the complex causes of global climate change) and get it treated by the intelligentsia of the West as Gospel truth. You don’t need evidence. You just keep repeating the same mantras (“the science is in”), demonize honest scientific dissent (they are all “deniers”), etc. If you keep on doing that, nobody will notice that the temperature has flatlined for years, that it failed to go up again after 2011 as predicted, that the Antarctic ice is recovering, that Eastern North America has shivered in the past two winters as it hasn’t since the 1970s, that water mains are breaking on their own street in the winter, right in front of their noses, that never broke before, etc. Slogans, properly spread, will trump sense-evidence any time.
Timaeus:
I pretty much completely agree with you in the sense that what the number is doesn’t matter too much anddoes not prove one side of tthe argument. At worst for materialists even if the number was much lower than stated the time lines or rates of evolutionary change and the neutral theory would have to change to accommodate the number of mutations required. But it won’t change much.
my issue as a scientist is accuracy and truth. What I will argue about is that, and where ID comes in my argument lies with interpretation of truth (observable facts) and assigning how well observations fit hypotheses.
so as such, the only concern I have is who is being most honest here. It boils down to someone letting their worldview lead the number they give rather than simply what is the number. This isn’t a debate about what you interpret from a number or hypothesise what happened over time, in this case rather it us a debate as to what are the observable FACTS. And are those facts being misrepresented by one or both sides of a debate to advance a worldview.
That is what this story is about. If indeed it has been shown chimps and human genomes differ by <99% then the question is why is it still commonly quoted as fact?
Additionally I am more than happy to disagree with fellow IDers about the low end estimates if their methods are flawed. I'm not bothered if it is 99% or not. But I won't compromise on truth, honesty or deceptive methods to advance my own worldview even if the argument is very powerful to support my view. Dishonesty is wrong and lacks integrity. Sadly it happens on both sides.
But the reason we have to fight for transparency is so that those seeking truth aren't fed misinformation and have the facts before them in honest and we'll reasoned arguments.
wd400:
What? You don’t have a viable alternative so YOU lose.
The myth persists because some people want to think that there is only a 1% difference between chimp and human. We’re 99% the same.
But the difference between human and chimp is so great it cannot be measured. The two are an infinite distance apart.
Genetic properties do not tell the story of what a human person is.
If we are 99% genetically identical, why don’t we look, think and most of all behave 99% identically?
Since Darwinists believe that the evolution is all about genes, why can’t they tweak the chimpanzee genome in the lab and make it at least to wipe after they take a dump?
Do you know how embarrassing it was for my son’s biology teacher to have to explain to elementary schoolkids why a chimpanzee, 99% genetically identical to us and our closest living relative, first takes a dump in front of hundreds of people in the zoo and then doesn’t even wipe?
Querius although I can’t give firm answers to your important questions at 71, none-the-less, here is Rana’s quote in full context:
KevNick
I find evolutionists to be very embarrassing. But they don’t seem to care about such things.
Seversky asked this:
It’s hard to believe this is a serious question. A five year old knows the answer. If I say, “you look and act like a chimpanzee” – there’s nothing to be offended about?
Evolutionism is embarrassing – and really stupid.
KevNick
I don’t think that this is what evolutionists believe. It is my understanding that they believe it is about the affect of the environment on the expression of genes.
Timaeus:
Meanwhile the Zombie threat is very real:
The Equation That Can Help Predict Zombie Migration Patterns
The post by Timaeus @76 is well worth reading.
wd400: What interests me is how anti-scientific movements propagate.
Then why are you wasting your time at this site? Go find a movement that’s anti-science.
Mung:
The astonishing thing is that Darwinism is the most anti-scientific movement in the history of humanity.
i am writing from an iPad and away from home so am limited in resources.
I believe the really big differences between chimps and humans are in the control mechanisms not in the protein coding sequences. Especially the control of neural areas of the brain.
What a lot of noise.
Q,
Nope, i’ve linked to the raw data several times. Anyone that wants to check it out can.
About 75%. About 75%. Not really, but that both chimps and humans (and organs and gorillas and monkeys…) have about the same similatity to a all the ungulates (dolphins included) is certainly easier to explain under common descent than other proposals.
Well, 30 million differences = 15 million changes in each lineages. Absent selection changes fix at a rate equal to the per-individual mutation rate. Taking a 20 year generation time you have
6 Million years / 20 years/gen = 300 000 generations
15 million mutations / 300 000 generations = 50 mutations/generations
Which is pretty much what he observe! Care to withdraw?
JDD,
I discussed what the different estiamtes from the literature mean in 17 and 24. The 99% is not a myth, it’s one accurate description of how similar our genes are.
The 2.4Gb was the size of the chimp reference genome at that time (representing the work in progress nature of the genome, and the fact the chimp sequence is much worse than either the human or the gorilla). The human and chimps genomes are both about 3.5 pg (I think the best estimate of chimp is 3.45.
Found reference:
http://www.asa3.org/ASA/meetin.....Wilcox.pdf
One of the things it says is that the regulatory nature in the human genome is extremely more complex than the next species. Here is a quote:
There aren’t any such genes. What makes us human is not found in the genes nor how they are regulated. Genes influence development but they do not determine what will develop.
Joe: “There aren’t any such genes. What makes us human is not found in the genes nor how they are regulated. Genes influence development but they do not determine what will develop.”
I don’t see how you figure this. If you implant a tiger fetus in a lion, the outcome is a tiger. I think that genes do determine “what” will develop. The environment can only have an impact on how these genes are expressed.
They do not know where the instructions are for construction of a complex organism. They are somewhere in the egg but they are not sure where. Probably in cellular wall.
unwilling participant-
Dr Denton puts that to rest in his article in “Uncommon Dissent”:
It’s not the genes. It ain’t the genome. It ain’t the same ole genes used differently. And that is the main reason why evolutionism is a failure.
In his book (English title) “Why is a Fly not a Horse?”, the prominent Italian geneticist Giuseppe Sermonti, tells us the following :
Chapter VI “Why is a Fly not a horse?” (same as the book’s title)
wd400 is determined to beat a dead horse so, once again, here is Tomkins’s paper where the unbiased reader can judge for themselves who is being forthright and who is being biased towards the evidence.
Please note that ORFans were excluded from the above analysis: (i.e. This definition was considered to be conservative because it did not include the amount of human DNA absent in chimp nor did it include chimp DNA that was not aligned to the human genome assembly (unanchored sequence contigs).)
And here is another recent paper by Tomkins which underscores the point made in the previous paper:
And here is a repost of the video interview of Tomkins where a person can see for themselves the integrity and professionalism with which Tomkins conducts himself.
wd400 claims:
What wd400 does not inform people of are the hidden assumptions built into his ‘back of the envelope’ calculation.
One hidden assumption is the claim that changes to DNA can effect body plan morphogenesis, which is a claim he simply has no evidence for:
Another hidden assumption in wd400’s ‘back of the envelope’ calculation is that most all of the 15,000,000 mutations will be ‘fixed’ fairly easily. He simply has no evidence for that assumption:
In fact, the types of mutations that will most easily fix are NOT the types of mutations that wd400 needs:
There is much more that is fallacious in wd400’s thinking, but I will leave the refutation of his claim at this stage for the moment and give him a chance to respond to Behe, Gauger and Axe.
The only assumption in that calculation is the one I stated — that new mutaitions are selectively neutral. Positive selection of the sort discussed in your links might make more mutations fix, but the neutral rate is equal to the per-individual mutation rate.
WD400,
I’m confused. Did they in 2005 believe that the chimp genome was in fact 2.55 Gbp? Were they really nearly ~0.9-0.95Gbp out from what we think now?
You state:
And in the publication they state:
So they claim to cover 94% of the chimp genome.
They then state:
So again, I come back to the point – it seems here they are:
1) Stating their OWN results and alignment with the human genome as 2.4Gb of sequence aligned
2) Stating that they cover ~94% of the chimp genome
Now if the genome of the chimp is in fact 3.45Gb, then this does not quite add up. Either they should be shot for incredibly bad wording, or you are wrong with what you say, or back in 2005 they significantly underestimated the size of the chimp genome, by 25%. Which is it? Because 3.45 x 0.94 (x 0.98 for high quality) does not equal 2.4. It equals 3.17. So why can they only align 2.4Gb? I don’t understand this. Maybe they underestimated the size of the whole chimp genome but that is not clear to me.
Secondly, you state:
Do you really mean that sentence in the implication of its words? Do you understand that people are generally not contesting that notion? I know you have said slightly different elsewhere in the thread but I would have thought you would be more careful if so – not many are contesting that we are 99% identical to chimps in our genes. For we all know the definition of “gene”. And barely anyone here will argue with you over our similarity of genes, but rather the genome.
Further, the whole point is sloppy science. Many people (I’ll exclude you from this as I have read numerous, numerous atheistic evolutionary biologists say this) will state anywhere from 90% same DNA to chimps to 96%, to 98%. These are people who do NOT support ID. Many do not adhere to the 99% line. And yet, even if we were 99% chimps and humans cary dramatically. As said, that is what the contentious point is – that different cannot be simply due to 1% of the genome. If it is, we really do not understand the genome well at all, if it is not, the Darwinian paradigm falls quite flat. So to sloppily say we are “99% the same” as so many pop-science articles do is quite frankly, silly, and shows a brainwash of the media towards the Darwinian worldview as being gospel.
Just for the record, I would personally not be surprised if our DNA was once 100% identical with chimps, in the places that share sequence similarity.
I fully accept the raw data and agree that where you can align bases between the genomes, they share 99% homology. But that does not mean our genomes are 99% the same – which is the picture it paints to the less discerning/knowledgable on genetics and science in general.
I really would honestly not be surprised if a while back, chimps and humans as separate organisms existed where they both contained identical sequences in the alignable regions. Somewhere in Genesis 1-3, for example.
Many IDists and even YECs have absolutely no problem with high homology even with chimps. It is hardly unexpected.
wd400 at 98, so you do not claim, as is held in the modern synthesis, that Body Plans are determined by DNA???
Really? I’m glad to hear that you do not since it is not true.
But if mutations to DNA do not explain how a chimp-like creature can become a human, as they can’t explain how it can happen, then why do you pretend as if you have proven how it can happen solely by reference to 15,000,000 mutations to DNA?
Since mutations to DNA do NOT effect body plan morphogenesis, do I really need to point the fact out to you that there is a huge, gargantuan, gap in your explanation as to how we got here?
A gargantuan gap that is very reminiscent of this cartoon??,,,
As to your unsubstantiated claim that most mutations are neutral, there are strong empirical and theoretical considerations for believing that there are no truly neutral nucleotide positions.
Moreover, neutral theory was not developed because of any empirical observation, but was developed because it was forced upon Darwinism by the mathematics. (i.e. neutral theory is actually the result of a theoretical failure of Darwinism!)
A graph featuring ‘Kimura’s Distribution’ being ‘properly used’ is shown in the following video:
In fact neutral theory is why, against the overwhelming evidence now found for widespread functionality in the genome (i.e. ENCODE etc.. etc..), most neo-Darwinists still insist, against that overwhelming empirical evidence for widespread functionality, that most of the genome must be junk:
At the 2:45 minute mark of the following video, the mathematical roots of the junk DNA argument, that is still used by many Darwinists, can be traced through Haldane, Kimura, and Ohno’s work in the late 1950’s, 60’s through the early 70’s:
Here are more detailed refutations of ‘neutral theory’
here are some supplemental comments/quips as to neutral theory:
With the adoption of the ‘neutral theory’ of evolution by prominent Darwinists, and the casting under the bus of Natural Selection as a major player in evolution, William J Murray quips,,,
as to drift
Sequencing and assembling genomes is hard, no one in their right ming would think it was the best way to estimate genome size. We know from flow cytometry that the chimp and human genomes are about the same size, the current build of the chimp genome is actually a little longer than the human one
The rest of your post reveals we appear to have a different meaning of the word “gene” in mind. I meant the simplest one, a unit of inheritance. I guess you meant just protein coding genes or some other restrictive definition.
wd400 as to:
“The rest of your post reveals we appear to have a different meaning of the word “gene” in mind. I meant the simplest one, a unit of inheritance.”
Towards the latter half of the following podcast, Dr Sternberg, who has a PhD in evolutionary biology, elucidates how the overturning/loss of the ‘gene’ as the central unit of inheritance turns the modern synthesis of neo-Darwinism from a science into no better than the discarded alchemy of yesteryear.
How much does it cost today to sequence a human genome?
I’m pretty sure that if we were to sequence my genome and any of the Darwinists on this thread, our genomes wouldn’t be even 97% identical.
I love bets and I may have a sponsor to cover the costs of the genome sequencing. Would anybody like to challenge me?
unwilling participant,
What happened to mutations and natural selection? Are you telling me that environment drives the inconceivable changes in body parts by regulating gene expressions? Really. I hope you have a mechanism for this process and more than pure Darwinian speculation.
New blueprints out of nowhere? Please surprise me. I’m all ears.
It’s about 1000 USD to sequence a genome (wholesale). Two humans picked at random will be about 99.9% identical on average.
Genomic Mosaicism is another semi-related finding that also contradicts what Darwinism would have predicted
Of supplemental note to post 104
Thank you for your illuminating posts, bornagain77. Seems like a “Copernican” revolution in genetics is starting to gain momentum.
While browsing around, I found some interesting statements in the following paper, first about the 1% difference, and later about brain size.
http://genome.cshlp.org/content/15/12/1746.full
For example
Then, I found it curious in one of wd400’s responses that the chimpanzee genome is actually larger (about 7% larger) than the human genome. It seems likely that it would be difficult to reconcile that 7%, which does not exist in the human genome, with the 1-2% reported difference between the genomes. At any rate, it seems to be a non-issue, and I suppose it’s further evidence of the limited role of DNA in distinguishing the species.
But not everyone agrees.
It also brings to mind the hilarious New York Supreme Court Justice Barbara Jaffe, who briefly granted chimpanzees the same legal protection as humans regarding detention. I wonder what’s next? Quotas for university admissions? Having the right to vote? Driver’s licences? Another hearing on May 6 should reveal what Judge Jaffe has discovered! 😉
-Q
Timaeus
So that you won’t feel ignored:
Timaeus @ 29
And what both you and Barry seemed to have missed is that I was commenting on what I thought were pertinent points in the comments posted under the News byline in the OP.
I, like you, will post in any way that I see fit or not post at all, as the case may be. There are reasons why I’m not able to post with the frequency or at the length of some others here. When I do post, I have no expectation that anyone will necessarily answer and I’m not offended by a lack of comment. No one is obliged to answer or to read my comments at all.
Seversky:
You are of course free not to reply to people when they respond to you. I would not put a gun to your head to force you to converse. At the same time, if you make a claim, and someone raises objections, and you don’t respond to the objections, your critic can be said to have won by default, since you have abandoned the defense of your claim. I will therefore treat all my unanswered objections to your claims as decisive refutations until such time as you respond. So right now it’s Timaeus 5, Seversky 0. And of course, others here, whose responses to you have also gone unanswered, may have accumulated even higher totals.
No Darwinist is willing to prove me wrong? What happened to your faith in Darwin?
The 99% identical genome of humans and chimps just kills Darwinism and you know it. Find another mechanism if you can. In the mean time I’m going to sequence my and my younger brother’s genome. He is a closet Darwinist. Can anybody predict the results of our genome sequencing? How close can we be?
I am not sure if anyone has brought this up before but I was watching at documentary on Neanderthals and it occurred to me:
Why do scientist say 96% of human DNA is the same as chimp DNA, but only 1-2% of human DNA is the same as Neanderthal, and 50% of our DNA is the same as our parents and siblings? That is a rhetorical question, I know the answer. But I think it is relevant to point out that scientists use statistics to subliminally influence how people think.
https://news.nationalgeographic.com/news/2005/08/0831_050831_chimp_genes.html
Chimps, Humans 96 Percent the Same, Gene Study Finds
https://www.livescience.com/42056-neanderthal-woman-genome-sequenced.html
They estimated about 1.5 to 2.1 percent of DNA of people outside Africa are Neanderthal in origin
http://genetics.thetech.org/ask/ask138
We share 1/2 of our genetic material with our mother and 1/2 with our father. We also share 1/2 of our DNA, on average, with our brothers and sisters.
The documentary on Neanderthals is here:
https://www.youtube.com/watch?v=6hIyD1QlX9k