The “We share 99% of our DNA with chimps” claim rises again

I am not sure if anyone has brought this up before but I was watching at documentary on Neanderthals and it occurred to me: Why do scientist say 96% of human DNA is the same as chimp DNA, but only 1-2% of human DNA is the same as Neanderthal, and 50% of our DNA is the same as our parents and siblings? That is a rhetorical question, I know the answer. But I think it is relevant to point out that scientists use statistics to subliminally influence how people think. https://news.nationalgeographic.com/news/2005/08/0831_050831_chimp_genes.html Chimps, Humans 96 Percent the Same, Gene Study Finds https://www.livescience.com/42056-neanderthal-woman-genome-sequenced.html They estimated about 1.5 to 2.1 percent of DNA of people outside Africa are Neanderthal in origin http://genetics.thetech.org/ask/ask138 We share 1/2 of our genetic material with our mother and 1/2 with our father. We also share 1/2 of our DNA, on average, with our brothers and sisters. The documentary on Neanderthals is here: https://www.youtube.com/watch?v=6hIyD1QlX9k Jim Smith

No Darwinist is willing to prove me wrong? What happened to your faith in Darwin? The 99% identical genome of humans and chimps just kills Darwinism and you know it. Find another mechanism if you can. In the mean time I'm going to sequence my and my younger brother's genome. He is a closet Darwinist. Can anybody predict the results of our genome sequencing? How close can we be? KevNick

Seversky: You are of course free not to reply to people when they respond to you. I would not put a gun to your head to force you to converse. At the same time, if you make a claim, and someone raises objections, and you don't respond to the objections, your critic can be said to have won by default, since you have abandoned the defense of your claim. I will therefore treat all my unanswered objections to your claims as decisive refutations until such time as you respond. So right now it's Timaeus 5, Seversky 0. And of course, others here, whose responses to you have also gone unanswered, may have accumulated even higher totals. Timaeus

Timaeus So that you won’t feel ignored: Timaeus @ 29

I agree with Barry above that you have missed the article’s point. You seem to be reading too quickly. And that is not surprising. You seem to comment on column after column here, but never stay long on any one column long enough to have a sustained, back-and-forth discussion with anyone, a discussion where points and arguments are exchanged and people on both sides modify their views.

And what both you and Barry seemed to have missed is that I was commenting on what I thought were pertinent points in the comments posted under the News byline in the OP.

Your approach, for the most part, is scattershot. You toss in a drive-by comment, then move on to the next column which catches your interest, toss in another drive-by comment, move on again, etc. Most people who respond to you don’t get even a single reply to their responses. It’s as if you have what teachers for the past few years have been calling “ADD” — attention deficit disorder — and are unable to stay long at any one task, being too easily distracted by background activity in your environment.

I, like you, will post in any way that I see fit or not post at all, as the case may be. There are reasons why I’m not able to post with the frequency or at the length of some others here. When I do post, I have no expectation that anyone will necessarily answer and I’m not offended by a lack of comment. No one is obliged to answer or to read my comments at all. Seversky

Thank you for your illuminating posts, bornagain77. Seems like a "Copernican" revolution in genetics is starting to gain momentum. While browsing around, I found some interesting statements in the following paper, first about the 1% difference, and later about brain size. http://genome.cshlp.org/content/15/12/1746.full For example

Also, what might seem an important phenotypic difference between humans and great apes might not actually be the most critical factor in determining unique features of the human condition. For example, despite the frequent attention given to big brain size (Wood and Collard 1999; Preuss 2005), there is little evidence for causative connections between brain size and human cognitive abilities (Preuss 2005).

Then, I found it curious in one of wd400's responses that the chimpanzee genome is actually larger (about 7% larger) than the human genome. It seems likely that it would be difficult to reconcile that 7%, which does not exist in the human genome, with the 1-2% reported difference between the genomes. At any rate, it seems to be a non-issue, and I suppose it's further evidence of the limited role of DNA in distinguishing the species. But not everyone agrees. It also brings to mind the hilarious New York Supreme Court Justice Barbara Jaffe, who briefly granted chimpanzees the same legal protection as humans regarding detention. I wonder what's next? Quotas for university admissions? Having the right to vote? Driver's licences? Another hearing on May 6 should reveal what Judge Jaffe has discovered! ;-) -Q Querius

Genetic breakthrough that reveals the differences between humans - 2006 Excerpt: The findings mean that instead of humanity being 99.9 per cent identical, as previously believed, we are at least 10 times more different between one another than once thought (99%) - which could explain why some people are prone to serious diseases. http://www.independent.co.uk/news/science/genetic-breakthrough-that-reveals-the-differences-between-humans-425432.html Marching to our own sequence: Study finds DNA replication timing varies among people - Nov 13, 2014 Excerpt: A new study from geneticists at Harvard Medical School and the Broad Institute of Harvard and MIT has found that this replication plan—including where the origin points are and in what order DNA segments get copied—varies from person to person. The study also identifies the first genetic variants that orchestrate replication timing. "Everyone's cells have a plan for copying the genome. The idea that we don't all have the same plan is surprising and interesting," said Steven McCarroll, assistant professor of genetics at HMS, director of genetics for the Stanley Center for Psychiatric Research at the Broad and senior author of the paper. "It's a new form of variation in people no one had expected," said first author Amnon Koren, postdoctoral fellow at HMS and the Broad. "That's very exciting." http://phys.org/news/2014-11-sequence-dna-replication-varies-people.html New level of genetic diversity in human RNA sequences uncovered – May 2011 Excerpt: A detailed comparison of DNA and RNA in human cells has uncovered a surprising number of cases where the corresponding sequences are not, as has long been assumed, identical. The RNA-DNA differences generate proteins that do not precisely match the genes that encode them.,,, Nearly half of the RDDs uncovered in the new study cannot be explained by the activity of deaminase enzymes, however, indicating that unknown processes must be modifying the RNA sequence, either during or after transcription. ,,, Although all of the individuals analyzed in the study had a large number of RDDs, there was a great deal of variability in the specific RDDs found in each person's genetic material." http://www.physorg.com/news/2011-05-genetic-diversity-human-rna-sequences.html

Genomic Mosaicism is another semi-related finding that also contradicts what Darwinism would have predicted

Ask an Embryologist: Genomic Mosaicism - Jonathan Wells - February 23, 2015 Excerpt: humans have a "few thousand" different cell types. Here is my simple question: Does the DNA sequence in one cell type differ from the sequence in another cell type in the same person?,,, The simple answer is: We now know that there is considerable variation in DNA sequences among tissues, and even among cells in the same tissue. It's called genomic mosaicism. In the early days of developmental genetics, some people thought that parts of the embryo became different from each other because they acquired different pieces of the DNA from the fertilized egg. That theory was abandoned,,, ,,,(then) "genomic equivalence" -- the idea that all the cells of an organism (with a few exceptions, such as cells of the immune system) contain the same DNA -- became the accepted view. I taught genomic equivalence for many years. A few years ago, however, everything changed. With the development of more sophisticated techniques and the sampling of more tissues and cells, it became clear that genetic mosaicism is common. I now know as an embryologist,,,Tissues and cells, as they differentiate, modify their DNA to suit their needs. It's the organism controlling the DNA, not the DNA controlling the organism. http://www.evolutionnews.org/2015/02/ask_an_embryolo093851.html

Of supplemental note to post 104

Why the 'Gene' Concept Holds Back Evolutionary Thinking - James Shapiro - 11/30/2012 Excerpt: The Century of the Gene. In a 1948 Scientific American article, soon-to-be Nobel Laureate George Beadle wrote: "genes are the basic units of all living things.",,, This notion of the genome as a collection of discrete gene units prevailed when the neo-Darwinian "Modern Synthesis" emerged in the pre-DNA 1940s. Some prominent theorists even proposed that evolution could be defined simply as a change over time in the frequencies of different gene forms in a population.,,, The basic issue is that molecular genetics has made it impossible to provide a consistent, or even useful, definition of the term "gene." In March 2009, I attended a workshop at the Santa Fe Institute entitled "Complexity of the Gene Concept." Although we had a lot of smart people around the table, we failed as a group to agree on a clear meaning for the term. The modern concept of the genome has no basic units. It has literally become "systems all the way down." There are piecemeal coding sequences, expression signals, splicing signals, regulatory signals, epigenetic formatting signals, and many other "DNA elements" (to use the neutral ENCODE terminology) that participate in the multiple functions involved in genome expression, replication, transmission, repair and evolution.,,, Conventional thinkers may claim that molecular data only add details to a well-established evolutionary paradigm. But the diehard defenders of orthodoxy in evolutionary biology are grievously mistaken in their stubbornness. DNA and molecular genetics have brought us to a fundamentally new conceptual understanding of genomes, how they are organized and how they function. http://www.huffingtonpost.com/james-a-shapiro/why-the-gene-concept-hold_b_2207245.html

bornagain77

It's about 1000 USD to sequence a genome (wholesale). Two humans picked at random will be about 99.9% identical on average. wd400

unwilling participant, What happened to mutations and natural selection? Are you telling me that environment drives the inconceivable changes in body parts by regulating gene expressions? Really. I hope you have a mechanism for this process and more than pure Darwinian speculation. New blueprints out of nowhere? Please surprise me. I'm all ears. KevNick

How much does it cost today to sequence a human genome? I'm pretty sure that if we were to sequence my genome and any of the Darwinists on this thread, our genomes wouldn't be even 97% identical. I love bets and I may have a sponsor to cover the costs of the genome sequencing. Would anybody like to challenge me? KevNick

wd400 as to: "The rest of your post reveals we appear to have a different meaning of the word “gene” in mind. I meant the simplest one, a unit of inheritance."

Landscape of transcription in human cells – Sept. 6, 2012 Excerpt: Here we report evidence that three-quarters of the human genome is capable of being transcribed, as well as observations about the range and levels of expression, localization, processing fates, regulatory regions and modifications of almost all currently annotated and thousands of previously unannotated RNAs. These observations, taken together, prompt a redefinition of the concept of a gene.,,, Isoform expression by a gene does not follow a minimalistic expression strategy, resulting in a tendency for genes to express many isoforms simultaneously, with a plateau at about 10–12 expressed isoforms per gene per cell line. http://www.nature.com/nature/journal/v489/n7414/full/nature11233.html Time to Redefine the Concept of a Gene? - Sept. 10, 2012 Excerpt: As detailed in my second post on alternative splicing, there is one human gene that codes for 576 different proteins, and there is one fruit fly gene that codes for 38,016 different proteins! While the fact that a single gene can code for so many proteins is truly astounding, we didn’t really know how prevalent alternative splicing is. Are there only a few genes that participate in it, or do most genes engage in it? The ENCODE data presented in reference 2 indicates that at least 75% of all genes participate in alternative splicing. They also indicate that the number of different proteins each gene makes varies significantly, with most genes producing somewhere between 2 and 25. Based on these results, it seems clear that the RNA transcripts are the real carriers of genetic information. This is why some members of the ENCODE team are arguing that an RNA transcript, not a gene, should be considered the fundamental unit of inheritance. http://networkedblogs.com/BYdo8 Duality in the human genome - Nov. 28, 2014 Excerpt: The gene, as we imagined it, exists only in exceptional cases. "We need to fundamentally rethink the view of genes that every schoolchild has learned since Gregor Mendel's time. Moreover, the conventional view of individual mutations is no longer adequate. Instead, we have to consider the two gene forms and their combination of variants,",,, "Our investigations at the protein level have shown that 96 percent of all genes have at least 5 to 20 different protein forms.,,, http://medicalxpress.com/news/2014-11-duality-human-genome.html Multiple haplotype-resolved genomes reveal population patterns of gene and protein diplotypes - 26 November 2014 Excerpt Discussion: Our global view of haplotype/diplotype diversity in relation to population size suggests that current efforts are still far from capturing the majority of gene forms and that saturation may not even be achievable. The concept of a predominant, ‘wild-type’ form of ‘the’ gene appears obsolete for over 85% of genes, challenging traditional ‘Mendelian’ views. This highlights the need for an expansion of current concepts of ‘the’ gene^29, along with the development of appropriate documentation and language. The enormous diversity of haploid and diploid gene forms raises fundamental questions concerning the relationships between sequence(s), structure(s) and function(s)^21 http://www.nature.com/ncomms/2014/141126/ncomms6569/full/ncomms6569.html

Towards the latter half of the following podcast, Dr Sternberg, who has a PhD in evolutionary biology, elucidates how the overturning/loss of the ‘gene’ as the central unit of inheritance turns the modern synthesis of neo-Darwinism from a science into no better than the discarded alchemy of yesteryear.

Podcast – Richard Sternberg PhD – On Human Origins: Is Our Genome Full of Junk DNA? Part 5 (emphasis on ENCODE and the loss of the term ‘gene’ as a accurate description in biology and how that loss undermines the modern synthesis of neo-Darwinism) http://www.discovery.org/multimedia/audio/2014/11/on-human-origins-is-our-genome-full-of-junk-dna-pt-5/ The Extreme Complexity Of Genes - Dr. Raymond G. Bohlin https://vimeo.com/106012299 Design In DNA – Alternative Splicing, Duons, and Dual coding genes – video (5:05 minute mark) http://www.youtube.com/watch?v=Bm67oXKtH3s#t=305

bornagain77

Sequencing and assembling genomes is hard, no one in their right ming would think it was the best way to estimate genome size. We know from flow cytometry that the chimp and human genomes are about the same size, the current build of the chimp genome is actually a little longer than the human one The rest of your post reveals we appear to have a different meaning of the word "gene" in mind. I meant the simplest one, a unit of inheritance. I guess you meant just protein coding genes or some other restrictive definition. wd400

here are some supplemental comments/quips as to neutral theory:

Majestic Ascent: Berlinski on Darwin on Trial - David Berlinski - November 2011 Excerpt: The publication in 1983 of Motoo Kimura's The Neutral Theory of Molecular Evolution consolidated ideas that Kimura had introduced in the late 1960s. On the molecular level, evolution is entirely stochastic, and if it proceeds at all, it proceeds by drift along a leaves-and-current model. Kimura's theories left the emergence of complex biological structures an enigma, but they played an important role in the local economy of belief. They allowed biologists to affirm that they welcomed responsible criticism. "A critique of neo-Darwinism," the Dutch biologist Gert Korthof boasted, "can be incorporated into neo-Darwinism if there is evidence and a good theory, which contributes to the progress of science." By this standard, if the Archangel Gabriel were to accept personal responsibility for the Cambrian explosion, his views would be widely described as neo-Darwinian. http://www.evolutionnews.org/2011/11/berlinski_on_darwin_on_trial053171.html

With the adoption of the 'neutral theory' of evolution by prominent Darwinists, and the casting under the bus of Natural Selection as a major player in evolution, William J Murray quips,,,

"One wonders what would have become of evolution had Darwin originally claimed that it was simply the accumulation of random, neutral variations that generated all of the deeply complex, organized, interdependent structures we find in biology? Would we even know his name today? What exactly is Darwin really famous for now? Advancing a really popular, disproven idea (of Natural Selection), along the lines of Luminiferous Aether? Without the erroneous but powerful meme of “survival of the fittest” to act as an opiate for the Victorian intelligentsia and as a rationale for 20th century fascism, how might history have proceeded under the influence of the less vitriolic maxim, “Survival of the Happenstance”?" - William J Murray https://uncommondescent.com/intelligent-design/why-keith-blanchard-really-doesnt-understand-evolution/#comment-510124 Ann Gauger on genetic drift - August 2012 Excerpt: The idea that evolution is driven by drift has led to a way of retrospectively estimating past genetic lineages. Called coalescent theory, it is based on one very simple assumption — that the vast majority of mutations are neutral and have no effect on an organism’s survival. (For a review go here.) According to this theory, actual genetic history is presumed not to matter. Our genomes are full of randomly accumulating neutral changes. When generating a genealogy for those changes, their order of appearance doesn’t matter. Trees can be drawn and mutations assigned to them without regard to an evolutionary sequence of genotypes, since genotypes don’t matter. https://uncommondescent.com/evolution/ann-gauger-on-genetic-drift/ Here is a Completely Different Way of Doing Science - Cornelius Hunter PhD. - April 2012 Excerpt: But how then could evolution proceed if mutations were just neutral? The idea was that neutral mutations would accrue until finally an earthquake, comet, volcano or some such would cause a major environmental shift which suddenly could make use of all those neutral mutations. Suddenly, those old mutations went from goat-to-hero, providing just the designs that were needed to cope with the new environmental challenge. It was another example of the incredible serendipity that evolutionists call upon. Too good to be true? Not for evolutionists. The neutral theory became quite popular in the literature. The idea that mutations were not brimming with cool innovations but were mostly bad or at best neutral, for some, went from an anathema to orthodoxy. And the idea that those neutral mutations would later magically provide the needed innovations became another evolutionary just-so story, told with conviction as though it was a scientific finding. Another problem with the theory of neutral molecular evolution is that it made even more obvious the awkward question of where these genes came from in the first place. http://darwins-god.blogspot.com/2012/04/here-is-completely-different-way-of.html

as to drift

Thou Shalt Not Put Evolutionary Theory to a Test - Douglas Axe - July 18, 2012 Excerpt: "For example, McBride criticizes me for not mentioning genetic drift in my discussion of human origins, apparently without realizing that the result of Durrett and Schmidt rules drift out. Each and every specific genetic change needed to produce humans from apes would have to have conferred a significant selective advantage in order for humans to have appeared in the available time (i.e. the mutations cannot be 'neutral'). Any aspect of the transition that requires two or more mutations to act in combination in order to increase fitness would take way too long (greater than 100 million years). My challenge to McBride, and everyone else who believes the evolutionary story of human origins, is not to provide the list of mutations that did the trick, but rather a list of mutations that can do it. Otherwise they're in the position of insisting that something is a scientific fact without having the faintest idea how it even could be." - Doug Axe PhD. http://www.evolutionnews.org/2012/07/thou_shalt_not062351.html Natural Selection Struggles to Fix Advantageous Traits in Populations - Casey Luskin - October 23, 2014 Excerpt: Michael Lynch, an evolutionary biologist at Indiana University,, writes that "random genetic drift can impose a strong barrier to the advancement of molecular refinements by adaptive processes."2 He notes that the effect of drift is "encouraging the fixation of mildly deleterious mutations and discouraging the promotion of beneficial mutations."3 Likewise, Eugene Koonin, a leading scientist at the National Institutes of Health, explains that genetic drift leads to "random fixation of neutral or even deleterious changes."4 http://www.evolutionnews.org/2014/10/natural_selecti_3090571.html

bornagain77

wd400 at 98, so you do not claim, as is held in the modern synthesis, that Body Plans are determined by DNA??? Really? I'm glad to hear that you do not since it is not true. But if mutations to DNA do not explain how a chimp-like creature can become a human, as they can't explain how it can happen, then why do you pretend as if you have proven how it can happen solely by reference to 15,000,000 mutations to DNA? Since mutations to DNA do NOT effect body plan morphogenesis, do I really need to point the fact out to you that there is a huge, gargantuan, gap in your explanation as to how we got here? A gargantuan gap that is very reminiscent of this cartoon??,,,

'Then a miracle occurs' - cartoon http://www.mcpsonline.org/images/f/f3/And_then_a_miracle_happens_cartoon.jpg

As to your unsubstantiated claim that most mutations are neutral, there are strong empirical and theoretical considerations for believing that there are no truly neutral nucleotide positions.

Unexpectedly small effects of mutations in bacteria bring new perspectives - November 2010 Excerpt: Most mutations in the genes of the Salmonella bacterium have a surprisingly small negative impact on bacterial fitness. And this is the case regardless whether they lead to changes in the bacterial proteins or not.,,, using extremely sensitive growth measurements, doctoral candidate Peter Lind showed that most mutations reduced the rate of growth of bacteria by only 0.500 percent. No mutations completely disabled the function of the proteins, and very few had no impact at all. Even more surprising was the fact that mutations that do not change the protein sequence had negative effects similar to those of mutations that led to substitution of amino acids. A possible explanation is that most mutations may have their negative effect by altering mRNA structure, not proteins, as is commonly assumed. http://www.physorg.com/news/2010-11-unexpectedly-small-effects-mutations-bacteria.html "Moreover, there is strong theoretical reasons for believing there is no truly neutral nucleotide positions. By its very existence, a nucleotide position takes up space, affects spacing between other sites, and affects such things as regional nucleotide composition, DNA folding, and nucleosome building. If a nucleotide carries absolutely no (useful) information, it is, by definition, slightly deleterious, as it slows cell replication and wastes energy.,, Therefore, there is no way to change any given site without some biological effect, no matter how subtle." - John Sanford - Genetic Entropy and The Mystery of The Genome - pg. 21 - Inventor of the 'Gene Gun'

Moreover, neutral theory was not developed because of any empirical observation, but was developed because it was forced upon Darwinism by the mathematics. (i.e. neutral theory is actually the result of a theoretical failure of Darwinism!)

Haldane's Dilemma Excerpt: Haldane was the first to recognize there was a cost to selection which limited what it realistically could be expected to do. He did not fully realize that his thinking would create major problems for evolutionary theory. He calculated that in man it would take 6 million years to fix just 1,000 mutations (assuming 20 years per generation).,,, Man and chimp differ by at least 150 million nucleotides representing at least 40 million hypothetical mutations (Britten, 2002). So if man evolved from a chimp-like creature, then during that process there were at least 20 million mutations fixed within the human lineage (40 million divided by 2), yet natural selection could only have selected for 1,000 of those. All the rest would have had to been fixed by random drift - creating millions of nearly-neutral deleterious mutations. This would not just have made us inferior to our chimp-like ancestors - it surely would have killed us. Since Haldane's dilemma there have been a number of efforts to sweep the problem under the rug, but the problem is still exactly the same. ReMine (1993, 2005) has extensively reviewed the problem, and has analyzed it using an entirely different mathematical formulation - but has obtained identical results. John Sanford PhD. - "Genetic Entropy and The Mystery of the Genome" - pg. 159-160 Walter ReMine on Haldane's Dilemma - interview http://kgov.com/Walter-ReMine-on-Haldanes-Dilemma Kimura's Quandary Excerpt: Kimura realized that Haldane was correct,,, He developed his neutral theory in response to this overwhelming evolutionary problem. Paradoxically, his theory led him to believe that most mutations are unselectable, and therefore,,, most 'evolution' must be independent of selection! Because he was totally committed to the primary axiom (neo-Darwinism), Kimura apparently never considered his cost arguments could most rationally be used to argue against the Axiom's (neo-Darwinism's) very validity. John Sanford PhD. - "Genetic Entropy and The Mystery of the Genome" - pg. 161 - 162

A graph featuring 'Kimura's Distribution' being ‘properly used’ is shown in the following video:

Evolution Vs Genetic Entropy - Andy McIntosh - video https://vimeo.com/91162565

In fact neutral theory is why, against the overwhelming evidence now found for widespread functionality in the genome (i.e. ENCODE etc.. etc..), most neo-Darwinists still insist, against that overwhelming empirical evidence for widespread functionality, that most of the genome must be junk: At the 2:45 minute mark of the following video, the mathematical roots of the junk DNA argument, that is still used by many Darwinists, can be traced through Haldane, Kimura, and Ohno's work in the late 1950’s, 60’s through the early 70’s:

What Is The Genome? It's Not Junk! - Dr. Robert Carter - video - (Notes in video description) http://www.metacafe.com/w/8905583 Carter: Why Evolutionists Need Junk DNA - Robert W. Carter - 2009 Excerpt: Junk DNA is not just a label that was tacked on to some DNA that seemed to have no function, but it is something that is required by evolutionary theory. Mathematically, there is too much variation, too much DNA to mutate, and too few generations in which to get it all done. This was the essence of Haldane's work. Without junk DNA, evolutionary theory cannot currently explain how everything works mathematically. Think about it; in the evolutionary model there have only been 3-6 million years since humans and chimps diverged. With average human generation times of 20-30 years, this gives them only 100,000 to 300,000 generations to fix the millions of mutations that separate humans and chimps. This includes at least 35 million single letter differences, over 90 million base pairs of non-shared DNA, nearly 700 extra genes in humans (about 6% not shared with chimpanzees), and tens of thousands of chromosomal rearrangements. Also, the chimp genome is about 13% larger than that of humans, but mostly due to the heterochromatin that caps the chromosome telomeres. All this has to happen in a very short amount of evolutionary time. They don't have enough time, even after discounting the functionality of over 95% of the genome--but their position becomes grave if junk DNA turns out to be functional. Every new function found for junk DNA makes the evolutionists' case that much more difficult. Robert W. Carter - biologist http://creation.com/junk-dna-slow-death Kimura (1968) developed the idea of “Neutral Evolution”. If “Haldane’s Dilemma” is correct, the majority of DNA must be non-functional.

Here are more detailed refutations of 'neutral theory'

Using Numerical Simulation to Better Understand Fixation Rates, and Establishment of a New Principle - "Haldane's Ratchet" - Christopher L. Rupe and John C. Sanford - 2013 Excerpt: We then perform large-scale experiments to examine the feasibility of the ape-to-man scenario over a six million year period. We analyze neutral and beneficial fixations separately (realistic rates of deleterious mutations could not be studied in deep time due to extinction). Using realistic parameter settings we only observe a few hundred selection-induced beneficial fixations after 300,000 generations (6 million years). Even when using highly optimal parameter settings (i.e., favorable for fixation of beneficials), we only see a few thousand selection-induced fixations. This is significant because the ape-to-man scenario requires tens of millions of selective nucleotide substitutions in the human lineage. Our empirically-determined rates of beneficial fixation are in general agreement with the fixation rate estimates derived by Haldane and ReMine using their mathematical analyses. We have therefore independently demonstrated that the findings of Haldane and ReMine are for the most part correct, and that the fundamental evolutionary problem historically known as "Haldane's Dilemma" is very real. Previous analyses have focused exclusively on beneficial mutations. When deleterious mutations were included in our simulations, using a realistic ratio of beneficial to deleterious mutation rate, deleterious fixations vastly outnumbered beneficial fixations. Because of this, the net effect of mutation fixation should clearly create a ratchet-type mechanism which should cause continuous loss of information and decline in the size of the functional genome. We name this phenomenon "Haldane's Ratchet". http://media.wix.com/ugd/a704d4_47bcf08eda0e4926a44a8ac9cbfa9c20.pdf Neo-Darwinism's Catch-22: Before Evolving New Features, Organisms Would Be Swamped by Genetic Junk - Casey Luskin - April 10, 2015 Excerpt: A new peer-reviewed paper in the journal Complexity presents a computational model of evolution which shows that evolving new biological structures may be deterred by an unavoidable catch-22 problem.,,, This is a bit complex -- let's go over it again. Darwinian evolution either (1) produces nothing new, or (2) it's destined to produce boatloads of deadly junk. In the case of (2), the reward for trying new things is high compared to the cost of building new structures. But in order for the ratio to be high enough for complexity to increase, the cost of building new things must be negligible. Novelties proliferate, but the fraction,, that's vestigial grows, and the organism is eventually swamped and overwhelmed by harmful vestigial features. However, if you try to avoid the problem of (2) by making the reward-to-cost ratio lower, as in (1), then nothing new ever evolves. The authors think real biological organisms are closer to position (1). Indeed, study in the field of systems biology increasingly finds that biological systems contain very little junk.,,, http://www.evolutionnews.org/2015/04/neo-darwinisms_095121.html

bornagain77

Just for the record, I would personally not be surprised if our DNA was once 100% identical with chimps, in the places that share sequence similarity. I fully accept the raw data and agree that where you can align bases between the genomes, they share 99% homology. But that does not mean our genomes are 99% the same - which is the picture it paints to the less discerning/knowledgable on genetics and science in general. I really would honestly not be surprised if a while back, chimps and humans as separate organisms existed where they both contained identical sequences in the alignable regions. Somewhere in Genesis 1-3, for example. Many IDists and even YECs have absolutely no problem with high homology even with chimps. It is hardly unexpected. Dr JDD

JDD, I discussed what the different estiamtes from the literature mean in 17 and 24. The 99% is not a myth, it’s one accurate description of how similar our genes are. The 2.4Gb was the size of the chimp reference genome at that time (representing the work in progress nature of the genome, and the fact the chimp sequence is much worse than either the human or the gorilla). The human and chimps genomes are both about 3.5 pg (I think the best estimate of chimp is 3.45.

WD400, I'm confused. Did they in 2005 believe that the chimp genome was in fact 2.55 Gbp? Were they really nearly ~0.9-0.95Gbp out from what we think now? You state:

The 2.4Gb was the size of the chimp reference genome at that time

And in the publication they state:

The draft genome assembly—generated from ~3.6-fold sequence redundancy of the autosomes and ~1.8-fold redundancy of both sex chromosomes—covers ~94% of the chimpanzee genome with >98% of the sequence in high-quality bases.

So they claim to cover 94% of the chimp genome. They then state:

We set out to study the mutational events that have shaped the human and chimpanzee genomes since their last common ancestor. We explored changes at the level of single nucleotides, small insertions and deletions, interspersed repeats and chromosomal rearrangements. The analysis is nearly definitive for the smallest changes, but is more limited for larger changes, particularly lineage-specific segmental duplications, owing to the draft nature of the genome sequence. Nucleotide divergence Best reciprocal nucleotide-level alignments of the chimpanzee and human genomes cover ~2.4?gigabases (Gb) of high-quality sequence, including 89?Mb from chromosome X and 7.5?Mb from chromosome Y.

So again, I come back to the point - it seems here they are: 1) Stating their OWN results and alignment with the human genome as 2.4Gb of sequence aligned 2) Stating that they cover ~94% of the chimp genome Now if the genome of the chimp is in fact 3.45Gb, then this does not quite add up. Either they should be shot for incredibly bad wording, or you are wrong with what you say, or back in 2005 they significantly underestimated the size of the chimp genome, by 25%. Which is it? Because 3.45 x 0.94 (x 0.98 for high quality) does not equal 2.4. It equals 3.17. So why can they only align 2.4Gb? I don't understand this. Maybe they underestimated the size of the whole chimp genome but that is not clear to me. Secondly, you state:

The 99% is not a myth, it’s one accurate description of how similar our genes are.

Do you really mean that sentence in the implication of its words? Do you understand that people are generally not contesting that notion? I know you have said slightly different elsewhere in the thread but I would have thought you would be more careful if so - not many are contesting that we are 99% identical to chimps in our genes. For we all know the definition of "gene". And barely anyone here will argue with you over our similarity of genes, but rather the genome. Further, the whole point is sloppy science. Many people (I'll exclude you from this as I have read numerous, numerous atheistic evolutionary biologists say this) will state anywhere from 90% same DNA to chimps to 96%, to 98%. These are people who do NOT support ID. Many do not adhere to the 99% line. And yet, even if we were 99% chimps and humans cary dramatically. As said, that is what the contentious point is - that different cannot be simply due to 1% of the genome. If it is, we really do not understand the genome well at all, if it is not, the Darwinian paradigm falls quite flat. So to sloppily say we are "99% the same" as so many pop-science articles do is quite frankly, silly, and shows a brainwash of the media towards the Darwinian worldview as being gospel. Dr JDD

The only assumption in that calculation is the one I stated -- that new mutaitions are selectively neutral. Positive selection of the sort discussed in your links might make more mutations fix, but the neutral rate is equal to the per-individual mutation rate. wd400

wd400 claims:

Well, 30 million differences = 15 million changes in each lineages. Absent selection changes fix at a rate equal to the per-individual mutation rate. Taking a 20 year generation time you have 6 Million years / 20 years/gen = 300 000 generations 15 million mutations / 300 000 generations = 50 mutations/generations Which is pretty much what he observe! Care to withdraw?

What wd400 does not inform people of are the hidden assumptions built into his 'back of the envelope' calculation. One hidden assumption is the claim that changes to DNA can effect body plan morphogenesis, which is a claim he simply has no evidence for:

Response to John Wise - October 2010 Excerpt: A technique called "saturation mutagenesis"1,2 has been used to produce every possible developmental mutation in fruit flies (Drosophila melanogaster),3,4,5 roundworms (Caenorhabditis elegans),6,7 and zebrafish (Danio rerio),8,9,10 and the same technique is now being applied to mice (Mus musculus).11,12 None of the evidence from these and numerous other studies of developmental mutations supports the neo-Darwinian dogma that DNA mutations can lead to new organs or body plans--because none of the observed developmental mutations benefit the organism. http://www.evolutionnews.org/2010/10/response_to_john_wise038811.html

Another hidden assumption in wd400's 'back of the envelope' calculation is that most all of the 15,000,000 mutations will be 'fixed' fairly easily. He simply has no evidence for that assumption:

More from Ann Gauger on why humans didn’t happen the way Darwin said - July 9, 2012 Excerpt: Each of these new features probably required multiple mutations. Getting a feature that requires six neutral mutations is the limit of what bacteria can produce. For primates (e.g., monkeys, apes and humans) the limit is much more severe. Because of much smaller effective population sizes (an estimated ten thousand for humans instead of a billion for bacteria) and longer generation times (fifteen to twenty years per generation for humans vs. a thousand generations per year for bacteria), it would take a very long time for even a single beneficial mutation to appear and become fixed in a human population. You don’t have to take my word for it. In 2007, Durrett and Schmidt estimated in the journal Genetics that for a single mutation to occur in a nucleotide-binding site and be fixed in a primate lineage would require a waiting time of six million years. The same authors later estimated it would take 216 million years for the binding site to acquire two mutations, if the first mutation was neutral in its effect. Facing Facts But six million years is the entire time allotted for the transition from our last common ancestor with chimps to us according to the standard evolutionary timescale. Two hundred and sixteen million years takes us back to the Triassic, when the very first mammals appeared. One or two mutations simply aren’t sufficient to produce the necessary changes— sixteen anatomical features—in the time available. At most, a new binding site might affect the regulation of one or two genes. https://uncommondescent.com/intelligent-design/more-from-ann-gauger-on-why-humans-didnt-happen-the-way-darwin-said/ Experimental Evolution in Fruit Flies (35 years of trying to force fruit flies to evolve in the laboratory fails, spectacularly) - October 2010 Excerpt: "Despite decades of sustained selection in relatively small, sexually reproducing laboratory populations, selection did not lead to the fixation of newly arising unconditionally advantageous alleles.,,, "This research really upends the dominant paradigm about how species evolve," said ecology and evolutionary biology professor Anthony Long, the primary investigator. http://www.arn.org/blogs/index.php/literature/2010/10/07/experimental_evolution_in_fruit_flies http://eebweb.arizona.edu/nachman/Suggested%20Papers/Lab%20papers%20fall%202010/Burke_et_al_2010.pdf

In fact, the types of mutations that will most easily fix are NOT the types of mutations that wd400 needs:

“The First Rule of Adaptive Evolution”: Break or blunt any functional coded element whose loss would yield a net fitness gain - Michael Behe - December 2010 Excerpt: In its most recent issue The Quarterly Review of Biology has published a review by myself of laboratory evolution experiments of microbes going back four decades.,,, The gist of the paper is that so far the overwhelming number of adaptive (that is, helpful) mutations seen in laboratory evolution experiments are either loss or modification of function. Of course we had already known that the great majority of mutations that have a visible effect on an organism are deleterious. Now, surprisingly, it seems that even the great majority of helpful mutations degrade the genome to a greater or lesser extent.,,, I dub it “The First Rule of Adaptive Evolution”: Break or blunt any functional coded element whose loss would yield a net fitness gain. http://behe.uncommondescent.com/2010/12/the-first-rule-of-adaptive-evolution/ Getting There First: An Evolutionary Rate Advantage for Adaptive Loss-of-Function Mutations Michael J. Behe - 2013 http://www.worldscientific.com/doi/pdf/10.1142/9789814508728_0020 Biological Information - Loss-of-Function Mutations by Paul Giem 2015 - video playlist (Behe - Loss of function mutations are far more likely to fix in a population than gain of function mutations) https://www.youtube.com/watch?v=hzD3hhvepK8&index=20&list=PLHDSWJBW3DNUUhiC9VwPnhl-ymuObyTWJ Study demonstrates evolutionary ‘fitness’ not the most important determinant of success – February 7, 2014 – with illustration Excerpt: An illustration of the possible mutations available to an RNA molecule. The blue lines represent mutations that will not change its function (phenotype), the grey are mutations to an alternative phenotype with slightly higher fitness and the red are the ‘fittest’ mutations. As there are so few possible mutations resulting in the fittest phenotype in red, the odds of this mutation are a mere 0.15%. The odds for the slightly fitter mutation in grey are 6.7% and so this is far more likely to fix, and thus to be found and survive, even though it is much less fit than the red phenotype.,,, By modelling populations over long timescales, the study showed that the ‘fitness’ of their traits was not the most important determinant of success. Instead, the most genetically available mutations dominated the changes in traits. The researchers found that the ‘fittest’ simply did not have time to be found, or to fix in the population over evolutionary timescales. http://phys.org/news/2014-02-evolutionary-important-success.html This following headline sums the preceding finding up very nicely: Fittest Can’t Survive If They Never Arrive – February 7, 2014 http://crev.info/2014/02/fittest-cant-survive-if-they-never-arrive/

There is much more that is fallacious in wd400's thinking, but I will leave the refutation of his claim at this stage for the moment and give him a chance to respond to Behe, Gauger and Axe. bornagain77

wd400 is determined to beat a dead horse so, once again, here is Tomkins's paper where the unbiased reader can judge for themselves who is being forthright and who is being biased towards the evidence.

Comprehensive Analysis of Chimpanzee and Human Chromosomes Reveals Average DNA Similarity of 70% by Jeffrey P. Tomkins on February 20, 2013 Abstract Since the original 2005 report for the chimpanzee (chimp) genome assembly (5X rough draft), an additional one-fold redundant coverage has been added. Using the new 6X chimpanzee assembly, a sequential comparison to the human genome was performed on an individual chromosome basis. The chimpanzee chromosomes, were sliced into new individual query files of varying string lengths and then queried against their human chromosome homolog using the BLASTN algorithm. Using this approach, queries could be optimized for each chromosome irrespective of gene/feature linear order. Non-DNA letters (gap filling ‘N’s) were stripped from the query data and excluded from the analyses. The definition of similarity for each chromosome was the amount (percent) of optimally aligned chimp DNA. This definition was considered to be conservative because it did not include the amount of human DNA absent in chimp nor did it include chimp DNA that was not aligned to the human genome assembly (unanchored sequence contigs). For the chimp autosomes, the amount of optimally aligned DNA sequence provided similarities between 66 and 76%, depending on the chromosome. In general, the smaller and more gene-dense the chromosomes, the higher the DNA similarity—although there were several notable exceptions defying this trend. Only 69% of the chimpanzee X chromosome was similar to human and only 43% of the Y chromosome. Genome-wide, only 70% of the chimpanzee DNA was similar to human under the most optimal sequence-slice conditions. While, chimpanzees and humans share many localized protein-coding regions of high similarity, the overall extreme discontinuity between the two genomes defies evolutionary timescales and dogmatic presuppositions about a common ancestor. https://answersingenesis.org/answers/research-journal/v6/comprehensive-analysis-of-chimpanzee-and-human-chromosomes/

Please note that ORFans were excluded from the above analysis: (i.e. This definition was considered to be conservative because it did not include the amount of human DNA absent in chimp nor did it include chimp DNA that was not aligned to the human genome assembly (unanchored sequence contigs).) And here is another recent paper by Tomkins which underscores the point made in the previous paper:

Comparison of the Transcribed Intergenic Regions of the Human Genome to Chimpanzee - Jeffrey P. Tomkins - 2014 Abstract: The human genome is pervasively transcribed and produces a wide array of long noncoding RNAs that have been implicated in gene regulation, chromatin modification, nuclear organization, and scaffolding for functionally active protein complexes. Of particular interest in human origins is the long and very long intergenic noncoding RNAs transcribed from genomic regions outside protein coding genes. These are known as lincRNA and vlincRNA, respectively. Linc­RNA regions of the genome are more taxonomically restricted than protein coding segments and make logical candidates for research in genomic discontinuity. This report describes the comparative use of three different human lincRNA datasets and one vlincRNA dataset to the chimpanzee genome using the BLASTN algorithm. Short human lincRNA genomic regions (less than 600 bases) were about 75–79% similar to chimpanzee, while the larger lincRNA regions (greater than 600 bases) were about 71 to 74% similar. The human vlincRNA genomic regions were only 67% similar to chimpanzee. In contrast, all known human protein coding exons 300 to 599 bases in length, are 86% similar to chimpanzee. https://www.creationresearch.org/images/CRSQ-PDFs/Public-Articles/CRSQ-50-04-Tomkins.pdf

And here is a repost of the video interview of Tomkins where a person can see for themselves the integrity and professionalism with which Tomkins conducts himself.

The Myth of 98% Genetic Similarity between Humans and Chimps – Jeffrey Tomkins PhD. – video https://vimeo.com/95287522

bornagain77

unwilling participant- Dr Denton puts that to rest in his article in "Uncommon Dissent":

To understand the challenge to the “superwatch” model by the erosion of the gene-centric view of nature, it is necessary to recall August Weismann’s seminal insight more than a century ago regarding the need for genetic determinants to specify organic form. As Weismann saw so clearly, in order to account for the unerring transmission through time with precise reduplication, for each generation of “complex contingent assemblages of matter” (superwatches), it is necessary to propose the existence of stable abstract genetic blueprints or programs in the genes- he called them “determinants”- sequestered safely in the germ plasm, away from the ever varying and destabilizing influences of the extra-genetic environment. Such carefully isolated determinants would theoretically be capable of reliably transmitting contingent order through time and specifying it reliably each generation. Thus, the modern “gene-centric” view of life was born, and with it the heroic twentieth century effort to identify Weismann’s determinants, supposed to be capable of reliably specifying in precise detail all the contingent order of the phenotype. Weismann was correct in this: the contingent view of form and indeed the entire mechanistic conception of life- the superwatch model- is critically dependent on showing that all or at least the vast majority of organic form is specified in precise detail in the genes. Yet by the late 1980s it was becoming obvious to most genetic researchers, including myself, since my own main research interest in the ‘80s and ‘90s was human genetics, that the heroic effort to find information specifying life’s order in the genes had failed. There was no longer the slightest justification for believing there exists anything in the genome remotely resembling a program capable of specifying in detail all the complex order of the phenotype. The emerging picture made it increasingly difficult to see genes as Weismann’s “unambiguous bearers of information” or view them as the sole source of the durability and stability of organic form. It is true that genes influence every aspect of development, but influencing something is not the same as determining it. Only a small fraction of all known genes, such as the developmental fate switching genes, can be imputed to have any sort of directing or controlling influence on form generation. From being “isolated directors” of a one-way game of life, genes are now considered to be interactive players in a dynamic two-way dance of almost unfathomable complexity, as described by Keller in The Century of The Gene.

It's not the genes. It ain't the genome. It ain't the same ole genes used differently. And that is the main reason why evolutionism is a failure. In his book (English title) “Why is a Fly not a Horse?”, the prominent Italian geneticist Giuseppe Sermonti, tells us the following : Chapter VI “Why is a Fly not a horse?” (same as the book’s title)

”The scientist enjoys a privilege denied the theologian. To any question, even one central to his theories, he may reply “I’m sorry but I do not know.” This is the only honest answer to the question posed by the title of this chapter. We are fully aware of what makes a flower red rather than white, what it is that prevents a dwarf from growing taller, or what goes wrong in a paraplegic or a thalassemic. But the mystery of species eludes us, and we have made no progress beyond what we already have long known, namely, that a kitty is born because its mother was a she-cat that mated with a tom, and that a fly emerges as a fly larva from a fly egg.”

Joe

I think that genes do determine “what” will develop. The environment can only have an impact on how these genes are expressed

They do not know where the instructions are for construction of a complex organism. They are somewhere in the egg but they are not sure where. Probably in cellular wall. jerry

Joe: "There aren’t any such genes. What makes us human is not found in the genes nor how they are regulated. Genes influence development but they do not determine what will develop." I don't see how you figure this. If you implant a tiger fetus in a lion, the outcome is a tiger. I think that genes do determine "what" will develop. The environment can only have an impact on how these genes are expressed. unwilling participant

What shall we say about the genes which make us human?

There aren't any such genes. What makes us human is not found in the genes nor how they are regulated. Genes influence development but they do not determine what will develop. Joe

Found reference: www.asa3.org/ASA/meetings/belmont2013/papers/ASA2013Wilcox.pdf One of the things it says is that the regulatory nature in the human genome is extremely more complex than the next species. Here is a quote:

What shall we say about the genes which make us human? We and chimps share 96% to 99% of our protein coding sequences. Why are we different? Not the 1.5% of our genome that codes for proteins but the 98.5% that controls their production. Literally, no other primate lineage has evolved as fast as our lineage has during the last 1.5 million years, and it’s all due to unique changes in our control genome. At least 80% probably more of our “non-coding” genome is also transcribed, starting from multiple start points, transcribed in both directions, with overlapping reading frames of many sizes and a whole spectrum of alterations, producing a whole zoo of ‘new’ types of RNA control elements – piRNA,siRNA, miRNA,sdRNA, xiRNA, moRNA, snoRNA, MYS-RNA, crasiRNA, TEL-sRNA, PARs, and lncRNA. Most of these unique RNA transcripts – and there are thousands, if not millions of them – are uniquely active in developing human neural tissue – uniquely active compared to their activity in chimpanzees, much less other primates or mammals. It is the new epigenetic world

jerry

What a lot of noise. Q,

I see. So is this the data that wd400 has been referencing that shows that the parts of human DNA that matches chimpanzee DNA matches up extremely closely?

Nope, i've linked to the raw data several times. Anyone that wants to check it out can.

* What percent of closely matching dolphin DNA matches that of human DNA? * And what percent of closely matching dolphin DNA matches chimpanzee DNA? * Is this technique broadly used to determine evolutionary relationships?

About 75%. About 75%. Not really, but that both chimps and humans (and organs and gorillas and monkeys...) have about the same similatity to a all the ungulates (dolphins included) is certainly easier to explain under common descent than other proposals.

Even if there was a 99% similarity between chimes and humans which there aren’t it still means a staggering 30 000 00 base pair difference. Consider that our last common ancestor lived a about 6 000 000 years ago Darwinism still can’t explain the amount of changes in such a short geological blink of time. WD400 the floor is yours. Enlighten us.

Well, 30 million differences = 15 million changes in each lineages. Absent selection changes fix at a rate equal to the per-individual mutation rate. Taking a 20 year generation time you have 6 Million years / 20 years/gen = 300 000 generations 15 million mutations / 300 000 generations = 50 mutations/generations Which is pretty much what he observe! Care to withdraw? JDD, I discussed what the different estiamtes from the literature mean in 17 and 24. The 99% is not a myth, it's one accurate description of how similar our genes are. The 2.4Gb was the size of the chimp reference genome at that time (representing the work in progress nature of the genome, and the fact the chimp sequence is much worse than either the human or the gorilla). The human and chimps genomes are both about 3.5 pg (I think the best estimate of chimp is 3.45. wd400

i am writing from an iPad and away from home so am limited in resources. I believe the really big differences between chimps and humans are in the control mechanisms not in the protein coding sequences. Especially the control of neural areas of the brain. jerry

Mung:

wd400: What interests me is how anti-scientific movements propagate. Then why are you wasting your time at this site? Go find a movement that’s anti-science.

The astonishing thing is that Darwinism is the most anti-scientific movement in the history of humanity. Mapou

wd400: What interests me is how anti-scientific movements propagate. Then why are you wasting your time at this site? Go find a movement that's anti-science. Mung

The post by Timaeus @76 is well worth reading. Mung

Timaeus:

Indeed, the whole AGW propaganda machine has been an object lesson in how to spread extremely shaky science (mathematical models based on many questionable factual assumptions and at most about a 20% understanding of the complex causes of global climate change) and get it treated by the intelligentsia of the West as Gospel truth.

Meanwhile the Zombie threat is very real: The Equation That Can Help Predict Zombie Migration Patterns Mung

KevNick

Since Darwinists believe that the evolution is all about genes, why can’t they tweak the chimpanzee genome in the lab and make it at least to wipe after they take a dump?

I don't think that this is what evolutionists believe. It is my understanding that they believe it is about the affect of the environment on the expression of genes. unwilling participant

KevNick

Do you know how embarrassing it was for my son’s biology teacher to have to explain to elementary schoolkids

I find evolutionists to be very embarrassing. But they don't seem to care about such things. Seversky asked this:

Why are people so offended by the prospect of being closely related to chimpanzees?

It's hard to believe this is a serious question. A five year old knows the answer. If I say, "you look and act like a chimpanzee" - there's nothing to be offended about? Evolutionism is embarrassing - and really stupid. Silver Asiatic

Querius although I can't give firm answers to your important questions at 71, none-the-less, here is Rana's quote in full context:

DNA Comparisons between Humans and Chimps: A Response to the Venema Critique of the RTB Human Origins Model, Part 2 - 2010 Excerpt: This figure, however, overestimates genetic similarity. When performing the comparison, the researchers examined only about 2.4 billion base pairs, which represent around 75 to 80 percent of the genomes. As the authors note:

Best reciprocal nucleotide-level alignments of the chimpanzee and human genomes cover ~2.4 gigabases (Gb) of high-quality sequence, including 89 Mb from chromosome X and 7.5 Mb from chromosome Y.9

The reason for this limited comparison stems from the fact that they struggled to get a significant fraction of the genomes to align, in part, because of differences. The authors of the study described the nature of the difficulties:

On the basis of comparisons with the primary donor, some small supercontigs (most <5 kb) have not been positioned within large supercontigs (~1 event per 100 kb); these are not strictly errors but nonetheless affect the utility of the assembly. There are also small, undetected overlaps (all less than 1 kb) between consecutive contigs (~1.2 events per 100 kb) and occasional local misordering of small contigs (~0.2 events per 100 kb). No misoriented contigs were found. Comparison with the finished chromosome 21 sequence yielded similar discrepancy rates (see Supplementary Information “Genome sequencing and assembly”). The most problematic regions are those containing recent segmental duplications. Analysis of BAC clones from duplicated (n = 75) and unique (n = 28) regions showed that the former tend to be fragmented into more contigs (1.6-fold) and more supercontigs (3.2-fold). Discrepancies in contig order are also more frequent in duplicated than unique regions (~0.4 versus ~0.1 events per 100 kb). The rate is twofold higher in duplicated regions with the highest sequence identity (greater than 98%). If we restrict the analysis to older duplications (less than/equal to 98% identity) we find fewer assembly problems: 72% of those that can be mapped to the human genome are shared as duplications in both species. These results are consistent with the described limitations of current WGS assembly for regions of segmental duplication.10

Given that the reason for the investigation’s failure to align 0.6 to 0.8 billion base pairs in the two genomes stems from the extensive genetic differences, it is unlikely that these regions display only a 3 percent difference, as is the case for the rest of the genomes. Instead the genetic difference in these regions must be greater. When this greater genetic difference is considered, it is reasonable to conclude that the overall difference between humans and chimpanzees is less than 97 percent and may well be as low as about 90 percent. In direct response to Venema’s criticisms, this is why we state the genetic similarity between humans and chimpanzees may be as low as 90 percent, not 95. Earlier work presaged the Chimpanzee Sequencing and Analysis Consortium’s struggle in their attempts to align large regions of the human and chimp genomes. In early 2002, The International Consortium for the Sequencing of Chimpanzee Chromosome 22 reported one of the first studies to make a large scale genome-to-genome comparison.11 To make this comparison, the Chimpanzee Genome Project team cut the chimp genome into fragments, sequenced them, then compared them to corresponding sequences found in the Human Genome Database. The team found that those chimp DNA fragments able to align with human sequences displayed a 98.77 percent agreement. However, the researchers also found that about 15,000 of the 65,000 chimp DNA fragments did not align with any sequence in the Human Genome Database. These fragments appeared to represent unique genetic regions. Furthermore, during a detailed comparison of the chimp DNA fragments with human chromosome 21, the team discovered that this human chromosome possesses two regions apparently unique to humans. A few months later, a team from the Max Planck Institute achieved a similar result when they compared over 10,000 regions (encompassing nearly 3,000,000 nucleotide base pairs). Only two-thirds of the sequences from the chimp genome aligned with the sequences in the human genome. As expected in those that did align, a 98.76 percent genetic similarity was measured—yet one-third found no matches.12 It is interesting that when evolutionary biologists discuss genetic comparisons between human and chimpanzee genomes, the fact that, again, as much as 25 percent of the two genomes won’t align receives no mention. Instead, the focus is only on the portions of the genome that display a high-degree of similarity. This distorted emphasis makes the case for the evolutionary connection between humans and chimps seem more compelling than it may actually be. In many respects this discussion is moot, unless there is a clear understanding as to how the genetic differences between humans and chimpanzee translate into the biological and profound behavioral differences between these two species. http://www.reasons.org/articles/dna-comparisons-between-humans-and-chimps-a-response-to-the-venema-critique-of-the-rtb-human-origins-model-part-2

bornagain77

If we are 99% genetically identical, why don't we look, think and most of all behave 99% identically? Since Darwinists believe that the evolution is all about genes, why can't they tweak the chimpanzee genome in the lab and make it at least to wipe after they take a dump? Do you know how embarrassing it was for my son’s biology teacher to have to explain to elementary schoolkids why a chimpanzee, 99% genetically identical to us and our closest living relative, first takes a dump in front of hundreds of people in the zoo and then doesn't even wipe? KevNick

The myth persists because some people want to think that there is only a 1% difference between chimp and human. We're 99% the same. But the difference between human and chimp is so great it cannot be measured. The two are an infinite distance apart. Genetic properties do not tell the story of what a human person is. Silver Asiatic

wd400:

I’d/creationism lost long ago.

What? You don't have a viable alternative so YOU lose. Joe

Timaeus: I pretty much completely agree with you in the sense that what the number is doesn't matter too much anddoes not prove one side of tthe argument. At worst for materialists even if the number was much lower than stated the time lines or rates of evolutionary change and the neutral theory would have to change to accommodate the number of mutations required. But it won't change much. my issue as a scientist is accuracy and truth. What I will argue about is that, and where ID comes in my argument lies with interpretation of truth (observable facts) and assigning how well observations fit hypotheses. so as such, the only concern I have is who is being most honest here. It boils down to someone letting their worldview lead the number they give rather than simply what is the number. This isn't a debate about what you interpret from a number or hypothesise what happened over time, in this case rather it us a debate as to what are the observable FACTS. And are those facts being misrepresented by one or both sides of a debate to advance a worldview. That is what this story is about. If indeed it has been shown chimps and human genomes differ by <99% then the question is why is it still commonly quoted as fact? Additionally I am more than happy to disagree with fellow IDers about the low end estimates if their methods are flawed. I'm not bothered if it is 99% or not. But I won't compromise on truth, honesty or deceptive methods to advance my own worldview even if the argument is very powerful to support my view. Dishonesty is wrong and lacks integrity. Sadly it happens on both sides. But the reason we have to fight for transparency is so that those seeking truth aren't fed misinformation and have the facts before them in honest and we'll reasoned arguments. Dr JDD

wd400: If you're interested in how anti-science propagates, study the hacked Climategate emails. No greater betrayal of the very spirit of science can be imagined. Indeed, the whole AGW propaganda machine has been an object lesson in how to spread extremely shaky science (mathematical models based on many questionable factual assumptions and at most about a 20% understanding of the complex causes of global climate change) and get it treated by the intelligentsia of the West as Gospel truth. You don't need evidence. You just keep repeating the same mantras ("the science is in"), demonize honest scientific dissent (they are all "deniers"), etc. If you keep on doing that, nobody will notice that the temperature has flatlined for years, that it failed to go up again after 2011 as predicted, that the Antarctic ice is recovering, that Eastern North America has shivered in the past two winters as it hasn't since the 1970s, that water mains are breaking on their own street in the winter, right in front of their noses, that never broke before, etc. Slogans, properly spread, will trump sense-evidence any time. Timaeus

bornagain: I can't verify your arguments as I haven't studied the technical material. I'm not familiar enough with the various methods that are used to measure similarity and dissimilarity. But supposing for the sake of argument your numbers are correct, then indeed, as you say, wd400's argument here is in even worse shape than I suppose. I suspect that, when all the dust of partisanship has cleared, the actual numbers accepted by just about everyone will be somewhere between the lowball numbers accepted by creationists and the ultra-high numbers accepted by the atheists. Somewhere in the 90s, I would say. But even a number in the 90s could not by itself prove common descent; and even if it could prove common descent, it could not refute design. wd400 apparently thinks that the higher the number, the worse the consequences for ID. But that's simply not true. I have nothing against you or others carrying on a fight for numbers lower than 99%, if that is what the empirical evidence warrants. If the atheists and materialists are wrong about the number, they should be corrected. But I always brace myself for the "worst" possible outcome. What if, after another 20 years of argument, the number were demonstrated to be 99%? Would any of my current views change? And the answer is, no. Even at 99% I could still deny common descent (if I wanted to, though I have no interest in doing so), and even at 99% I could still argue for design. And even at 99% I could still argue that chimpanzees are so obviously qualitatively different from human beings that all this stuff about chimps having lawyers to guarantee their rights is utter rubbish. My problem with these battles over the percentage is that I think that underlying them is still the old opposition of "creation versus evolution." I think that the creationists want to minimize the number because they think that creates a "gap" that makes human evolution impossible, and I think the atheists want to maximize the number because they think that closes all the "gaps" and makes evolution certain. But my whole motive for entering these debates is to argue that this is not the right opposition, that the opposition should be "design versus chance." Once design is established, the truly important question has been settled. So I'm neither going to accede to wd400's demand that I persuade others here to stop talking about numbers (if his numbers are wrong, he deserves to be contradicted), nor will I endorse lengthy debates by Christians motivated by the desire to keep the numbers lower than 99% at any intellectual cost. I think much more important questions than genome similarity include how new body plans are formed, why the universe is fine-tuned, etc. I think those are the things ID should be concentrating on. I think genome similarity is a red herring, which misleads people on both sides. Timaeus

Another question for anyone who knows the accurate measurements: 1) What is the accurate number of bp for the entire homo sapiens genome 2) What is the accurate number of bp for the entire pan troglodytes genome Thanks Dr JDD

wd400 - why do you hold so strongly to the 99% figure? Of course it doesn't really matter, but the point is good vs bad science. Why do you reject papers from even 10 years ago which demonstrate it at 96%? You say "what's 3%" but when you are talking about giba bp any percent is significant. Are those papers wrong? Note - written by evolutionary biologists. http://genome.cshlp.org/content/15/12/1746.full

"The difference between the two genomes is actually not ?1%, but ?4%—comprising ?35 million single nucleotide differences and ?90 Mb of insertions and deletions"

That was 10 years ago. Is it incorrect? Now I agree, if in fact Tompkins analysis aligns as you give an example above, short sequences without taking into account gaps for indels - is an incorrect way of measuring homology. So I am wary of that 70% figure and the best answer I have heard from him was simply a refutation by saying someone cannot compare by doing a simple armchair analysis. I have not heard an answer to the challenge about that particular issue, if in fact that is how he arose to his figure. However to not budge on 99% when many non-ID scientists wouldn't even quote 99% but would say ">90%" is a bit odd to me. What do you make of this statement then: "Best reciprocal nucleotide-level alignments of the chimpanzee and human genomes cover ~2.4?gigabases (Gb) of high-quality sequence, including 89?Mb from chromosome X and 7.5?Mb from chromosome Y." http://www.nature.com/nature/journal/v437/n7055/full/nature04072.html Does this not mean that only 2.4billion of the 3.2billion human base pairs in the genome could be aligned? If so, what to say about that 25% of the human genome sequence? Why could it not be aligned to the chimp genome, if in fact, it was 99% similar? Or even 96% similar? Why could 25% of the human genome not be aligned with chimp? Bear in mind 94% of the chimp genome was covered with 98% being high quality. Thanks Dr JDD

Even if there was a 99% similarity between chimes and humans which there aren't it still means a staggering 30 000 00 base pair difference. Consider that our last common ancestor lived a about 6 000 000 years ago Darwinism still can't explain the amount of changes in such a short geological blink of time. WD400 the floor is yours. Enlighten us. Andre

WD400:

I’d/creationism lost long ago.

So why do you care? What are you continually foaming at the mouth about if you already won? Inquiring minds and all that. Mapou

bornagain77 relates

Fazale Rana Excerpt: It is interesting that when evolutionary biologists discuss genetic comparisons between human and chimpanzee genomes, the fact that, again, as much as 25 percent of the two genomes won’t align receives no mention. Instead, the focus is only on the portions of the genome that display a high-degree of similarity.

I see. So is this the data that wd400 has been referencing that shows that the parts of human DNA that matches chimpanzee DNA matches up extremely closely? A single data point shows little, so one is tempted to ask * What percent of closely matching dolphin DNA matches that of human DNA? * And what percent of closely matching dolphin DNA matches chimpanzee DNA? * Is this technique broadly used to determine evolutionary relationships? Just asking. -Q Querius

Timaeus, While I certainly agree that the broader points that you are trying to bring out, and which wd400 refuses to discuss, (since they 'uncomfortably' falsify neo-Darwinism), are very important, even the narrow point that wd400 is trying to defend is not even right on the 'narrow, science geeky point of view' he would like to make. ORFan genes by themselves refute his 99% claim for protein coding regions (by anywhere from a 10% to 40% margin, nobody really has a firm clue yet).

Finding Protein-Coding Genes through Human Polymorphisms – January 2013 Excerpt: We found 5,737 putative protein-coding genes that do not exist in the reference, whose protein-coding status is supported by homology to known proteins. On average 10% of these genes are located in the genomic regions devoid of annotated genes in 12 other catalogs. Our statistical analysis showed that these ORFs are unlikely to occur by chance. http://www.plosone.org/article/info:doi/10.1371/journal.pone.0054210 Mechanisms and dynamics of orphan gene emergence in insect genomes – January 2013 Excerpt: Orphans are an enigmatic portion of the genome since their origin and function are mostly unknown and they typically make up 10 to 30% of all genes in a genome. http://gbe.oxfordjournals.org/content/early/2013/01/24/gbe.evt009.full.pdf+html “However, with the advent of sequencing of full genomes, it became clear that approximately 20–40% of the identified genes could not be associated with a gene family that was known before. Such genes were originally called ‘orphan’ genes” http://ccsb.dfci.harvard.edu/web/export/sites/default/ccsb/publications/papers/2013/Tautz_eLS_2013.pdf

Of related interest to the large percentages of ORFan genes being found in ALL genomes is the disingenuous way that neo-Darwinists try to 'explain away' these dissimilar, non-Darwinian, sequences that are being found throughout the supposed tree of life

Another Horizontal Gene Transfer Fairy Tale by Jeffrey P. Tomkins, Ph.D. – April 6, 2015 http://www.icr.org/article/another-horizontal-gene-transfer-fairy

Moreover, wd400's claim that the entire genomes, not simply protein coding regions, of chimps and humans are 99% similar is simply, for lack of a better term at this point of dealing with wd400's continued misrepresentations of the evidence, a bald face lie.

DNA Comparisons between Humans and Chimps – Fazale Rana Excerpt: It is interesting that when evolutionary biologists discuss genetic comparisons between human and chimpanzee genomes, the fact that, again, as much as 25 percent of the two genomes won’t align receives no mention. Instead, the focus is only on the portions of the genome that display a high-degree of similarity. This distorted emphasis makes the case for the evolutionary connection between humans and chimps seem more compelling than it may actually be.

The only way that a 99% similarity figure for entire genome comparisons can possibly be reached is by Darwinists presupposing common ancestry as true and then filtering the data to accord with that presupposition. And that is in fact what they do.

Contradictory Trees: Evolution Goes 0 For 1,070 – Whif – Cornelius Hunter Excerpt: One of evolution’s trade secrets is its prefiltering of data to make it look good, but now evolutionists are resorting to postfiltering of the data as well.,,, Prefiltering is often thought of merely as cleaning up the data. But prefiltering is more than that, for built-in to the prefiltering steps is the theory of evolution. Prefiltering massages the data to favor the theory. The data are, as philosophers explain, theory-laden. But even prefiltering cannot always help the theory.,,, http://darwins-god.blogspot.com/2013/06/contradictory-trees-evolution-goes-0.html Comprehensive Analysis of Chimpanzee and Human Chromosomes Reveals Average DNA Similarity of 70% by Jeffrey Tomkins on February 20, 2013 Excerpt: there is a great deal of preferential and selective treatment of the data being analyzed. In many cases, only the most promising data such as gene-rich sequences that exist in both species (homologs) is utilized from a much larger data pool. This pre-selected data is often further subjected to more filtering before being analyzed and discussed. Non-alignable regions and large gaps in DNA sequence alignments are also typically omitted, thus increasing the levels of reported similarity. https://answersingenesis.org/answers/research-journal/v6/comprehensive-analysis-of-chimpanzee-and-human-chromosomes/ The Myth of 98% Genetic Similarity between Humans and Chimps – Jeffrey Tomkins PhD. – video https://vimeo.com/95287522

Thus Timeus, since wd400 can't even be honest with the ‘narrow, science geeky point of view’ on his false 99% figure, I really don't see why anyone should expect him to be honest on the more important matters that more directly falsify his worldview. He simply does not care for the truth. bornagain77

I'm not the least bit interested in scoring points. I'd/creationism lost long ago. What interests me is how anti-scientific movements propigate. This is a great example, a cut and dried that is labeled a "myth" by many IDers and creationists! As I say, the torrent of links BA can provide to oppose so simple a finding is remarkable testament to how easy it is to find comforting "evidence", and why doing so is such a bad idea. wd400

wd400: I don’t care about that. Mung

wd400: You are right; you are not obliged to reply to anything anyone here says beyond what interests you. But clearly what interests you is polemics -- scoring points against ID from a narrow, science-geeky point of view. If you were a person of broader intellectual sympathies, you might find statements that go beyond narrow technical points (e.g., 94% versus 99%) and into broader considerations (like whether mere amount of genomic similarity establishes anything important) to be actually interesting and worth pursuing. You might actually learn something from reflecting upon such statements. Timaeus

wd400: the 99% thing isn’t a myth. So? Why do you care? Why does it matter? Even if it's true, you still have no response to Timaeus. wd400:

timeaus: a whole bunch of other stuff

Timaeus: It’s not how similar the genomes are, it’s the inferences we draw from the similarity. wd400: I don’t care about that. indeed Mung

wd400:

wd400: the 99% thing isn’t a myth. That so many of you are ready to believe that it is demonstrates the danger of seeking out ‘facts’ that suit your own opinions.

Kind of like the way you want it to be 99% to suit your biased opinion, eh? Problem is, even 99% is not evidence for Darwinian evolution. Mapou

unwilling:

That is why I say that comparing to human design is not likely to be productive in concluding that design is the best explanation for any structure other than for structures designed and built by humans. To get beyond this, we must free ourselves of this bias.

You need to look at this from a different perspective. Intelligent design is not a conclusion. It is THE hypothesis. From this hypothesis we predict several things such as specified complexity, irreducibility, lateral inheritance and a hierarchical organization of the designs over time. From the predictions we can conduct experiments to find evidence for the hypothesis. This is why ID is falsifiable. And guess what? The evidence corroborates the ID hypothesis. Mapou

wd400 you claim that the dolphin genome is not even close to being “identical” to the human, You are, once again, completely wrong in your claim i.e. this time your 'not even wrong' claim is 'not even close' context is everything, so I will quote Sternberg in full:

On Human Origins: Is Our Genome Full of Junk DNA? Pt 2. - Richard Sternberg PhD. Evolutionary Biology Excerpt: "Here's the interesting thing, when you look at the protein coding sequences that you have in your cell what you find is that they are nearly identical to the protein coding sequences in of a dog, of a carp, of a fruit fly, of a nematode. They are virtually the same and they are interchangeable. You can knock out a gene that encodes a protein for an inner ear bone in say a mouse. This has been done. And then you can take a protein that is similar to it but from a fruit fly. And fruit flies aren't vertebrates and they certainly are not mammals., so they don't have inner ear bones. And you can plug that gene in and guess what happens? The offspring of the mouse will have a perfectly normal inner ear bone. So you can swap out all these files. I mentioning this to you because when you hear about we are 99% similar (to chimps) it is almost all referring to those protein coding regions. When you start looking, and you start comparing different mammals. Dolphins, aardvarks, elephants, manatees, humans, chimpanzees,, it doesn't really matter. What you find is that the protein coding sequences are very well conserved, and there is also a lot of the DNA that is not protein coding that is also highly conserved. But when you look at the chromosomes and those banding patterns, those bar codes, (mentioned at the beginning of the talk), its akin to going into the grocery store. You see a bunch of black and white lines right? You've seen one bar code you've seen them all. But those bar codes are not the same.,, Here's an example, aardvark and human chromosomes. They look very similar at the DNA level when you take small snippets of them. When you look at how they are arranged in a linear pattern along the chromosome they turn out to be very distinct (from one another). So when you get to the folder and the super-folder and the higher order level, that's when you find these striking differences. And here is another example. They are now sequencing the nuclear DNA of the Atlantic bottle-nose dolphin. And when they started initially sequencing the DNA, the first thing they realized is that basically the Dolphin genome is almost wholly identical to the human genome. That is, there are a few chromosome rearrangements here and there, you line the sequences up and they fit very well. Yet no one would argue, based on a statement like that, that bottle-nose dolphins are closely related to us. Our sister species if you will. No one would presume to do that. So you would have to layer in some other presumption. But here is the point. You will see these statements throughout the literature of how common things are.,,, (Parts lists are very similar, but how the parts are used is where you will find tremendous differences) http://www.discovery.org/multimedia/audio/2014/11/on-human-origins-is-our-genome-full-of-junk-dna-pt-2/

Thus wd400 faces quite the dilemma, there is found to be far more dissimilarity than he wishes there to be for chimps and humans and far too much similarity for dolphins and humans. All of this on top of the fact that mutations to DNA do not even effect basic body plan plasticity in the first place. Just keep lying to yourself and others wd400, maybe you can make the truth go away! :) Personally I'm sure you will fail ! bornagain77

BA, Here's the dolphin genome, it's not even close to being "identical" to the human one: http://uswest.ensembl.org/Tursiops_truncatus/Info/Index But by all means, keep embarrassing yourself. Mung, It's more like wd400: the 99% thing isn't a myth. That so many of you are ready to believe that it is demonstrates the danger of seeking out 'facts' that suit your own opinions. Also, BA, just stop. timeaus: a whole bunch of other stuff wd400

Mapou: "Your argument is incoherent, IMO. First we know many designers, i.e., humans from all over the globe." I'm afraid that I have to disagree. You are correct if we were looking at what we think is a man made artifact and extrapolating from what we have observed from thousands (or millions) of human designers. But this technique only has power to reasonably identify human made designs. Since we have no idea how a non human designer of biological structures could facilitate the design and "manufacture" of a biological structure, we have nothing to compare against. That is why I say that comparing to human design is not likely to be productive in concluding that design is the best explanation for any structure other than for structures designed and built by humans. To get beyond this, we must free ourselves of this bias. unwilling participant

REC: See here. Mung

"I’d rather be related to slime than a chimp! Who’s with me" I'm with you Mung. I find it appealing I'm 50% Banana. Uplifting that I have Bird DNA. Lion DNA? Makes me feel regal. Not happy I have broccoli DNA. My spider DNA creeps me out, not feel like superhero no. Chimp DNA makes me want to shower. That's just me though. ppolish

unwilling (emphasis added):

We cannot rely on comparing what we see in biology to all known designers because we only know of one designer, humans. To be taken seriously we have to stop using this comparison.

Your argument is incoherent, IMO. First we know many designers, i.e., humans from all over the globe. Second, it has nothing to do with the species of the designers or where they come from but whether or not they are intelligent. The ID hypothesis is about both intelligence and design. It makes logical sense to reuse existing designs especially if there are only a few ways to do certain things due to environmental constraints. Reinventing the wheel every time one makes a new wheel is not particularly intelligent. It is stupid. Mapou

Jim@44 You've misread the paper. Try again. REC

Let me try my best to provide an accurate summary. wd400: It's of utmost importance that we admit to just how similar are the genomes of humans and chimps. Timaeus: It's not how similar the genomes are, it's the inferences we draw from the similarity. wd400: I don't care about that. Mung

as to some regions of genomic similarity being high, I repeat these facts:

Richard Sternberg PhD – podcast – On Human Origins: Is Our Genome Full of Junk DNA? Part 2. (Major Differences in higher level chromosome spatial organization) 5:30 minute mark quote: “Basically the dolphin genome is almost wholly identical to the human genome,, yet no one would argue that bottle-nose dolphins are our sister species”,,, http://www.discovery.org/multimedia/audio/2014/11/on-human-origins-is-our-genome-full-of-junk-dna-pt-2/ Kangaroo genes close to humans Excerpt: Australia’s kangaroos are genetically similar to humans,,, “There are a few differences, we have a few more of this, a few less of that, but they are the same genes and a lot of them are in the same order,” ,,,”We thought they’d be completely scrambled, but they’re not. There is great chunks of the human genome which is sitting right there in the kangaroo genome,” http://www.reuters.com/article/science%20News/idUSTRE4AH1P020081118

Thus once again, similarity in certain regions of the genome is not the be all end all Darwinists pretend it to be: Moreover

Evolution by Splicing – Comparing gene transcripts from different species reveals surprising splicing diversity. – Ruth Williams – December 20, 2012 Excerpt: A major question in vertebrate evolutionary biology is “how do physical and behavioral differences arise if we have a very similar set of genes to that of the mouse, chicken, or frog?”,,, A commonly discussed mechanism was variable levels of gene expression, but both Blencowe and Chris Burge,,, found that gene expression is relatively conserved among species. On the other hand, the papers show that most alternative splicing events differ widely between even closely related species. “The alternative splicing patterns are very different even between humans and chimpanzees,” said Blencowe.,,, http://www.the-scientist.com/?articles.view%2FarticleNo%2F33782%2Ftitle%2FEvolution-by-Splicing%2F Gene Regulation Differences Between Humans, Chimpanzees Very Complex – Oct. 17, 2013 Excerpt: Although humans and chimpanzees share,, similar genomes (70% per Tomkins), previous studies have shown that the species evolved major differences in mRNA expression levels.,,, http://www.sciencedaily.com/releases/2013/10/131017144632.htm "Where (chimps and humans) really differ, and they differ by orders of magnitude, is in the genomic architecture outside the protein coding regions. They are vastly, vastly, different.,, The structural, the organization, the regulatory sequences, the hierarchy for how things are organized and used are vastly different between a chimpanzee and a human being in their genomes." Raymond Bohlin (per Richard Sternberg) - 9:29 minute mark of video https://vimeo.com/106012299 podcast: Dr. Richard Sternberg presents evidence that refutes the myth that the human genome is full of junk DNA. http://www.discovery.org/multimedia/audio/2014/11/on-human-origins-is-our-genome-full-of-junk-dna/#more-26791

and I repeat, mutations to developmental Gene Regulatory Networks are 'always catastrophically bad':

Stephen Meyer - Responding to Critics: Marshall, Part 2 (developmental Gene Regulatory Networks) - video https://www.youtube.com/watch?v=Cg8Mhn2EKvQ

bornagain77

wd400, not only are you completely wrong about genetic similarity, you are, at an even more fundamental level of theoretical importance, also completely wrong with your belief in the modern synthesis. i.e. With your reliance on the 'bottom up' modern synthesis of neo-Darwinism, you simply are not even in the right ballpark to begin with. Dr. Meyer puts the insurmountable problem for neo-Darwinists like this.

Stephen Meyer - Functional Proteins and Information for Body Plans - video https://vimeo.com/91322260 Dr. Stephen Meyer comments at the end of the preceding video,,, ‘Now one more problem as far as the generation of information. It turns out that you don’t only need information to build genes and proteins, it turns out to build Body-Plans you need higher levels of information; Higher order assembly instructions. DNA codes for the building of proteins, but proteins must be arranged into distinctive circuitry to form distinctive cell types. Cell types have to be arranged into tissues. Tissues have to be arranged into organs. Organs and tissues must be specifically arranged to generate whole new Body-Plans, distinctive arrangements of those body parts. We now know that DNA alone is not responsible for those higher orders of organization. DNA codes for proteins, but by itself it does not insure that proteins, cell types, tissues, organs, will all be arranged in the body. And what that means is that the Body-Plan morphogenesis, as it is called, depends upon information that is not encoded on DNA. Which means you can mutate DNA indefinitely. 80 million years, 100 million years, til the cows come home. It doesn’t matter, because in the best case you are just going to find a new protein some place out there in that vast combinatorial sequence space. You are not, by mutating DNA alone, going to generate higher order structures that are necessary to building a body plan. So what we can conclude from that is that the neo-Darwinian mechanism is grossly inadequate to explain the origin of information necessary to build new genes and proteins, and it is also grossly inadequate to explain the origination of novel biological form.’ Stephen Meyer - (excerpt taken from Meyer/Sternberg vs. Shermer/Prothero debate - 2009) "These different sources of epigenetic information in embryonic cells pose an enormous challenge to the sufficiency of the neo-Darwinian mechanism. According to neo-Darwinism, new information, form, and structure arise from natural selection acting on random mutations arising at a very low level within the biological hierarchy—within the genetic text. Yet both body-plan formation during embryological development and major morphological innovation during the history of life depend upon a specificity of arrangement at a much higher level of the organizational hierarchy, a level that DNA alone does not determine. If DNA isn’t wholly responsible for the way an embryo develops—for body-plan morphogenesis—then DNA sequences can mutate indefinitely and still not produce a new body plan, regardless of the amount of time and the number of mutational trials available to the evolutionary process. Genetic mutations are simply the wrong tool for the job at hand." Stephen Meyer - Darwin's Doubt (p. 281) https://uncommondescent.com/epigenetics/epigenetics-why-it-is-a-problem-for-darwinism/ Darwin's Doubt narrated by Paul Giem - The Origin of Body Plans - video http://www.youtube.com/watch?list=PLHDSWJBW3DNUaMy2xdaup5ROw3u0_mK8t&v=rLl6wrqd1e0&feature=player_detailpage#t=290 Body Plans Are Not Mapped-Out by the DNA - Jonathan Wells - video http://www.youtube.com/watch?v=meR8Hk5q_EM

bornagain77

Mapou: "They are close to us genetically because we were designed by intelligent beings who did what intelligent designers everywhere always do: they reuse existing designs as much as possible." Even though I agree that there is design involved, your argument here is based on a statistical degrees of freedom of zero. And as anyone with even the most basic knowledge of statistics knows, drawing any conclusions by extrapolating from a single point is not possible. We cannot rely on comparing what we see in biology to all known designers because we only know of one designer, humans. To be taken seriously we have to stop using this comparison. unwilling participant

T, true. wd400, by your own admission then, most of what you've said is irrelevant. Mung

unwilling:

Chimps are still our closest relative.

No, they are not our relatives because the word 'relative' implies a family relation that involves procreation. They are close to us genetically because we were designed by intelligent beings who did what intelligent designers everywhere always do: they reuse existing designs as much as possible. In software engineering, it's called "adding functionality through class inheritance." Is a corvette a relative of a Ferrari, a horse drawn carriage or an SUV? No, they may just share similar designs (wheels, rear view mirrors, headlights, etc.) Mapou

BA, I already told you why Tomkins is wrong, if you don't want to learn that's fine, got back to link spamming. Timeaus, I din't "ignore" anything. I only replied to the bit that bore any relation to anything I have said. No one is under any obligation to reply point by point to everything you say. wd400

wd400: I see you ignored the most important part of my post. My agreement that the genomic similarity is high was merely prefatory to my more important point, which is that it doesn't matter that it's high, because no matter how high it is, the further inferences that all or many Darwinians draw from the similarity (e.g., there is no design, human beings are nothing special, chimps should have legal rights) are unwarranted. It's precisely because those further inferences are unwarranted that I'm not at all threatened by the genomic similarity, whether the number is 99%, 94%, 89%, or whatever. And the other side of the coin, which you seem to miss, is that atheists/materialists are just as guilty of making too much of the numbers, since they don't in themselves establish anything that's of interest. Timaeus

My understanding of genome comparisons, and it is by no means comprehensive, is that the % similarity depends on the way the comparison is made. But regardless of the method used, chimps still come out as the closest to humans. Do does it really matter whether it is 99%, 95% or 90%? Chimps are still our closest relative. unwilling participant

wd400, you are proven wrong. The data itself is what proves you wrong. Whereas, I can not stop you from lying about what the evidence says. In other words, Tomkins has access to the unfiltered raw data and that is what he bases his 70% analysis on. That you would try to belittle him to try to discredit his work is a typical dishonest tactic of Darwinists. Of related interest, Tomkins had a similar disagreement with Darwinists over the raw genetic data on the alleged chromosome fusion site that he debunked:

according to Miller. The fusion site is “more than 1,300 bases away from the gene,” he says, based on a review of major gene databanks. “These increasingly desperate efforts to ‘debunk’ the chromosome 2 story have failed before, and they’ve failed this time, too,” Miller concludes. https://uncommondescent.com/intelligent-design/so-why-are-the-human-and-chimpanzeebonobo-genomes-so-similar-a-reply-to-professor-larry-moran/#comment-493752 So who’s right: Tomkins or Miller? Short answer: Tomkins. Here’s a short reply from an academic who teaches microbiology: ENCODE is right. Tomkins pulls the data from ENCODE and there is clearly a gene transcribed across the fusion event. The gene is rather larger than the 1500 bp that Miller quotes. The gene is a helicase (if I remember correctly) expressed in various tissues throughout development. If you read Tomkins’ paper, he demonstrates where the supposed telomere ends are located, where additional centromeres are supposedly located, and how the region is transcriptionally active (a hallmark associated with non-telomeric DNA). https://uncommondescent.com/intelligent-design/so-why-are-the-human-and-chimpanzeebonobo-genomes-so-similar-a-reply-to-professor-larry-moran/#comment-493752 DNA slam dunk! - Jeffrey Tomkins' interview - Jan. 30, 2015 - video https://www.youtube.com/watch?v=jZoto0nyHho Ken Miller personally admitted to Dr Tomkins that he was wrong about chromosome fusion (11:00 minute mark).

Seeing as Tomkins pretty much single handedly debunked Chromosome fusion, and had Miller personally concede that to him that he had done so, then I'm sticking with Tomkins's assessment of the inherent bias with which Darwinists drastically 'pre-filter' the similarity data to fit their preconceived conclusion. You guys simply have no credibility with me. a few more notes on the fusion controversy:

Alleged Human Chromosome 2 “Fusion Site” Encodes an Active DNA Binding Domain Inside a Complex and Highly Expressed Gene—Negating Fusion - by Jeffrey P. Tomkins - October 16, 2013 http://www.answersingenesis.org/articles/arj/v6/n1/human-chromosome-fusion Human Chromosome Fusion Debunked - Jeffrey P. Tomkins - Oct. 26, 2013 http://designed-dna.org/blog/files/3e06d2e493f6210f9ceaaf555397ec29-86.php Defenders Of The Evolutionary ‘Consensus’ Could Benefit From More Fact Checking - Casey Luskin - Aug. 27, 2014 Excerpt: Mooney,, took aim at a creationist biologist named Jeff Tomkins who had searched gene databases and discovered that the purported “fusion” point in human chromosome 2 is actually part of a functional gene. Quoting Kenneth Miller, an evolutionary biologist from Brown University, Mooney wrote: "But that’s just wrong, according to Miller. The fusion site is “more than 1,300 bases away from the gene,” he says, based on a review of major gene databanks. “These increasingly desperate efforts to ‘debunk’ the chromosome 2 story have failed before, and they’ve failed this time, too,” Miller concludes." Actually Mooney was wrong. When challenged privately, Dr. Miller conceded that the fusion point was only far away from the gene when one excludes results from a genomic database called “refseq.” When refseq is included, a longer gene transcript is found — produced by a section of DNA that includes the fusion site. Miller admitted the mistake to Tomkins: “in this transcript, the fusion site is in the middle of the first [gene] exon as you note.” Somehow Mooney failed to mention that inconvenient fact. Mooney apparently wanted to give the impression that the “fusion site” is useless junk DNA, produced by random evolutionary mutations. The evidence suggests otherwise — it’s an important, functional gene. http://www.theblaze.com/contributions/defenders-of-the-evolutionary-consensus-could-benefit-from-more-fact-checking-2/# Tomkins defended himself from another Darwinist here Jeff Tomkins response (1): I used the complete chimp and gorilla GULO genome sequences as queries against the human GULO region as a target database. This was all done on a local server and the human GULO database was constructed using the makeblastdb tool. I had to use optimized sequence slices to determine the similarity since the transposable element fragment differences, which are very large in this region as previously noted by several evolutionary authors, made the alignments highly discontinuous. In contrast, you did NOT do a one-to-one genomic regional comparison for the gulo region in human to the gulo region in chimpanzee. You also used human GULO as the query sequence and the entire chimp genome as the target database. Therefore, because you used the standard default web server blastn parameters, your alignment was chained across the entire chimp genome – which included partial sequence ‘best’ matches. ============== Jeff Tomkins response (2): No, basically you are wrong and you are merely pushing your evolutionary agenda and fake information in disregard of the scientific evidence. And you are misrepresenting my work with your imaginations. You invited me to download data which I already did and presented in a thorough peer-reviewed paper – and you didn’t like it because it conflicted with your presuppositions. Well, I downloaded the data again for good measure and this time performed a MUSCLE alignment which shows the same thing I reported in my paper. You can access this data here. http://www.designed-dna.org/resources/human-chimp_gulo_muscle_alignment.png

bornagain77

I'd rather be related to slime than a chimp! Who's with me?

And the Lord God formed man of the slime of the earth: and breathed into his face the breath of life, and man became a living soul.

Mung

Timaeus @29: Whew. For a bit there I thought you were talking about me! Mung

http://mbe.oxfordjournals.org/content/24/10/2266.full.pdf+html

Mapping Human Genetic Ancestry Ingo Ebersberger,*
§k Petra Galgoczy, Stefan Taudien, Simone Taenzer, Matthias Platzer, and Arndt von Haeseler*
§k The human genome is a mosaic with respect to its evolutionary history. Based on a phylogenetic analysis of 23,210 DNA sequence alignments from human, chimpanzee, gorilla, orangutan, and rhesus, we present a map of human genetic ancestry. For about 23% of our genome, we share no immediate genetic ancestry with our closest living relative, the chimpanzee. This encompasses genes and exons to the same extent as intergenic regions. We conclude that about 1/3 of our genes started to evolve as human-specific lineages before the differentiation of human, chimps, and gorillas took place. This explains recurrent findings of very old human-specific morphological traits in the fossils record, which predate the recent emergence of the human species about 5-6 MYA. Furthermore, the sorting of such ancestral phenotypic polymorphisms in subsequent speciation events provides a parsimonious explanation why evolutionary derived characteristics are shared among species that are not each other’s closest relatives.?

Jim Smith

The importance of genetic similarities between species is that it tells us, when considered along with the fossil record, how fast DNA changes. When correlated with laboratory experiements (Douglas Axe et al.) and population genetics, population size, generation time, etc, we can begin investigate if natural causes can really explain the rate of genetic change. In order to do this investigation you need objective unbiased data on the genetic differences between species. Jim Smith

News. It's ~99% identity whatever you may prefer to think. Nothing about that fact means genetics isn't important. "Genetics", after all, includes all the genetic sequences that control the timing and location of gene expression too. BA, If you keep reading rubbish like Luskin and Tomkins, you will keep being wrong about this topic. It seems you can't be dissuaded form that, so, one more time I'll repeat myself. The raw data underlying my claim is freely available, please prove me wrong if you can. wd400

Here is another article on the bias of Darwinists in 'filtering data' Contradictory Trees: Evolution Goes 0 For 1,070 - Whif - Cornelius Hunter Excerpt: One of evolution’s trade secrets is its prefiltering of data to make it look good, but now evolutionists are resorting to postfiltering of the data as well.,,, Prefiltering is often thought of merely as cleaning up the data. But prefiltering is more than that, for built-in to the prefiltering steps is the theory of evolution. Prefiltering massages the data to favor the theory. The data are, as philosophers explain, theory-laden. But even prefiltering cannot always help the theory.,,, http://darwins-god.blogspot.com/2013/06/contradictory-trees-evolution-goes-0.html Comprehensive Analysis of Chimpanzee and Human Chromosomes Reveals Average DNA Similarity of 70% by Jeffrey Tomkins on February 20, 2013 Excerpt: there is a great deal of preferential and selective treatment of the data being analyzed. In many cases, only the most promising data such as gene-rich sequences that exist in both species (homologs) is utilized from a much larger data pool. This pre-selected data is often further subjected to more filtering before being analyzed and discussed. Non-alignable regions and large gaps in DNA sequence alignments are also typically omitted, thus increasing the levels of reported similarity. https://answersingenesis.org/answers/research-journal/v6/comprehensive-analysis-of-chimpanzee-and-human-chromosomes/ The Myth of 98% Genetic Similarity between Humans and Chimps – Jeffrey Tomkins PhD. – video https://vimeo.com/95287522 bornagain77

WD400:

Good. I hope you can convince your fellow-travelers to stop embarrassing themselves on this topic.

I think you should give the same advice to Darwinists such as yourself. The reason that some ID proponents resisted the chimp-human similarity is that you Darwinists love to use it as strong evidence for Darwinian evolution and common descent but not for ID. This is a lie, of course. It is also strong evidence for intelligent design. It's time for you to go back to school and learn a thing or two about intelligent design. Mapou

wd400, states:

98-99% identity is for the whole genome. The idea that it applies only to protein coding genes really is truly a myth. As I keep saying — the raw data is available. If I’m wrong it shouldn’t be hard to show it.

and yet this was posted right before he stated that:

Human lincRNA Regions Vastly Different from Chimpanzee by Jeffrey Tomkins, Ph.D – 2014 Excerpt: My recent research report describes the use of regions of the human genome that correspond to three different human lincRNA datasets and one vlincRNA (very long intergenic non-coding RNA) dataset in an exhaustive comparison to the chimpanzee genome. In summary, the short human lincRNA regions (less than 600 DNA bases in length) were about 75% to 79% similar to chimpanzee, while the larger lincRNA regions (greater than 600 bases) were about 71% to 74% similar. And the human vlincRNA genomic regions were only 67% similar to chimpanzee. To provide a high-similarity contrast for this study, I also compared the protein-coding regions of the human genome, called exons, that were between 300 and 599 bases in length—the ideal size for optimally aligning them to chimpanzee DNA without having to slice them into smaller pieces. In contrast to the lower similarity observed for the lincRNA and vlincRNA regions, all known human protein-coding exons 300 to 599 bases in length were 86% similar to chimpanzee. These data included the fact that over 6% of human protein-coding exons of this size have no similar counterpart in the chimpanzee. http://www.icr.org/article/8227/ Groundbreaking Genetic Discoveries Challenge Ape to Human Evolutionary Theory – June 17, 2013 Excerpt: Dr. Tomkins further emphasized that evolutionists greatly exaggerate the genetic similarities between humans and chimps, and often ignore areas of DNA where major differences do exist. “It’s called cherry-picking the data,” he explained. “There are many genetic regions between humans and chimps that are radically different. In fact, humans have many sections of DNA that are missing in chimps and vice versa. Recent research is now showing that the genomes are only 70% similar overall.”,,, Study Reports a Whopping “23% of Our Genome” Contradicts Standard Human-Ape Evolutionary Phylogeny – Casey Luskin – June 2011 Excerpt: For about 23% of our genome, we share no immediate genetic ancestry with our closest living relative, the chimpanzee. This encompasses genes and exons to the same extent as intergenic regions. We conclude that about 1/3 of our genes started to evolve as human-specific lineages before the differentiation of human, chimps, and gorillas took place. (of note; 1/3 of our genes is equal to about 7000 genes that we do not share with chimpanzees) DNA Comparisons between Humans and Chimps – Fazale Rana Excerpt: It is interesting that when evolutionary biologists discuss genetic comparisons between human and chimpanzee genomes, the fact that, again, as much as 25 percent of the two genomes won’t align receives no mention. Instead, the focus is only on the portions of the genome that display a high-degree of similarity. This distorted emphasis makes the case for the evolutionary connection between humans and chimps seem more compelling than it may actually be. Ten years on, still much to be learned from human genome map – April 12, 2013 Excerpt:,,,”What’s more, about 10 percent of the human genome still hasn’t been sequenced and can’t be sequenced by existing technology, Green added. “There are parts of the genome we didn’t know existed back when the genome was completed,” he said.,,, Recent Genetic Research Shows Chimps More Distant From Humans,,, – Jan. 2010 Excerpt: A Nature paper from January, 2010 titled, “Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content,” found that Y chromosomes in humans and chimps “differ radically in sequence structure and gene content,” showing “extraordinary divergence” where “wholesale renovation is the paramount theme.”,,, “Even more striking than the gene loss is the rearrangement of large portions of the chromosome. More than 30% of the chimp Y chromosome lacks an alignable counterpart on the human Y chromosome, and vice versa,,,” A False Trichotomy Excerpt: The common chimp (Pan troglodytes) and human Y chromosomes are “horrendously different from each other”, says David Page,,, “It looks like there’s been a dramatic renovation or reinvention of the Y chromosome in the chimpanzee and human lineages.”

Willful blindness at its worse? Tomkins comments on the severe bias of Darwinists here in omitting dissimilar data that does not agree with their preferred conclusion:

Human and Chimp DNA--Nearly Identical? by Jeffrey Tomkins, Ph.D. - 2014 Excerpt: Major research published over the past decade comparing human and chimpanzee DNA was recently reviewed and critiqued.1 In every single publication, researchers only reported on the highly similar DNA sequence data and discarded the rest—apparently because it was too dissimilar. In fact, when the DNA similarities from these studies were recalculated using the omitted data, markedly lower levels—between 81 and 86 percent similarity—were found. Even the well-known chimpanzee genome paper published by evolutionists in 2005 provides a genomic similarity of only about 80 percent when the discarded nonsimilar data are included and only 70 percent when the estimated size of the chimpanzee genome is incorporated.2,3,,, Not counting the Y-chromosome, the results of my comparison showed variability between 66 and 76 percent similarity for the different chimp chromosomes, with an overall genome average of only 70 percent similarity to human chromosomes. In reality, many chromosomal regions are vastly different between chimps and humans, and several areas of the genome that are present in chimps are completely absent in humans—and vice versa. While it is true that there are sections of the chimp genome that are very similar to humans, this is not the complete picture. DNA sequence comparisons that include all the relevant data plainly show that the human and chimp genomes are not nearly identical at all. Instead, they are as distinct as one might expect based on the obvious differences in the resulting anatomies and behavioral capacities. Hypothetical evolutionary processes cannot explain the extremely broad differences between chimp and human DNA when the whole genomes are considered. The similar regions between genomes are easily interpreted as the basic reuse of effective code—a concept very familiar to software engineers.,,, http://www.icr.org/article/7892/

Moreover, the modern synthesis, which wd400 holds to be true, is found to be false (which is another fact that he will refuse to admit):

"Physiology Is Rocking the Foundations of Evolutionary Biology": Another Peer-Reviewed Paper Takes Aim at Neo-Darwinism - Casey Luskin March 31, 2015 Excerpt: Noble doesn't mince words: "It is not only the standard 20th century views of molecular genetics that are in question. Evolutionary theory itself is already in a state of flux (Jablonka & Lamb, 2005; Noble, 2006, 2011; Beurton et al. 2008; Pigliucci & Muller, 2010; Gissis & Jablonka, 2011; Shapiro, 2011). In this article, I will show that all the central assumptions of the Modern Synthesis (often also called Neo-Darwinism) have been disproved." Noble then recounts those assumptions: (1) that "genetic change is random," (2) that "genetic change is gradual," (3) that "following genetic change, natural selection leads to particular gene variants (alleles) increasing in frequency within the population," and (4) that "inheritance of acquired characteristics is impossible." He then cites examples that refute each of those assumptions,,, He then proposes a new and radical model of biology called the "Integrative Synthesis," where genes don't run the show and all parts of an organism -- the genome, the cell, the body plan, everything -- is integrated. http://www.evolutionnews.org/2015/03/physiology_is_r094821.html Modern Synthesis Of Neo-Darwinism Is False – Denis Noble – video https://vimeo.com/115822429 ,, In the preceding video, Dr Nobel states that around 1900 there was the integration of Mendelian (discrete) inheritance with evolutionary theory, and about the same time Weismann established what was called the Weismann barrier, which is the idea that germ cells and their genetic materials are not in anyway influenced by the organism itself or by the environment. And then about 40 years later, circa 1940, a variety of people, Julian Huxley, R.A. Fisher, J.B.S. Haldane, and Sewell Wright, put things together to call it ‘The Modern Synthesis’. So what exactly is the ‘The Modern Synthesis’? It is sometimes called neo-Darwinism, and it was popularized in the book by Richard Dawkins, ‘The Selfish Gene’ in 1976. It’s main assumptions are, first of all, is that it is a gene centered view of natural selection. The process of evolution can therefore be characterized entirely by what is happening to the genome. It would be a process in which there would be accumulation of random mutations, followed by selection. (Now an important point to make here is that if that process is genuinely random, then there is nothing that physiology, or physiologists, can say about that process. That is a very important point.) The second aspect of neo-Darwinism was the impossibility of acquired characteristics (mis-called “Larmarckism”). And there is a very important distinction in Dawkins’ book ‘The Selfish Gene’ between the replicator, that is the genes, and the vehicle that carries the replicator, that is the organism or phenotype. And of course that idea was not only buttressed and supported by the Weissman barrier idea, but later on by the ‘Central Dogma’ of molecular biology. Then Dr. Nobel pauses to emphasize his point and states “All these rules have been broken!”. Professor Denis Noble is President of the International Union of Physiological Sciences.

Of supplemental note: Here is a recent article by Tomkins which shows that the mechanism of Horizontal Gene Transfer does not even begin to explain the dissimilarity in genomes being found

Another Horizontal Gene Transfer Fairy Tale by Jeffrey P. Tomkins, Ph.D. - April 6, 2015 Excerpt: First, the researchers found unique genes in a variety of fruit flies, worms, primates, and humans that had no clear evolutionary ancestry. In other words, each of these genes is specific to a certain type of creature. Scientists have previously termed these "orphan genes"—a unique type of gene that provides a clear anti-evolutionary enigma I have discussed in previous reports.3,4 Some claim these novel orphan sequences evolved suddenly out of non-coding DNA while others, such as the authors of this new report, claim they were derived from HGT. The major problem with claiming that these alleged HGT genes are imported or "foreign" (i.e., transferred into the genome from some other creature), is that many of them encode important enzymatic proteins and are key parts of the interconnected gene networks and complex biochemical pathways that are essential to the very life of the organism. The researchers stated, "The majority of these genes are concerned with metabolism." Clearly, the genes are not foreign at all, but designed to function as key parts of essential biologically complex systems. Second, the approach to supposedly identifying many of the foreign genes in animals as microbial in origin was not even based on actual complete gene sequence, but depended upon isolated regions of similarity in the proteins they encode. In mammals, genes are quite complex, and on average only about 10% of the entire gene sequence actually codes for protein, the rest contains a large diversity of regulatory sequences that determine how the gene is to function and its various types of products. In contrast, microbial genes are typically much less complex and lack these intricate and intervening regulatory regions found in animal genes. If the researchers had actually compared the genomic DNA, very little similarity would have been discovered—in other words, they didn't do their homework correctly. In fact, they admitted their claim that the gene was foreign—or where it originated from—was purely hypothetical, when they stated that "absolute certainty in the assignment of most HGT is unachievable." Third, no mechanism of HGT for any of the hundreds of alleged "foreign genes" they found was either discovered or even suggested. This is due to the fact that the only cases where such gene transfer occurs in nature typically involves a clear host-parasite relationship. Not only that, but the cells of the germline (those that produce sperm and egg) must be specifically targeted or the introgressed genes (those that were incorporated from one species into the genome of another) will not be inherited. Unfortunately, evolutionary biologists constantly resort to fictional stories cloaked in technical terminology to escape the straightforward conclusion that the genomes of different creatures were purposefully crafted. Because of their unwavering commitment to evolution, all ideas about these cleverly designed and network-integrated gene sequences being engineered by a Creator are not considered—at least not openly. http://www.icr.org/article/another-horizontal-gene-transfer-fairy

bornagain77

If the 99% claim were correct, it would merely mean that genetics does not tell us very much about a life form. Anyone can tell the difference between a chimpanzee and a human being. I don't care one way or the other, but prefer to think - for the present - that genetics is informative, and that the people quoting the lower figures are correct. News

I am not offended to share 50% DNA with bananas. I also respect pickle rights: https://m.youtube.com/watch?v=3ob5sU0XRuk ppolish

I’m one ID proponent who is not “offended” by genomic similarity to chimpanzee

Good. I hope you can convince your fellow-travelers to stop embarrassing themselves on this topic. wd400

wd400: I'm one ID proponent who is not "offended" by genomic similarity to chimpanzees. Further, I find the responses of some ID proponents, e.g., that the similarity is not 99%, but only 94%, to be beside the point, which is that the similarity is very large. But why shouldn't it be? Anyone can see by simple observation that chimpanzees are very similar in many ways to human beings, and one would expect that this similarity would be reflected in the genetic material (though of course the genes alone are not the only determinant of an organism's properties). I don't see that the similarities in genomes has anything to do with the question of design in living systems. A sufficiently intelligent designer could employ many common design elements to create different overall results (e.g., as different computers can employ RAM, hard drives,etc. in similar ways), and such a designer could also devise an evolutionary program which was designed to generate new species from old. Thus, both "creationism" (e.g., Ross) and "evolutionism" (e.g., Denton) can be compatible with "design," and ID has no built-in objection to references to chimp/human similarities, or even to speculations about historical relationships between chimps and humans; such relationships in themselves don't threaten inferences of design. I think the deeper objection to discussion of chimp-human comparisons is not at bottom genetic, but ethical or spiritual. The point is that, physical similarities notwithstanding, we are very different in crucial ways from chimpanzees and from all other creatures on the planet. Where Darwinian or other evolutionary theory is employed to blur these differences, or deny their existence, then the ethical or spiritual objections come into play. Silly ideas about giving chimps legal rights are an example of this blurring. From what I'm told, cabbages (or is it bananas?) have 60% of the same genes as humans, so should they have 60% of the legal rights of humans? The arguments on this front are just plain stupid. Legal rights are not apportioned, and should not be apportioned, on the basis of information that can only be obtained with microscopes and complex scientific equipment. Chimpanzees are morally and politically irresponsible creatures, and even their greatest intellectual achievements are accomplished only when they are aided by human teaching and intervention. Chimpanzees *in nature* cannot employ symbolic language, for example; only with long training instigated by humans do they learn to manipulate symbols as humans do. And language in that sense is crucial for the moral/legal/social life typical of human beings. A person who cannot recognize the key macroscopic differences between a chimp and a human is a fool, even if he has a Ph.D. in comparative genomics and is celebrated in academic circles for his obscure technical articles. And it's on the basis of macroscopic differences that legal and political rights are assigned. Of course, this does not mean that we cannot or should not have laws restricting what we do to chimpanzees or other creatures. But to base those laws on a conception of "human rights" designed for fully rational, fully linguistic, fully moral creatures is idiotic. You of course do not torture an animal unnecessarily; but the reason for that is not that the animal has the "inalienable rights" guaranteed by the American constitution. "All men are created equal" does not mean "all creatures with X% or higher genomic similarity to man are created equal." The Founders certainly knew the difference between an ape (back when "ape" was defined properly) and a man, and they had no intention whatsoever of granting constitutional rights to the former. Timaeus

The molecular machinery depicted in this Ted Talk is 100% Chimp and/or Human I presume? https://m.youtube.com/watch?v=WFCvkkDSfIU The "1%" difference is in the output of the common DNA replicator machine? That is so incredible. How about a Banana? Same machine? ppolish

Ok WD, I accept your apology. ppolish

pp, I don't won't people to be offended, so of course I'm sorry when someone learns a fact about the world that upsets them. No snark there. But, as I say, whether you or anyone else takes offensive to something doesn't make it more or less true. wd400

WD, no reason for you to be sorry. You asked why some people are "put off" and I gave you a reason. Are you truly sorry or were you just being snarky:( ppolish

98-99% identity is for the whole genome. The idea that it applies only to protein coding genes really is truly a myth. As I keep saying -- the raw data is available. If I'm wrong it shouldn't be hard to show it. wd400

Seversky: I agree with Barry above that you have missed the article's point. You seem to be reading too quickly. And that is not surprising. You seem to comment on column after column here, but never stay long on any one column long enough to have a sustained, back-and-forth discussion with anyone, a discussion where points and arguments are exchanged and people on both sides modify their views. Your approach, for the most part, is scattershot. You toss in a drive-by comment, then move on to the next column which catches your interest, toss in another drive-by comment, move on again, etc. Most people who respond to you don't get even a single reply to their responses. It's as if you have what teachers for the past few years have been calling "ADD" -- attention deficit disorder -- and are unable to stay long at any one task, being too easily distracted by background activity in your environment. You would achieve more intellectual growth if you commented on fewer columns here, but engaged at length in those few places with your critics and questioners. Your current approach is unlikely to teach you anything. Certainly it does not teach anyone else here anything. Drive-by shots at the opinions of others, unsustained by argumentation, are worthless to a learning community. Think about it, Seversky. Are you happy to be the village's cranky old man, taking shots at everyone else's position? Or do you wish to participate in the life of the village, by having genuine sustained dialogue with the village's other members? Speaking for myself, at least, I don't feel you've engaged my last four or five objections to your posts, and to me that makes your posts of little to no value. And I am inclined to think that someone who does not respond to reasoned objections to his comments cannot defend those comments; that is the most economical explanation of quick exits when challenges are given. Timaeus

wd400, you, the supposedly educated one, are the one embarrassing yourself against someone who is supposedly uneducated in these matters. Coyne is, IMHO, underestimating the extent that ORFan genes are found,, as the papers I referenced under the Coyne quote make clear. Moreover, I already noted that the protein coding regions only encompass approx. 2% of the genome. Yet you falsely said that I was considering the whole genome in the comparison. Yet, if the entire genome is included, as you accused me of doing in my reference to ORFans, then, as you well know but are apparently too dishonest to admit, the percentage difference between chimps and humans greatly increases from your desired 99% mark which you are falsely claiming is true, apparently, for the entire genome now. If you are not claiming that the entire genome is 99% similar then perhaps you need to rewrite what you wrote so as to not make it appear as if your are claiming 99% similarity for the entire genome?

Human lincRNA Regions Vastly Different from Chimpanzee by Jeffrey Tomkins, Ph.D - 2014 Excerpt: My recent research report describes the use of regions of the human genome that correspond to three different human lincRNA datasets and one vlincRNA (very long intergenic non-coding RNA) dataset in an exhaustive comparison to the chimpanzee genome. In summary, the short human lincRNA regions (less than 600 DNA bases in length) were about 75% to 79% similar to chimpanzee, while the larger lincRNA regions (greater than 600 bases) were about 71% to 74% similar. And the human vlincRNA genomic regions were only 67% similar to chimpanzee. To provide a high-similarity contrast for this study, I also compared the protein-coding regions of the human genome, called exons, that were between 300 and 599 bases in length—the ideal size for optimally aligning them to chimpanzee DNA without having to slice them into smaller pieces. In contrast to the lower similarity observed for the lincRNA and vlincRNA regions, all known human protein-coding exons 300 to 599 bases in length were 86% similar to chimpanzee. These data included the fact that over 6% of human protein-coding exons of this size have no similar counterpart in the chimpanzee. http://www.icr.org/article/8227/ Groundbreaking Genetic Discoveries Challenge Ape to Human Evolutionary Theory – June 17, 2013 Excerpt: Dr. Tomkins further emphasized that evolutionists greatly exaggerate the genetic similarities between humans and chimps, and often ignore areas of DNA where major differences do exist. “It’s called cherry-picking the data,” he explained. “There are many genetic regions between humans and chimps that are radically different. In fact, humans have many sections of DNA that are missing in chimps and vice versa. Recent research is now showing that the genomes are only 70% similar overall.”,,, http://christiannews.net/2013/06/17/groundbreaking-genetic-discoveries-challenge-ape-to-human-evolutionary-theory/ Study Reports a Whopping "23% of Our Genome" Contradicts Standard Human-Ape Evolutionary Phylogeny - Casey Luskin - June 2011 Excerpt: For about 23% of our genome, we share no immediate genetic ancestry with our closest living relative, the chimpanzee. This encompasses genes and exons to the same extent as intergenic regions. We conclude that about 1/3 of our genes started to evolve as human-specific lineages before the differentiation of human, chimps, and gorillas took place. (of note; 1/3 of our genes is equal to about 7000 genes that we do not share with chimpanzees) http://www.evolutionnews.org/2011/06/study_reports_a_whopping_23_of047041.html DNA Comparisons between Humans and Chimps - Fazale Rana Excerpt: It is interesting that when evolutionary biologists discuss genetic comparisons between human and chimpanzee genomes, the fact that, again, as much as 25 percent of the two genomes won’t align receives no mention. Instead, the focus is only on the portions of the genome that display a high-degree of similarity. This distorted emphasis makes the case for the evolutionary connection between humans and chimps seem more compelling than it may actually be. http://www.reasons.org/dna-comparisons-between-humans-and-chimps-response-venema-critique-rtb-human-origins-model-part-2 Ten years on, still much to be learned from human genome map - April 12, 2013 Excerpt:,,,"What's more, about 10 percent of the human genome still hasn't been sequenced and can't be sequenced by existing technology, Green added. "There are parts of the genome we didn't know existed back when the genome was completed," he said.,,, http://medicalxpress.com/news/2013-04-ten-years-human-genome.html Recent Genetic Research Shows Chimps More Distant From Humans,,, - Jan. 2010 Excerpt: A Nature paper from January, 2010 titled, "Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content," found that Y chromosomes in humans and chimps "differ radically in sequence structure and gene content," showing "extraordinary divergence" where "wholesale renovation is the paramount theme.",,, “Even more striking than the gene loss is the rearrangement of large portions of the chromosome. More than 30% of the chimp Y chromosome lacks an alignable counterpart on the human Y chromosome, and vice versa,,," http://www.evolutionnews.org/2010/04/recent_genetic_research_shows.html A False Trichotomy Excerpt: The common chimp (Pan troglodytes) and human Y chromosomes are “horrendously different from each other”, says David Page,,, “It looks like there’s been a dramatic renovation or reinvention of the Y chromosome in the chimpanzee and human lineages.” https://uncommondescent.com/intelligent-design/a-false-trichotomy/

bornagain77

PP, I'm sorry you find the fact your DNA is so similar to a chimp's offensive. I'm afraid your taking offense doesn't make it any less true. BA, Coyne is wrong about the extend of orphans in the human genome. But even you take that quote on face value it does not say 6% of the genome is oprhan genes, but 6% of the genes. For 1600 genes to be ~6% of the genes Coyne must be talking about protein coding genes, which make about 2% of the genome. So even taking Coyne's old numbers, we end up with .02 * .06 = .0012 of the genome in orphans. A tenth of a percent, which I think even you will agree is not >5%. You can avoid these embarrassing mistakes if yo bothered to learn a little biology, but I can't imagine yo will. wd400

The Darwinist's lame argument is that the similarity between chimp and human DNA is evidence for Darwinism but not for ID. How lame. I don't see that at all. I see it as a prime example of intelligent reuse in design. Personally, I am delighted to be closely related to apes. Apes are magnificently designed creatures. So are we. But humans are much more advanced than apes because the human brain was designed to interface with the spirit realm. It was designed to serve as a receptacle for a spiritual entity. As Genesis put it, Yahweh framed the spirit of man within him. He did not do the same for apes and other animals. Mapou

as to: "BA and the absurd claim that orphan genes make up more than 5% of the human genome." And yet, as was already referenced, but was ignored by wd400, there is more than 5% ORFan genes in the human genome as even arch-militant atheist Jerry Coyne admits:

“More than 6 percent of genes found in humans simply aren’t found in any form in chimpanzees. There are over fourteen hundred novel genes expressed in humans but not in chimps.” Jerry Coyne – ardent and ‘angry’ neo-Darwinist – professor at the University of Chicago in the department of ecology and evolution for twenty years. He specializes in evolutionary genetics. Finding Protein-Coding Genes through Human Polymorphisms – January 2013 Excerpt: We found 5,737 putative protein-coding genes that do not exist in the reference, whose protein-coding status is supported by homology to known proteins. On average 10% of these genes are located in the genomic regions devoid of annotated genes in 12 other catalogs. Our statistical analysis showed that these ORFs are unlikely to occur by chance. http://www.plosone.org/article/info:doi/10.1371/journal.pone.0054210 Mechanisms and dynamics of orphan gene emergence in insect genomes – January 2013 Excerpt: Orphans are an enigmatic portion of the genome since their origin and function are mostly unknown and they typically make up 10 to 30% of all genes in a genome. http://gbe.oxfordjournals.org/content/early/2013/01/24/gbe.evt009.full.pdf+html

As to the fact that the 2% of DNA that codes for proteins (i.e. genes) is vastly overrated, well that fact is blatantly obvious. Even if Darwinists could account for the origination of new ORFan protein/genes, (or the transformation of existing protein into a similar protein of a different function), which they can't explain by astronomical margins, the Darwinists still have not gone one inch of a thousand miles towards explaining the regulatory mechanisms that tell those proteins where, when, and how, to be used in an organism. Talbott puts this vast void in Darwinian explanations for 'form', (i.e. body plans), like this:

HOW BIOLOGISTS LOST SIGHT OF THE MEANING OF LIFE — AND ARE NOW STARING IT IN THE FACE - Stephen L. Talbott - May 2012 Excerpt: “If you think air traffic controllers have a tough job guiding planes into major airports or across a crowded continental airspace, consider the challenge facing a human cell trying to position its proteins”. A given cell, he notes, may make more than 10,000 different proteins, and typically contains more than a billion protein molecules at any one time. “Somehow a cell must get all its proteins to their correct destinations — and equally important, keep these molecules out of the wrong places”. And further: “It’s almost as if every mRNA [an intermediate between a gene and a corresponding protein] coming out of the nucleus knows where it’s going” (Travis 2011),,, Further, the billion protein molecules in a cell are virtually all capable of interacting with each other to one degree or another; they are subject to getting misfolded or “all balled up with one another”; they are critically modified through the attachment or detachment of molecular subunits, often in rapid order and with immediate implications for changing function; they can wind up inside large-capacity “transport vehicles” headed in any number of directions; they can be sidetracked by diverse processes of degradation and recycling... and so on without end. Yet the coherence of the whole is maintained. The question is indeed, then, “How does the organism meaningfully dispose of all its molecules, getting them to the right places and into the right interactions?” The same sort of question can be asked of cells, for example in the growing embryo, where literal streams of cells are flowing to their appointed places, differentiating themselves into different types as they go, and adjusting themselves to all sorts of unpredictable perturbations — even to the degree of responding appropriately when a lab technician excises a clump of them from one location in a young embryo and puts them in another, where they may proceed to adapt themselves in an entirely different and proper way to the new environment. It is hard to quibble with the immediate impression that form (which is more idea-like than thing-like) is primary, and the material particulars subsidiary. Two systems biologists, one from the Max Delbrück Center for Molecular Medicine in Germany and one from Harvard Medical School, frame one part of the problem this way: "The human body is formed by trillions of individual cells. These cells work together with remarkable precision, first forming an adult organism out of a single fertilized egg, and then keeping the organism alive and functional for decades. To achieve this precision, one would assume that each individual cell reacts in a reliable, reproducible way to a given input, faithfully executing the required task. However, a growing number of studies investigating cellular processes on the level of single cells revealed large heterogeneity even among genetically identical cells of the same cell type. (Loewer and Lahav 2011)",,, And then we hear that all this meaningful activity is, somehow, meaningless or a product of meaninglessness. This, I believe, is the real issue troubling the majority of the American populace when they are asked about their belief in evolution. They see one thing and then are told, more or less directly, that they are really seeing its denial. Yet no one has ever explained to them how you get meaning from meaninglessness — a difficult enough task once you realize that we cannot articulate any knowledge of the world at all except in the language of meaning.,,, http://www.netfuture.org/2012/May1012_184.html#2

bornagain77

"Why do you think people are so put out by sharing such similar DNA to chimps?" Because being called similiar to a Chimp is an insult? Same thing with Pig. PigChimp is kind of fun though. Look, if DNA can't explain the differences between Chimp & Man, why should it be assumed to show similarity? Irrational and illogical. Same with Universal Common Descent. Universal lol. ppolish

There is no One True Metric for genetic simlarity, if you prefer 95% that's fine. But the 99% identity between like bases is not a "myth", it's there for everyone to see.

DNA is way overrated...

Maybe, but it remains the case that IDers and creationists twist themselves in knots to deny the 99% identity. Tomkins and his papers, BA and the absurd claim that orphan genes make up more than 5% of the human genome. Why do you think people are so put out by sharing such similar DNA to chimps? wd400

bornagain77 @ 5

Thus, where Darwinists most need plasticity in the genome to be viable as a theory, (i.e. developmental Gene Regulatory Networks), is the place where mutations are found to be ‘always catastrophically bad’. Yet, it is exactly in this area of the genome (i.e. regulatory networks) where substantial, ‘orders of magnitude’, differences are found between even supposedly closely related species. Needless to say, this is the exact opposite finding for what Darwinism would have predicted for what should have been found in the genome. If Darwinism were a normal science, instead of a faith based belief system for atheists, this finding would count as a solid falsification.

Great remark and great citations. Thanks. harry

DNA is way overrated as a way to understand the difference in Chimp vs Neanderthal or Sapien. Overrated and useless really. Same thing with Sapien versus Banana. But DNA and DNA replication is a great example of Design. Unguided and Random and Ooops are becoming dustbinned very quickly. Exciting times. Science waking up. https://m.youtube.com/watch?v=WFCvkkDSfIU ppolish

Joe, ORFans by themselves exceed that 95% difference bornagain77

Then the 95% is a better value for indicating the difference. Joe

"which differ by one base 2/3rds identical. I think that’s pretty obviously wrong." What is 'pretty obviously wrong' is Darwinists trying to force fit the sequence data into their preconceived conclusion of common ancestry and ignoring all the other data that does not fit their preconceived conclusion. Moreover, genetic sequences that won't align to the Darwinian narrative are just the tip of the iceberg of problems for Darwinists. For instance, here are few more problems: “Any transition of form is pure fantasy. There is no demonstration of it.” Douglas Axe - co-author of Science & Human Origins - video http://www.youtube.com/watch?v=XxMmLakH2LQ Thou Shalt Not Put Evolutionary Theory to a Test - Douglas Axe - July 18, 2012 Excerpt: "For example, McBride criticizes me for not mentioning genetic drift in my discussion of human origins, apparently without realizing that the result of Durrett and Schmidt rules drift out. Each and every specific genetic change needed to produce humans from apes would have to have conferred a significant selective advantage in order for humans to have appeared in the available time (i.e. the mutations cannot be 'neutral'). Any aspect of the transition that requires two or more mutations to act in combination in order to increase fitness would take way too long (greater than 100 million years). My challenge to McBride, and everyone else who believes the evolutionary story of human origins, is not to provide the list of mutations that did the trick, but rather a list of mutations that can do it. Otherwise they're in the position of insisting that something is a scientific fact without having the faintest idea how it even could be." Doug Axe PhD. http://www.evolutionnews.org/2012/07/thou_shalt_not062351.html More from Ann Gauger on why humans didn’t happen the way Darwin said - July 2012 Excerpt: Each of these new features probably required multiple mutations. Getting a feature that requires six neutral mutations is the limit of what bacteria can produce. For primates (e.g., monkeys, apes and humans) the limit is much more severe. Because of much smaller effective population sizes (an estimated ten thousand for humans instead of a billion for bacteria) and longer generation times (fifteen to twenty years per generation for humans vs. a thousand generations per year for bacteria), it would take a very long time for even a single beneficial mutation to appear and become fixed in a human population. You don’t have to take my word for it. In 2007, Durrett and Schmidt estimated in the journal Genetics that for a single mutation to occur in a nucleotide-binding site and be fixed in a primate lineage would require a waiting time of six million years. The same authors later estimated it would take 216 million years for the binding site to acquire two mutations, if the first mutation was neutral in its effect. Facing Facts But six million years is the entire time allotted for the transition from our last common ancestor with chimps to us according to the standard evolutionary timescale. Two hundred and sixteen million years takes us back to the Triassic, when the very first mammals appeared. One or two mutations simply aren’t sufficient to produce the necessary changes— sixteen anatomical features—in the time available. At most, a new binding site might affect the regulation of one or two genes. https://uncommondescent.com/intelligent-design/more-from-ann-gauger-on-why-humans-didnt-happen-the-way-darwin-said/ Ask an Embryologist: Genomic Mosaicism - Jonathan Wells - February 23, 2015 Excerpt: humans have a "few thousand" different cell types. Here is my simple question: Does the DNA sequence in one cell type differ from the sequence in another cell type in the same person?,,, The simple answer is: We now know that there is considerable variation in DNA sequences among tissues, and even among cells in the same tissue. It's called genomic mosaicism. In the early days of developmental genetics, some people thought that parts of the embryo became different from each other because they acquired different pieces of the DNA from the fertilized egg. That theory was abandoned,,, ,,,(then) "genomic equivalence" -- the idea that all the cells of an organism (with a few exceptions, such as cells of the immune system) contain the same DNA -- became the accepted view. I taught genomic equivalence for many years. A few years ago, however, everything changed. With the development of more sophisticated techniques and the sampling of more tissues and cells, it became clear that genetic mosaicism is common. I now know as an embryologist,,,Tissues and cells, as they differentiate, modify their DNA to suit their needs. It's the organism controlling the DNA, not the DNA controlling the organism. http://www.evolutionnews.org/2015/02/ask_an_embryolo093851.html Podcast - Richard Sternberg PhD - On Human Origins: Is Our Genome Full of Junk DNA? Part 5 (emphasis on ENCODE findings and the loss of the term 'gene' as a accurate description in biology and also how that loss undermines the modern synthesis of neo-Darwinism) http://www.discovery.org/multimedia/audio/2014/11/on-human-origins-is-our-genome-full-of-junk-dna-pt-5/ etc.. etc... bornagain77

Dont' ignore it Joe, but maybe read it. It's ~99% identity when comparing like bases (the thing I desribed above), the ~95% numbers includes sequences missing in one or other species. wd400

Humans and chimps have 95 percent DNA compatibility, not 98.5 percent, research shows Oh, but we can ignore that.... Joe

Oh, I forgot to mention Tomkins. His analyses are pretty seriously flawed. He doesn't allow gaps in sequence so he'd call these two sequences ... ATATAGAATGATGCTAGCATCGTGATGTAG ATATAGAATGATGCTAGCATGTGATGTAG ... which differ by one base 2/3rds identical. I think that's pretty obviously wrong. Again, the raw data is there, anyone who wants to can check for themselves. wd400

: "More than 6 percent of genes found in humans simply aren't found in any form in chimpanzees. There are over fourteen hundred novel genes expressed in humans but not in chimps." Jerry Coyne - ardent and 'angry' neo-Darwinist - professor at the University of Chicago in the department of ecology and evolution for twenty years. He specializes in evolutionary genetics. Finding Protein-Coding Genes through Human Polymorphisms - January 2013 Excerpt: We found 5,737 putative protein-coding genes that do not exist in the reference, whose protein-coding status is supported by homology to known proteins. On average 10% of these genes are located in the genomic regions devoid of annotated genes in 12 other catalogs. Our statistical analysis showed that these ORFs are unlikely to occur by chance. http://www.plosone.org/article/info:doi/10.1371/journal.pone.0054210 Mechanisms and dynamics of orphan gene emergence in insect genomes - January 2013 Excerpt: Orphans are an enigmatic portion of the genome since their origin and function are mostly unknown and they typically make up 10 to 30% of all genes in a genome. http://gbe.oxfordjournals.org/content/early/2013/01/24/gbe.evt009.full.pdf+html "However, with the advent of sequencing of full genomes, it became clear that approximately 20–40% of the identified genes could not be associated with a gene family that was known before. Such genes were originally called ‘orphan’ genes" http://ccsb.dfci.harvard.edu/web/export/sites/default/ccsb/publications/papers/2013/Tautz_eLS_2013.pdf Guy Walks Into a Bar and Thinks He's a Chimpanzee: The Unbearable Lightness of Chimp-Human Genome Similarity - Sternberg - 2009 Excerpt: One can seriously call into question the statement that human and chimp genomes are 99% identical. For one thing, it has been noted in the literature that the exact degree of identity between the two genomes is as yet unknown (Cohen, J., 2007. Relative differences: The myth of 1% Science 316: 1836.). ,,, In short, the figure of identity that one wants to use is dependent on various methodological factors. http://www.evolutionnews.org/2009/05/guy_walks_into_a_bar_and_think.html The Chimp-Human 1% Difference: A Useful Lie - 06/29/2007 Excerpt: But truth be told, Wilson and King also noted that the 1% difference wasn’t the whole story. They predicted that there must be profound differences outside genes—they focused on gene regulation—to account for the anatomical and behavioral disparities between our knuckle-dragging cousins and us. Several recent studies have proven them perspicacious again, raising the question of whether the 1% truism should be retired. “For many, many years, the 1% difference served us well because it was underappreciated how similar we were,” says Pascal Gagneux, a zoologist at UC San Diego. “Now it’s totally clear that it’s more a hindrance for understanding than a help.”,,, This is a very disturbing article. We have basically caught the Darwinists in a bald lie that has hoodwinked the world for over 30 years. Gagneux says, “For many, many years, the 1% difference served us well” – stop right there! Who is “us”? Was it the millions of school children and laymen who were lied to? Was it the majority of people who believe God created mankind, suffering under an onslaught of lies told in the name of science? No! “Us” refers to the members of the Darwin Party,,, http://creationsafaris.com/crev200706.htm#20070629a Chimp DNA Mutation Study—Selective Yet Surprising - Jeffrey Tomkins - August 16, 2014 Excerpt: It was initially noted by another group of evolutionary scientists that when comparing random chimp genomic sequence only "about two thirds could be unambiguously aligned to DNA sequences in humans”(2). In confirmation of this widely known, but seldom discussed, inconvenient fact among those evolutionists working in the field was a comprehensive study published in 2013 by this author (3). In that research, I compared each individual chimpanzee chromosome to human (piece-by-piece) and it was shown that the chimpanzee genome was only 70% similar on average to human, with only short regions being highly similar. ,,, 30% difference in their genomes—some 900,000,000 DNA letter differences.,,, When the entire genomes are compared between humans and chimps, it becomes clear that they were each engineered uniquely and separately by an Omnipotent Creator. http://www.designed-dna.org/blog/files/baf81fbc404eb8e24c9b6bd7953817c5-110.php Geneticist Jeff Tomkins vs. Evolutionary Biologist who got laughed off stage - August 12, 2013 Excerpt: Tomkins described the origin of the fallacious comparison as a myth that got started in reassociation kinetic methods of comparison in the mid-1970's prior to the advent of modern sequencing techniques (like Illumina and Solexa). Reassociation kinetics was a technique where fragments of chimp and human DNA were mixed in the same chemical soup, and the DNAs that were reasonably similar would pair up, hence we got a biased sampling! If we take genes that are found in both humans and chimps and disregard the indels, we get the 98% figure. When indels are considered, the similarity drops to 80-85%! When including other sequences, the similarity drops even further, down to 70%. But that 70% figure itself, imho, is too generous. I don’t think Tomkins used ORFans or pseudo genes or many other intergenic sequences, and he explicitly avoided the complication of Synteny.... Tomkins pointed also to reports where lab workers may have contaminated the sequencing labs for Chimps with their own human DNA and thus biasing the figures! Hence re-sequencing has been done, and there is more sequencing pending to clean up these errors. He joked about the coughing and sneezing that may have gone on to cause contamination. https://uncommondescent.com/genetics/icc-2013-geneticist-jeff-tomkins-vs-evolutionary-biologist-who-got-laughed-off-stage/ Human and Chimp DNA--Nearly Identical? by Jeffrey Tomkins, Ph.D. - 2014 Excerpt: Major research published over the past decade comparing human and chimpanzee DNA was recently reviewed and critiqued.1 In every single publication, researchers only reported on the highly similar DNA sequence data and discarded the rest—apparently because it was too dissimilar. In fact, when the DNA similarities from these studies were recalculated using the omitted data, markedly lower levels—between 81 and 86 percent similarity—were found. Even the well-known chimpanzee genome paper published by evolutionists in 2005 provides a genomic similarity of only about 80 percent when the discarded nonsimilar data are included and only 70 percent when the estimated size of the chimpanzee genome is incorporated.2,3,,, Not counting the Y-chromosome, the results of my comparison showed variability between 66 and 76 percent similarity for the different chimp chromosomes, with an overall genome average of only 70 percent similarity to human chromosomes. In reality, many chromosomal regions are vastly different between chimps and humans, and several areas of the genome that are present in chimps are completely absent in humans—and vice versa. While it is true that there are sections of the chimp genome that are very similar to humans, this is not the complete picture. DNA sequence comparisons that include all the relevant data plainly show that the human and chimp genomes are not nearly identical at all. Instead, they are as distinct as one might expect based on the obvious differences in the resulting anatomies and behavioral capacities. Hypothetical evolutionary processes cannot explain the extremely broad differences between chimp and human DNA when the whole genomes are considered. The similar regions between genomes are easily interpreted as the basic reuse of effective code—a concept very familiar to software engineers.,,, http://www.icr.org/article/7892/ Human and Chimp DNA--Nearly Identical? by Jeffrey Tomkins, Ph.D. - 2014 Excerpt: Major research published over the past decade comparing human and chimpanzee DNA was recently reviewed and critiqued.1 In every single publication, researchers only reported on the highly similar DNA sequence data and discarded the rest—apparently because it was too dissimilar. In fact, when the DNA similarities from these studies were recalculated using the omitted data, markedly lower levels—between 81 and 86 percent similarity—were found. Even the well-known chimpanzee genome paper published by evolutionists in 2005 provides a genomic similarity of only about 80 percent when the discarded nonsimilar data are included and only 70 percent when the estimated size of the chimpanzee genome is incorporated.2,3,,, Not counting the Y-chromosome, the results of my comparison showed variability between 66 and 76 percent similarity for the different chimp chromosomes, with an overall genome average of only 70 percent similarity to human chromosomes. In reality, many chromosomal regions are vastly different between chimps and humans, and several areas of the genome that are present in chimps are completely absent in humans—and vice versa. While it is true that there are sections of the chimp genome that are very similar to humans, this is not the complete picture. DNA sequence comparisons that include all the relevant data plainly show that the human and chimp genomes are not nearly identical at all. Instead, they are as distinct as one might expect based on the obvious differences in the resulting anatomies and behavioral capacities. Hypothetical evolutionary processes cannot explain the extremely broad differences between chimp and human DNA when the whole genomes are considered. The similar regions between genomes are easily interpreted as the basic reuse of effective code—a concept very familiar to software engineers.,,, http://www.icr.org/article/7892/ bornagain77

WHat is the actual % difference between human and chimp DNA? Tiger131

No wd400, no one has done a complete side-by-side comparison. So you aren't even wrong. Joe

One of the reasons the 99% 'myth'b won't die is that it's true. If you take a random stretch of human DNA and compare it to the equivalent sequence in a chimp then 98-99% of the bases will be identical (on average). Anyone doubting this is welcome to putting me wrong, here is an entire database of raw sequencing data, including human and chimp sequencing: http://www.ncbi.nlm.nih.gov/sra/?term=homo%5Borgn%5D+or+pan%5Borgn%5D wd400

Seversky

Rights are not somehow diluted by being extended to more individuals.

Rights are aligned with responsibilities. Rights are diluted when they're extended without regard to responsibilities that follow. The right to freedom is not extended to people (murderers) who don't want to act in accord with those rights. So, rights are reciprocal. Animals cannot express that reciprocity.

Isn’t the way we treat our fellow creatures a measure of how civilized we are?

Yes. But if we're the ones that grant rights, we're expressing our dominion. We can also limit rights based on limits in responsibilities. The owner of the company has more rights to decide its direction because he/she has more responsibility. He has greater responsibility for stewardship of assets.

Everybody here is rejecting the claim that having “dominion” means that we have absolute authority over them.

True. I thought your comments on the problems with Scriptural interpretation were insightful and reasonable also, but yes anyway, it's not a question of absolute authority with no responsibility for the creatures of earth, or of the earth itself.

The alternative concept of “stewardship” implies a duty of care.

Yes, true. Some 'rights' should and always have been extended to animals. There are animal cruelty laws -- even though it can seem strange that those rights are granted by carnivores. It's a lot more strange from a Darwinian perspective where it's all about undirected movements around fitness and reproductive advantage. We have dominion/stewardship from a God-centered view. We reflect the care that God has for his creatures. Silver Asiatic

@8 Andre The questions @7 are serious. The person who used that 'R' term in his comments should be able to answer those simple questions upon request. These days words have lost their meaning. We hear expressions like 'omg!' or 'amazing!' or 'absolutely!' or 'perfectly!' within any context, hence there are no words left to use in real situations where we need to describe something that is really absolutely amazing. But this world doesn't seem to care. Does it? We 'love' anything theses days: chocolate, to go somewhere, to do something, or sometimes 'love' somebody too. What does it mean in each case? Is it the definition given in Luke 6:32 or John 3:16? The latter is 'agape'. We can't 'agape' chocolate. At least I don't know how. I could say I like so much the taste of chocolate, i.e. I very much like what chocolate does to me. Now, back to 'Rights': What rights? According to whom? Based on what? In the first half of the 20th century, apparently many 'civilized' central Europeans, including some who 'claimed' to be Christians, believed they had the 'right' to do 'krystalnacht' and everything they did after that. What right? According to whom? Based on what? What do you think? Dionisio

Clearly Seversky wants apes and monkeys to be good citizens that pay their taxes and vote for the democratic far left. Andre

@2 Seversky

Does our occasional failure to uphold the rights of our fellow human beings prevent us from extending them to others? Rights are not somehow diluted by being extended to more individuals.

Rights ? According to whom? Based on what? Dionisio

Another place where ‘orders of magnitude’ differences are found between humans, chimps, (and all other animals), is in the ‘image of God’ that is uniquely inherent to man.

Evolution of the Genus Homo – Annual Review of Earth and Planetary Sciences – Ian Tattersall, Jeffrey H. Schwartz, May 2009 Excerpt: “Unusual though Homo sapiens may be morphologically, it is undoubtedly our remarkable cognitive qualities that most strikingly demarcate us from all other extant species. They are certainly what give us our strong subjective sense of being qualitatively different. And they are all ultimately traceable to our symbolic capacity. Human beings alone, it seems, mentally dissect the world into a multitude of discrete symbols, and combine and recombine those symbols in their minds to produce hypotheses of alternative possibilities. When exactly Homo sapiens acquired this unusual ability is the subject of debate.” http://www.annualreviews.org/doi/abs/10.1146/annurev.earth.031208.100202 Leading Evolutionary Scientists Admit We Have No Evolutionary Explanation of Human Language – December 19, 2014 Excerpt: Understanding the evolution of language requires evidence regarding origins and processes that led to change. In the last 40 years, there has been an explosion of research on this problem as well as a sense that considerable progress has been made. We argue instead that the richness of ideas is accompanied by a poverty of evidence, with essentially no explanation of how and why our linguistic computations and representations evolved.,,, (Marc Hauser, Charles Yang, Robert Berwick, Ian Tattersall, Michael J. Ryan, Jeffrey Watumull, Noam Chomsky and Richard C. Lewontin, “The mystery of language evolution,” Frontiers in Psychology, Vol 5:401 (May 7, 2014).) It’s difficult to imagine much stronger words from a more prestigious collection of experts. http://www.evolutionnews.org/2014/12/leading_evoluti092141.html

More interesting still, the three Rs, reading, writing, and arithmetic, i.e. the unique ability to process information inherent to man, are the very first things to be taught to children when they enter elementary school. And yet it is this information processing, i.e. reading, writing, and arithmetic, that is found to be foundational to life itself:

Signature in the Cell by Stephen Meyer – video clip https://www.youtube.com/watch?v=TVkdQhNdzHU

As well, as if that was not ‘spooky’ enough, information, not material, is found to be foundational to the universe itself:

“it from bit” Every “it”— every particle, every field of force, even the space-time continuum itself derives its function, its meaning, its very existence entirely—even if in some contexts indirectly—from the apparatus-elicited answers to yes-or-no questions, binary choices, bits. “It from bit” symbolizes the idea that every item of the physical world has a bottom—a very deep bottom, in most instances, an immaterial source and explanation, that which we call reality arises in the last analysis from the posing of yes-no questions and the registering of equipment—evoked responses, in short all matter and all things physical are information-theoretic in origin and this is a participatory universe.” – Princeton University physicist John Wheeler (1911–2008) (Wheeler, John A. (1990), “Information, physics, quantum: The search for links”, in W. Zurek, Complexity, Entropy, and the Physics of Information (Redwood City, California: Addison-Wesley)) Why the Quantum? It from Bit? A Participatory Universe? Excerpt: In conclusion, it may very well be said that information is the irreducible kernel from which everything else flows. Thence the question why nature appears quantized is simply a consequence of the fact that information itself is quantized by necessity. It might even be fair to observe that the concept that information is fundamental is very old knowledge of humanity, witness for example the beginning of gospel according to John: “In the beginning was the Word.” Anton Zeilinger – a leading expert in quantum teleportation: http://www.metanexus.net/archive/ultimate_reality/zeilinger.pdf Quantum physics just got less complicated – Dec. 19, 2014 Excerpt: Patrick Coles, Jedrzej Kaniewski, and Stephanie Wehner,,, found that ‘wave-particle duality’ is simply the quantum ‘uncertainty principle’ in disguise, reducing two mysteries to one.,,, “The connection between uncertainty and wave-particle duality comes out very naturally when you consider them as questions about what information you can gain about a system. Our result highlights the power of thinking about physics from the perspective of information,”,,, http://phys.org/news/2014-12-quantum-physics-complicated.html

Finding both life, and the universe itself, to be ‘information theoretic’ in their basis, and finding humans, among all creatures on earth, to uniquely possess the ability to understand, communicate, and create information, is certainly very strong support for the Christian belief that we humans were made in the image of God. (As well as strong support for a 'mechanism' as to how prayers can be effective) It is hard to imagine what a more convincing proof that we are made in the ‘image of God’ might look like. I guess a more convincing proof could be if God became a man, died on a cross, and rose from the dead, so as to prove He was God. But who has ever heard of such a thing as God becoming a mere man so as to save us from death? :)

Turin Shroud Hologram Reveals The Words ‘The Lamb’ – short video https://vimeo.com/97156784 Scientists say Turin Shroud is supernatural – December 2011 Excerpt: After years of work trying to replicate the colouring on the shroud, a similar image has been created by the scientists. However, they only managed the effect by scorching equivalent linen material with high-intensity ultra violet lasers, undermining the arguments of other research, they say, which claims the Turin Shroud is a medieval hoax. Such technology, say researchers from the National Agency for New Technologies, Energy and Sustainable Economic Development (Enea), was far beyond the capability of medieval forgers, whom most experts have credited with making the famous relic. “The results show that a short and intense burst of UV directional radiation can colour a linen cloth so as to reproduce many of the peculiar characteristics of the body image on the Shroud of Turin,” they said. And in case there was any doubt about the preternatural degree of energy needed to make such distinct marks, the Enea report spells it out: “This degree of power cannot be reproduced by any normal UV source built to date.” http://www.independent.co.uk/news/science/scientists-say-turin-shroud-is-supernatural-6279512.html

Verses and Music:

Philippians 2: 6-11 Who, being in very nature God, did not consider equality with God something to be used to his own advantage; rather, he made himself nothing by taking the very nature of a servant, being made in human likeness. And being found in appearance as a man, he humbled himself by becoming obedient to death—even death on a cross! Therefore God exalted him to the highest place and gave him the name that is above every name, that at the name of Jesus every knee should bow,in heaven and on earth and under the earth, and every tongue acknowledge that Jesus Christ is Lord, to the glory of God the Father. Genesis 1:26 And God said, Let us make man in our image, after our likeness: and let them have dominion over the fish of the sea, and over the fowl of the air, and over the cattle, and over all the earth, and over every creeping thing that creepeth upon the earth. John 1:1-4 In the beginning was the Word, and the Word was with God, and the Word was God. The same was in the beginning with God. All things were made by Him, and without Him was not anything made that was made. In Him was life, and that life was the Light of men. Casting Crowns – The Word Is Alive https://www.youtube.com/watch?v=X9itgOBAxSc

bornagain77

repost from 'Apes Is People' thread: The original 99% error came from a King and Wilson paper in 1975

In “Science,” 1975, M-C King and A.C. Wilson were the first to publish a paper estimating the degree of similarity between the human and the chimpanzee genome. This documented the degree of genetic similarity between the two! The study, using a limited data set, found that we were far more similar than was thought possible at the time. Hence, we must be one with apes mustn’t we? But…in the second section of their paper King and Wilson honestly describe the deficiencies of such reasoning: “The molecular similarity between chimpanzees and humans is extraordinary because they differ far more than sibling species in anatomy and way of life. Although humans and chimpanzees are rather similar in the structure of the thorax and arms, they differ substantially not only in brain size but also in the anatomy of the pelvis, foot, and jaws, as well as in relative lengths of limbs and digits (38). Humans and chimpanzees also differ significantly in many other anatomical respects, to the extent that nearly every bone in the body of a chimpanzee is readily distinguishable in shape or size from its human counterpart (38). Associated with these anatomical differences there are, of course, major differences in posture (see cover picture), mode of locomotion, methods of procuring food, and means of communication. Because of these major differences in anatomy and way of life, biologists place the two species not just in separate genera but in separate families (39). So it appears that molecular and organismal methods of evaluating the chimpanzee human difference yield quite different conclusions (40).” King and Wilson went on to suggest that the morphological and behavioral differences between humans and apes,, must be due to variations in their genomic regulatory systems. David Berlinski – The Devil’s Delusion – Page 162&163 Evolution at Two Levels in Humans and Chimpanzees Mary-Claire King; A. C. Wilson – 1975 Of note: In biology, a genus (plural: genera) is a taxonomic rank used in the biological classification of living and fossil organisms. In the hierarchy of biological classification, genus comes above species and below family.

The supposed 99% similarity between chimps and humans, that King and Wilson originally came up with, has now been found to be a fallacious number. Although the estimated genetic similarity has been falling for a few years, fairly recently Jeffrey Tomkins did a comprehensive genomic comparison and arrived at a 70% figure for genetic similarity instead of a 99% figure:

The Myth of 98% Genetic Similarity and Chromosome Fusion between Humans and Chimps – Jeffrey Tomkins PhD. – video https://vimeo.com/95287522 Comprehensive Analysis of Chimpanzee and Human Chromosomes Reveals Average DNA Similarity of 70% – by Jeffrey P. Tomkins – February 20, 2013 Excerpt: For the chimp autosomes, the amount of optimally aligned DNA sequence provided similarities between 66 and 76%, depending on the chromosome. In general, the smaller and more gene-dense the chromosomes, the higher the DNA similarity—although there were several notable exceptions defying this trend. Only 69% of the chimpanzee X chromosome was similar to human and only 43% of the Y chromosome. Genome-wide, only 70% of the chimpanzee DNA was similar to human under the most optimal sequence-slice conditions. While, chimpanzees and humans share many localized protein-coding regions of high similarity, the overall extreme discontinuity between the two genomes defies evolutionary timescales and dogmatic presuppositions about a common ancestor. http://www.answersingenesis.org/articles/arj/v6/n1/human-chimp-chromosome

Moreover, unexpected genetic similarity is found in radically different species, such as dolphins and kangaroos:

Richard Sternberg PhD – podcast – On Human Origins: Is Our Genome Full of Junk DNA? Part 2. (Major Differences in higher level chromosome spatial organization) 5:30 minute mark quote: “Basically the dolphin genome is almost wholly identical to the human genome,, yet no one would argue that bottle-nose dolphins are our sister species”,,, http://www.discovery.org/multimedia/audio/2014/11/on-human-origins-is-our-genome-full-of-junk-dna-pt-2/ Kangaroo genes close to humans Excerpt: Australia’s kangaroos are genetically similar to humans,,, “There are a few differences, we have a few more of this, a few less of that, but they are the same genes and a lot of them are in the same order,” ,,,”We thought they’d be completely scrambled, but they’re not. There is great chunks of the human genome which is sitting right there in the kangaroo genome,” http://www.reuters.com/article/science%20News/idUSTRE4AH1P020081118

Thus genetic similarity is not as good of a benchmark for inferring relationships as Darwinists had presupposed. Moreover, it is found that King and Wilson were correct in their hunch that genomic regulatory systems between chimps and humans would be found to be very different. The regulatory regions of the genomes between chimps and humans are found to be ‘orders of magnitude’ different:

“Where (chimps and humans) really differ, and they differ by orders of magnitude, is in the genomic architecture outside the protein coding regions. They are vastly, vastly, different.,, The structural, the organization, the regulatory sequences, the hierarchy for how things are organized and used are vastly different between a chimpanzee and a human being in their genomes.” Raymond Bohlin (per Richard Sternberg) – 9:29 minute mark of video https://vimeo.com/106012299 An Interview with Stephen C. Meyer TT: Is the idea of an original human couple (Adam and Eve) in conflict with science? Does DNA tell us anything about the existence of Adam and Eve? SM: Readers have probably heard that the 98 percent similarity of human DNA to chimp DNA establishes that humans and chimps had a common ancestor. Recent studies show that number dropping significantly. More important, it turns out that previous measures of human and chimp genetic similarity were based upon an analysis of only 2 to 3 percent of the genome, the small portion that codes for proteins. This limited comparison was justified based upon the assumption that the rest of the genome was non-functional “junk.” Since the publication of the results of something called the “Encode Project,” however, it has become clear that the noncoding regions of the genome perform many important functions and that, overall, the non-coding regions of the genome function much like an operating system in a computer by regulating the timing and expression of the information stored in the “data files” or coding regions of the genome. Significantly, it has become increasingly clear that the non-coding regions, the crucial operating systems in effect, of the chimp and human genomes are species specific. That is, they are strikingly different in the two species. Yet, if alleged genetic similarity suggests common ancestry, then, by the same logic, this new evidence of significant genetic disparity suggests independent separate origins. For this reason, I see nothing from a genetic point of view that challenges the idea that humans originated independently from primates, http://www.ligonier.org/learn/articles/scripture-and-science-in-conflict/

Moreover, if that was not bad enough for Darwinists, mutations to the developmental gene regulatory networks are found to be ‘always catastrophically bad’:

A Listener’s Guide to the Meyer-Marshall Debate: Focus on the Origin of Information Question -Casey Luskin – December 4, 2013 Excerpt: “There is always an observable consequence if a dGRN (developmental gene regulatory network) subcircuit is interrupted. Since these consequences are always catastrophically bad, flexibility is minimal, and since the subcircuits are all interconnected, the whole network partakes of the quality that there is only one way for things to work. And indeed the embryos of each species develop in only one way.” - Eric Davidson http://www.evolutionnews.org/2013/12/a_listeners_gui079811.html

Thus, where Darwinists most need plasticity in the genome to be viable as a theory, (i.e. developmental Gene Regulatory Networks), is the place where mutations are found to be ‘always catastrophically bad’. Yet, it is exactly in this area of the genome (i.e. regulatory networks) where substantial, ‘orders of magnitude’, differences are found between even supposedly closely related species. Needless to say, this is the exact opposite finding for what Darwinism would have predicted for what should have been found in the genome. If Darwinism were a normal science, instead of a faith based belief system for atheists, this finding would count as a solid falsification. Moreover, anatomically we are now found to be closer to pigs than to chimps.

A chimp-pig hybrid origin for humans? – July 3, 2013 Excerpt: Dr. Eugene McCarthy,, has amassed an impressive body of evidence suggesting that human origins can be best explained by hybridization between pigs and chimpanzees. Extraordinary theories require extraordinary evidence and McCarthy does not disappoint. Rather than relying on genetic sequence comparisons, he instead offers extensive anatomical comparisons, each of which may be individually assailable, but startling when taken together.,,, The list of anatomical specializations we may have gained from porcine philandering is too long to detail here. Suffice it to say, similarities in the face, skin and organ microstructure alone is hard to explain away. A short list of differential features, for example, would include, multipyramidal kidney structure, presence of dermal melanocytes, melanoma, absence of a primate baculum (penis bone), surface lipid and carbohydrate composition of cell membranes, vocal cord structure, laryngeal sacs, diverticuli of the fetal stomach, intestinal “valves of Kerkring,” heart chamber symmetry, skin and cranial vasculature and method of cooling, and tooth structure. Other features occasionally seen in humans, like bicornuate uteruses and supernumerary nipples, would also be difficult to incorporate into a purely primate tree. http://phys.org/news/2013-07-chimp-pig-hybrid-humans.html

Now to be sure, the Darwinist who put forward the idea that a pig/chimp hybrid produced humans was roundly condemned by other Darwinists. But the funny thing in all that condemnation from other Darwinists is that none of the other Darwinists who condemned his ‘heretical’ idea were able to refute his ‘pimp hybrid’ hypothesis with any real empirical evidence to the contrary:

Human hybrids: a closer look at the theory and evidence – July 25, 2013 Excerpt: There was considerable fallout, both positive and negative, from our first story covering the radical pig-chimp hybrid theory put forth by Dr. Eugene McCarthy,,,By and large, those coming out against the theory had surprisingly little science to offer in their sometimes personal attacks against McCarthy. ,,,Under the alternative hypothesis (humans are not pig-chimp hybrids), the assumption is that humans and chimpanzees are equally distant from pigs. You would therefore expect chimp traits not seen in humans to be present in pigs at about the same rate as are human traits not found in chimps. However, when he searched the literature for traits that distinguish humans and chimps, and compiled a lengthy list of such traits, he found that it was always humans who were similar to pigs with respect to these traits. This finding is inconsistent with the possibility that humans are not pig-chimp hybrids, that is, it rejects that hypothesis.,,, http://phys.org/news/2013-07-human-hybrids-closer-theory-evidence.html

Does anyone truly think that think that pigs, kangaroos, or dolphins, ought to be grouped anywhere near chimps as our next of kin on the imaginary cladograms of Darwinists? Thus, that pretty much renders these imaginary Darwinian cladograms useless as far as rigorous science is concerned. bornagain77

Seversky:

Why are people so offended by the prospect of being closely related to chimpanzees?

Why do people want to be closely related to chimps? Joe

Seversky @ 2: Why to miss the point. And you did miss the point, badly. Read the article again. Then come back and tell us why your comment at 2 is way off base. I know you can do it. Barry Arrington

Why are people so offended by the prospect of being closely related to chimpanzees? Does our occasional failure to uphold the rights of our fellow human beings prevent us from extending them to others? Rights are not somehow diluted by being extended to more individuals. Isn't the way we treat our fellow creatures a measure of how civilized we are? Everybody here is rejecting the claim that having "dominion" means that we have absolute authority over them. The alternative concept of "stewardship" implies a duty of care. Seversky

It's so hard to let go of this scientific myth becaue it sounds so persuasive! What's a little white lie matter as long as Darwin is being exalted and people are being influenced to follow him? tjguy